GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 23-35. doi:10.1111/j.1365-2443.2004.00811.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, J.
Right arrow Articles by Yamamura, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, J.
Right arrow Articles by Yamamura, H.

Lysosome is a primary organelle in B cell receptor-mediated apoptosis: an indispensable role of Syk in lysosomal function

Jinsong He1, Yumi Tohyama1, Ken-ichi Yamamoto2, Masahiko Kobayashi2, Yuhong Shi1, Tomoko Takano1, Chiseko Noda3, Kaoru Tohyama4 and Hirohei Yamamura1,*

1 Department of Genome Sciences, Kobe University Graduate School of Medicine, Kobe 650-0017, Japan
2 Department of Molecular Pathology, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan
3 Department of Nutrition Management, Hyogo University, Kakogawa 675-0101, Japan
4 Department of Laboratory Medicine and Clinical Pathology, Kawasaki Medical School, Kurashiki 701-0192, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
To investigate the mechanism of B cell receptor (BCR)-mediated apoptosis, we utilized immature B cell lines, DT40 and WEHI-231. In both cell lines, BCR-crosslinking caused the increase in lysosomal pH with early apoptotic changes characterized by chromatin condensation and phosphatidylserine exposure. This increase was detected in c-Abl-deficient DT40 cells but not in Syk-deficient cells, which corresponded to the fact that the former cells but not the latter revealed BCR-induced apoptosis. In contrast, BCR-crosslinking caused no apparent change in mitochondrial transmembrane potential. Therefore, the lysosomal change might be a primary event in BCR-induced apoptosis in DT40 cells. The increased activity of cathepsin B and apoptosis-preventing effect of a cathepsin inhibitor suggested a significant role of lysosomal enzymes in this apoptosis. By microscopic studies, lysosomes of wild-type DT40 cells fused to BCR-carrying endosomes became enlarged and accumulated one another. In contrast, these changes of lysosomal dynamics did not occur in Syk-deficient cells but transfer of wild-type Syk restored the lysosomal changes and apoptosis. These results demonstrated that the lysosomal change accompanied with the activation of lysosomal enzymes is a primary step in BCR-crosslinking-mediated apoptosis and Syk is responsible for this step through the fusion of BCR-carrying endosomes to lysosomes.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Apoptosis is the major mechanism by which superfluously damaged or dangerous cells are eliminated in multicellular organisms. In several apoptotic systems the disruption of the mitochondrial transmembrane potential (MTP) is believed to make a commitment to apoptosis (Marzo et al. 1998; Katz et al. 2001; Hase et al. 2002). In addition to mitochondria, growing evidence suggests a role of lysosomal functions on the initiation and execution of the apoptotic program. In particular the role of lysosomal enzymes has become clear in several models: a cysteine protease, cathepsin B, or an aspartic protease, cathepsin D, are released from the lysosomes into the cytosol or the nucleus (Deiss et al. 1996; Foghsgaard et al. 2001; Michallet et al. 2003; Bidere et al. 2003; Cirman et al. 2004; Guicciardi et al. 2004) and act as proteolytic enzymes. Once released from the lysosomes, these enzymes can contribute to the execution of apoptosis either by direct cleavage of cellular substrates (Broker et al. 2004) or by acting in concert with the caspases. In some cases they cause mitochondrial dysfunction mediated by one or more cytosolic factors (Bidere et al. 2003; Cirman et al. 2004). Apoptosis also plays a key role in the regulation of the immune system. In immature B cells the binding of an antigen to the B cell receptor (BCR) in the absence of costimulatory signals leads to induction of apoptosis and consequently controls or deletes autoreactive B cell clones (Tsubata et al. 1993; Nossal 1994). The immature cell lines, murine WEHI-231 and chicken DT40, have been widely used as model systems to study immature B cell tolerance based on their property to undergo apoptosis in response to BCR-crosslinking by anti-IgM antibodies (Takata et al. 1995; Katz et al. 2001; Herold et al. 2002; Mlinaric-Rascan & Turk 2003; Katz et al. 2004). Among them Katz et al. (2001, 2004) showed the involvement of BCR-induced disruption of MTP and postmitochondrial activation of cathepsin B using WEHI-231 cells. Takata et al. (1995) demonstrated using DT40 cells that cascades driven by the activation of Syk tyrosine kinase are essential for BCR-induced apoptosis. Syk is expressed in a wide range of haematopoietic and non-haematopoietic cells (Taniguchi et al. 1991; Coopman et al. 2000; Yanagi et al. 2001) and is a key molecule in the B cell development and the activation of B cells after antigen recognition by BCR (Kurosaki et al. 1994, 1995; Cheng et al. 1995; Turner et al. 1995). BCR-ligation produces multiple outcomes to the cells at various developmental stages of B cells such as apoptosis, proliferation or differentiation. In addition, Syk is critical in pre-BCR- and BCR-signalling at all stages from pre-B, immature B to mature B cells (Takata et al. 1994; Sada et al. 2001; Kurosaki 2002), but the precise mechanism by which Syk is involved in BCR-induced apoptosis remains unclear.

The aim of this study is to evaluate the mechanism by which BCR-ligation promotes apoptosis in the absence of an adequate costimulation and the functional relationship with the vesicular traffic of BCR and apoptotic pathways. Our findings showed that after BCR-crosslinking lysosomal permeability is enhanced with the release of lysosomal enzymes correlated with the early apoptotic hallmarks, suggesting that this lysosomal change is a primary step of BCR-induced apoptosis and Syk is responsible for this change through a fusion of BCR-carrying endosomes to lysosomes.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
BCR-crosslinking induces apoptosis in wild-type and c-Abl-deficient DT40 cells

To investigate the mechanism by which a commitment to B cell receptor (BCR)-mediated apoptosis is determined, we used immature B cell lines DT40 and WEHI-231 as model systems (Takata et al. 1995; Katz et al. 2001; Herold et al. 2002; Mlinaric-Rascan & Turk 2003; Katz et al. 2004). The levels of cell surface expression of BCR on wild-type, c-Abl-deficient and Syk-deficient DT40 cells were checked and found to be the same as one another (Fig. 1A).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1  Detection of BCR-crosslinking-induced apoptosis in DT40 and mutant cells. (A) Expression of cell surface IgM on DT40, their mutant cells and WEHI-231 cells. DT40 and WEHI-231 cells were stained with FITC-labelled anti-chicken IgM antibody or anti-mouse IgM antibody and with FITC-labelled secondary antibodies, respectively, for flow cytometry. (B) Morphological change in BCR-crosslinking-induced apoptosis of DT40 and mutant cells. The cells were harvested at 4 or 8 h after treatment with anti-IgM antibody (10 µg/mL) and their cytospin preparations were stained with May–Gruenwald-Giemsa. In the left panel arrows indicate the cells representing shrinkage and chromatin condensation. The right panel shows the percentage of apoptotic cells judging from the nuclear morphology. At least 200 cells were counted and the mean values and SD of triplicate experiments are presented. The statistically significant difference was assessed by the Student's t-test; **P < 0.01. (C) Flow cytometric analysis of BCR-crosslinking-induced apoptosis in DT40 and mutant cells. Wild-type, c-Abl-deficient and Syk-deficient DT40 cells were treated with anti-IgM antibody (10 µg/mL) for 16 h at 37 °C and then stained with fluorescence-conjugated annexinV and PI. AnnexinV-positive and PI-negative cells were considered apoptotic. The cells which were negative for both annexinV and PI were alive, and the cells which were only PI-positive were considered necrotic. The representative data from three independent experiments are shown. The right histogram shows the percentage of apoptotic cells (annexinV-positive and PI-negative). The mean values and SD of triplicate experiments are presented in the histogram. The statistically significant difference was assessed by the Student's t-test; **P < 0.01.

 
c-Abl is reported to be involved in the apoptotic response to the endoplasmic reticulum (ER) stress by targeting to mitochondria (Ito et al. 2001) and Syk is shown to be essential for BCR-induced apoptosis using DT40 cells (Takata et al. 1995). To assess the contribution of c-Abl and Syk to BCR-induced apoptosis, wild-type and the mutant DT40 cells were stimulated with anti-chicken IgM antibody. To clarify the property of BCR-induced apoptosis, chromatin condensation and phosphatidylserine exposure were examined as hallmarks of early phase of apoptosis. Figure 1B (left) shows the time-course change of nuclear morphology by May–Gruenwald-Giemsa staining of DT40 cells. At 4 h after BCR-crosslinking, about one-fourth of wild-type DT40 cells revealed shrinkage and chromatin condensation and about a half of the cells at 8 h after the stimulation. As shown in Fig. 1B (right), c-Abl-deficient cells underwent apoptosis as similar to wild-type cells in response to BCR-crosslinking, whereas Syk-deficient cells hardly revealed the finding of apoptosis as previously reported (Takata et al. 1995). Next we examined another early apoptotic marker, phosphatidylserine exposure by dual staining with fluorescence-conjugated annexin V and propidium iodide (PI). The percentage of wild-type DT40 cells undergoing apoptosis (annexin V positive and PI negative) was increased from 9.8 ± 3.4% to 54.5 ± 5.1% at 16 h after BCR-crosslinking. Under the same condition, the percentages of apoptotic c-Abl-deficient and Syk-deficient cells changed from 28.0 ± 3.0% to 69.0 ± 6.6% and from 5.5 ± 0.4% to 6.8 ± 0.8%, respectively (Fig. 1C).

Disruption of MTP and release of cytochrome c are not essential for BCR-induced apoptosis

On the basis of previous reports that BCR-crosslinking activates the mitochondria–mediated apoptotic pathway (Katz et al. 2001, 2004; Hase et al. 2002; Herold et al. 2002), we examined the disruption of MTP in DT40 and WEHI-231 cells. To analyse the change of MTP quantitatively the cells were crosslinked with anti-BCR antibodies and then the incorporation of Mitotracker Orange was measured by flow cytometry together with the binding of annexinV. In DT40 cells MTP was kept unchanged for 24 h (4 h, 8 h, 16 h and 24 h) after BCR-crosslinking. In WEHI-231 cells MTP was not changed at 4 h and 8 h (data not shown) but the disruption was detected at 16 h (Fig. 2A) and 24 h (data not shown) after BCR-crosslinking. These results indicated that the disruption of MTP is not essential for BCR-induced apoptosis in DT40 cells unlike WEHI-231 cells. To further investigate mitochondria-mediated apoptosis, release of cytochrome c from the mitochondria into the cytosol was assessed by immunoblotting analysis. After BCR-crosslinking the amount of cytochrome c in the cytosolic fraction increased in wild-type cells while both Syk-deficient and c-Abl-deficient cells showed only a negligible release of cytochrome c into the cytosol (Fig. 2B), suggesting that the degree of apoptosis and the release of cytochrome c were not parallel among mutant cell lines in BCR-induced apoptosis.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2  Effects of BCR-crosslinking on mitochondrial function in WEHI-231 and DT40 cells. (A) Changes of MTP and binding of annexinV after BCR-crosslinking in WEHI-231 and DT40 cells. WEHI-231 and DT40 cells were treated with or without anti-IgM antibody (10 µg/mL) for 16 h, further incubated with 100 nM Mitotracker Orange for 30 min at 37 °C and the fluorescence intensity was analysed by flow cytometry (upper panel). Binding of annexin V was also examined in such treated cells (lower panel). (B) The amount of cytochrome c in the cytosolic fraction after BCR-crosslinking. Wild-type, c-Abl-deficient and Syk-deficient DT40 cells were treated with anti-IgM antibody (10 µg/mL) for 4 or 6 h at 37 °C. Aliquots of cytosolic fractions were prepared and immunoblotting analysis was performed with mAbs against cytochrome c and {alpha}-tubulin as described in Experimental procedures. The data were quantitatively analysed by NIH Image 1.63. The shown result is the representative of three independent experiments.

 
Changes in lysosomal pH after BCR-crosslinking

We then directed our attention to the role of lysosomes in the apoptosis of these cells. The change in lysosomal pH was measured by flow cytometry with FITC-dextran, a pH-sensitive fluorescent probe that enters lysosomes via fluid-phase endocytosis (Hishita et al. 2001). In both DT40 and WEHI-231 cells BCR-crosslinking resulted in a gradual and time-dependent increase in fluorescence intensity up to 24 h, indicating that lysosomal pH was increased by BCR-crosslinking (Fig. 3A). The change in lysosomal pH showed a good correlation with early apoptotic hallmarks such as chromatin condensation and phosphatidylserine exposure (Fig. 3B), suggesting that this change may be involved in the initiation of the apoptotic program. Then we examined whether the change in lysosomal pH also correlates with the difference of early apoptotic hallmarks. After BCR-crosslinking c-Abl-deficient cells revealed a similar increase in lysosomal pH as wild-type cells, but Syk-deficient cells hardly showed the increase (Fig. 3A, lower), and this difference corresponded to the degree of apoptosis (Fig. 1B,C).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3  Effects of BCR-crosslinking on lysosomal function in WEHI-231 and DT40 cells. (A) Change of lysosomal pH in WEHI-231 and DT40 cells. Wild-type DT40 and WEHI-231 cells were treated with anti-IgM antibody (10 µg/mL), incubated for indicated times at 37 °C, and labelled with 0.65 mg/mL FITC-dextran for additional 30 min at 37 °C for flow cytometry. Upper panel shows the time-dependent increase in fluorescence intensity by incorporated FITC-dextran. In lower panel, the change of lysosomal pH was analysed on wild-type, c-Abl-deficient and Syk-deficient DT40 cells which were treated with or without anti-chicken IgM antibody (10 µg/mL) for 16 h at 37 °C. Mean fluorescence intensities were normalized to that of untreated wild-type cells. The mean values and SD of triplicate experiments are presented. The statistically significant difference was assessed by the Student's t-test; **P < 0.01. (B) Comparative study of the change of lysosomal pH and other apoptotic parameters in DT40 cells. Mean fluorescence intensities of incorporated FITC-dextran and annexin V were normalized to those before the treatment, and the percentage of apoptotic cells assessed by nuclear morphology were shown. (C) Microscopic detection of cathepsin B activity in living cells. WEHI-231 and DT40 cells treated (4 h) or untreated with anti-IgM antibody were incubated with cathepsin B substrate (z-Arginine-Arginine)2 derivatives of the cresyl violet fluorophore for 30 min. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope. (D) Effects of E64d and zVAD-fmk on BCR-induced apoptosis in DT40 cells. The cells pretreated with or without 100 µM E-64d, 100 µM zVAD-fmk were treated with or without anti-chicken IgM antibody (10 µg/mL). The left panel shows the effect of E64d or zVAD-fmk on the percentage of apoptotic cells judging from the nuclear morphology. At 4 h after the treatment at least 200 cells were counted and the mean values and SD of triplicate experiments are presented. The right panel shows the effect of E64d or zVAD-fmk on the binding of fluorescence-conjugated annexin V at 8 h after the treatment with or without anti-chicken IgM antibody (10 µg/mL). Mean fluorescence intensities were normalized to that of untreated wild-type cells. The statistically significant difference was assessed by the Student's t-test; **P < 0.01. (E) Detection of activated form of cathepsin B after BCR-crosslinking in WEHI-231 cells. WEHI-231 cells were treated with anti-IgM antibody (10 µg/mL) for 4, 8 or 16 h at 37 °C. Whole cell lysates were prepared and immunoblotting analysis was performed with polyclonal antibodies against cathepsin B as described in Experimental procedures. Arrows show 43 kDa-proenzyme, active 25 kDa or 31 kDa form. The shown result is the representative of three independent experiments.

 
Next, to clarify the mechanism of lysosomal pathway of BCR-induced apoptosis the effects of BCR-crosslinking on the activity and the distribution of lysosomal enzymes were analysed by focusing on cathepsin B, a major lysosomal cysteine protease, which is stable and active in neutral pH (Michallet et al. 2003; Cirman et al. 2004). Microscopic analysis detecting fluorescence-linked cathepsin B activity showed that in resting cells only punctate fluorescence was seen but after BCR-crosslinking fluorescence spread widely into the cytoplasmic region in addition to the augmented activity in the aggregated vesicles (Fig. 3C). Next, treatment with E64d, an inhibitor of cysteine proteases (especially of cathepsin B in lysosome) suppressed the progress of apoptosis but z-VAD-fmk, an inhibitor of pancaspases did not (Fig. 3D). Immunoblotting analysis revealed that a clear increase of the active bands of cathepsin B (43 kDa-proenzyme was processed into active 25 kDa- or 31 kDa-form) by proteolytic cleavage under BCR-crosslinking (Fig. 3E) These results indicated that cathepsin B contributes in part to the commitment to BCR-induced apoptosis.

BCR-crosslinking leads to enlargement and accumulation of lysosomes whose acidic nature was retained until the collapse of nuclear morphology

To identify the BCR-induced morphological changes of lysosomes, we labelled lysosomes with Lysotracker Green, which is a fluorescent acidic probe for labelling and tracing acidic organelles in living cells. In wild-type DT40 cells, quiescent lysosomes showed a punctate localization in the cytoplasm. After BCR-crosslinking lysosomes became enlarged and gradually accumulated one another and formed a focus in the cytoplasm (within 45 min at the latest), and these lysosomal changes persisted with acidic nature until the collapse of nuclear morphology (4 h; Fig. 4A, upper left). These changes in the distribution of lysosomes appeared the same as the localization of cathepsin B after BCR-crosslinking (Fig. 3C), and at 8 h or 16 h, these accumulated lysosomes were observed in most of cells that were still alive (data not shown). In contrast, neither enlargement nor accumulation of lysosomes was observed in Syk-deficient cells (Fig. 4A, upper right). In WEHI-231 cells, enlarged lysosomes were also observed (4 h; Fig. 4A, lower).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 4  Microscopic detection of lysosomal change after BCR-crosslinking. (A) Detection of lysosomal accumulation in DT40 cells and WEHI-231 cells after BCR-crosslinking. Wild-type and Syk-deficient cells were pretreated with anti-chicken IgM antibody (10 µg/mL) for 30 min at 4 °C. After washing, the cells were incubated for 45 min or 4 h at 37 °C and 1 µM Lysotracker Green was added for the last 30 min. WEHI-231 cells were pretreated with anti-mouse IgM antibody (10 µg/mL) for 30 min at 4 °C. After washing, the cells were incubated for 4 h at 37 °C and 1 µM Lysotracker Green was added for the last 30 min. Anti-IgM-untreated cells were also treated with Lysotracker Green for 30 min. Photos show the fluorescence and DIC images of the cells. (B) Detection of lysosomal fusion to BCR in DT40 cells after BCR-crosslinking. Wild-type and Syk-deficient cells were pretreated with FITC-conjugated anti-chicken IgM antibody (20 µg/mL) (green) for 30 min at 4 °C. After washing the cells were incubated for 45 min at 37 °C and 0.6 µM Lysotracker Red (red) was added for the last 30 min. For a control assay the cells were incubated firstly with Lysotracker Red for 30 min at 37 °C and then treated with FITC-conjugated anti-chicken IgM antibody for 30 min at 4 °C. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope. Photos show the fluorescence (IgM and Lysotracker) and merged (dual fluorescence and DIC: Merge/DIC) images of the cells.

 
On the hypothesis that the enlarged lysosomes are the result of fusion of BCR-containing early endosomes to lysosomes, we monitored both the movement of BCR and lysosomes at the same time with incubating the cells pretreated with FITC-anti-IgM antibody in the presence of Lysotracker Red. At first, BCR existed diffusely on the cell membrane and lysosomes showed a punctate localization in both wild-type and Syk-deficient cells, but with time crosslinked-BCR moved into the centre of accumulated lysosomes and fused each other in most of wild-type cells, whereas neither such a co-localization nor lysosomal fusion was observed in Syk-deficient cells (Fig. 4B). c-Abl-deficient DT40 cells showed the similar fusion and accumulation as wild-type cells (data not shown).

Transfer of wild-type Syk in Syk-deficient cells restores the BCR-induced lysosomal changes with apoptosis

To confirm an essential role of Syk in BCR-induced lysosomal changes, we transferred the Flag-tagged wild-type Syk or kinase-inactive Syk into Syk-deficient cells. The cell clones stably expressing either type of Syk were isolated and the amount of protein expression was examined by immunoblotting analysis using anti-Flag epitope mAb and anti-Syk polyclonal antibody (Fig. 5A). The levels of BCR expression on cell surface were found to be the same as parental Syk-deficient cells by flow cytometry with FITC-anti-chicken IgM antibody (data not shown). Then we examined the effects of transfer of wild-type Syk or kinase-inactive Syk on the change of lysosomal pH (Fig. 5B) and the percentage of apoptotic cells (Fig. 5C). Transfer of wild-type Syk but not kinase-inactive Syk into Syk-deficient cells restored the increase of lysosomal pH together with the increase in apoptotic cells (Fig. 5B,C).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5  Effects of transfer of Syk on change of lysosomal pH and annexinV expression. (A) Expression of transfered wild-type Syk or kinase-inactive Syk in Syk-deficient DT40 cells. Flag-tagged wild-type Syk was transferred into Syk-deficient cells and positive clones (Syk/Syk; cl.1, cl.3 and cl.10) were obtained. Similarly, Flag-tagged kinase-inactive Syk was transferred into Syk-deficient cells and positive clones (KDSyk/Syk–; cl.22 and cl.23) were obtained. Protein expression was confirmed by immunoblotting analysis using anti-Flag mAb (top panel) and anti-Syk polyclonal antibody (second panel). The same cell lysates were also examined with anti-ãtubulin mAb for the internal control. (B) Effect of transfer of Syk on change of lysosomal pH into Syk-deficient DT40 cells. (C) Effect of transfer of Syk on annexinV expression into Syk-deficient DT40 cells. In (B) and (C) wild-type cells, Syk-deficient cells and Syk-deficient cells transferred with wild-type Syk (Syk/Syk; clones 1, 3 or 10) or kinase-inactive Syk (KDSyk/Syk–; clones 22 and 23) were treated with or without anti-chicken IgM antibody (10 µg/mL) for 16 h at 37 °C. In (B) the cells were treated with FITC-dextran for detecting the change in lysosomal pH (the graph shows the mean fluorescence intensities normalized to that of untreated wild-type cells.), In (C) the cells were stained with fluorescence-conjugated annexin V and PI for detecting the percentage of apoptotic cells (annexin V positive and PI negative cells; lower panel). Both graphs show the mean values and SD of triplicate experiments. The statistically significant difference was assessed by the Student's t-test; *P < 0.05; **P < 0.01.

 
Next, effects of gene transfer on BCR-induced lysosomal accumulation were examined. Transfer of wild-type Syk but not kinase-inactive Syk into Syk-deficient cells brought about the lysosomal enlargement, accumulation and fusion to BCR-carrying endosomes at the same degree as wild-type cells (Fig. 6A,B).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6  Effects of transfer of Syk on lysosomal accumulation and fusion to BCR. (A) Effect of transfer of Syk on lysosomal accumulation into Syk-deficient DT40 cells. Syk-deficient cells transferred with wild-type Syk (Syk/Syk) or kinase-inactive Syk (KDSyk/Syk) were treated with anti-chicken IgM antibody (10 µg/mL) for 30 min at 4 °C. After washing the cells were further incubated for 45 min at 37 °C and 1 µM Lysotracker Green was added for the last 30 min. Photos show the fluorescence and DIC images of the cells. The histogram shows the percentage of the cells representing accumulation of lysosomes with or without anti-chicken IgM antibody. At least 100 cells were evaluated. (B) Effect of transfer of Syk on lysosomal fusion to BCR into Syk-deficient DT40 cells. Syk-deficient cells transferred with wild-type Syk (Syk/Syk–) or kinase-inactive Syk (KDSyk/Syk) were pretreated with FITC-conjugated anti-chicken IgM mAb (20 µg/mL) (green) for 30 min at 4 °C. After washing the cells were further incubated for 45 min at 37 °C and 0.6 µM Lysotracker Red (red) was added for the last 30 min. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope. Photos show the fluorescence (IgM and Lysotracker) and merged (dual fluorescence and DIC: Merge/DIC) images of the cells. The histogram shows the percentage of cells in which BCR-carrying endosomes fused to accumulated lysosomes with incubation at 37 °C or 4 °C. At least 100 cells were evaluated.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
It has been reported that a lot of signalling molecules are involved in BCR-induced apoptosis (Kurosaki 2002) but the question of how the apoptotic process is initiated and executed has not fully been elucidated. In the present study we have examined BCR-mediated apoptotic pathways from a viewpoint of the relation between the trafficking of BCR and lysosomes. We have obtained the results as follows: (1) the lysosomal change with enhanced permeability is a primary step in BCR-mediated apoptosis, and (2) Syk is responsible for the change in lysosomes through a fusion of BCR-carrying endosomes to lysosomes.

As previously reported, by crosslinking with anti-surface IgM antibody BCR is rapidly internalized (Ma et al. 2001; Stoddart et al. 2002) and BCR-carrying endosomes fuse to lysosomes (Siemasko et al. 1998). Then in this study we investigated how this dynamic movement of BCR leads to apoptosis and found that the change in lysosomal permeability, which might be a result of lysosomal fusion, is the first event that directly induces apoptosis. As for BCR-induced apoptosis some reports showed the involvement of mitochondrial pathway via the change of MTP (Katz et al. 2001, 2004; Herold et al. 2002), especially by the use of WEHI-231 cells. Then to prove the impact of the lysosomal pathway on BCR-induced apoptosis, we analysed WEHI-231 cells as well as DT40. Time course study revealed that WEHI-231 cells showed the similar increase in lysosomal pH to DT40 cells as shown in Fig. 3A (early increase occurred from 4 h after the stimulation; data not shown), but change of morphology occurred later than DT40 cells (from 16 h after the stimulation; data not shown) and coincided with the change of MTP (Fig. 2A and data not shown). Judging from these results, the increase in lysosomal pH is the common event in the early apoptosis both in DT40 cells and in WEHI-231 cells, but execution of apoptotic program is different between these cell lines. In DT40 cells lysosomal change rapidly links to nuclear disruption without any change in MTP and therefore the early phase of apoptosis seems to proceed independently of mitochondrial change. On the other hand, the change of MTP occurred in WEHI-231 cells in execution of the early phase of apoptosis. These distinct as well as common responses in both cell lines show a generality of lysosomal pathway of BCR-crosslinking-induced apoptosis in immature B cells.

We further utilized c-Abl-deficient DT40 cells in addition to Syk-deficient cells. Previous reports showed that c-Abl sometimes acts as a transducer of anti-apoptotic (Wang 2000; Cao et al. 2003) as well as pro-apoptotic (Ito et al. 2001) effector pathways according to the time and circumstances. In our experiments, the basal value of apoptosis in c-Abl-deficient DT40 cells was so high as compared to that of wild-type DT40 cells in the usual culture (Fig. 1C), but deficiency of c-Abl did not affect the increase in apoptosis induced by BCR-crosslinking. These results suggest that c-Abl acts as anti-apoptotic effector in the usual culture but does not affect the early events of BCR-induced apoptosis in DT40 cells. As c-Abl is involved in mitochondrial function in the case of ER-stress-induced apoptosis, it cannot be denied that c-Abl might act some roles in the late phase of apoptosis in WEHI-231 cells. As to cytochrome c release from mitochondria, the release was suppressed in c-Abl-deficient DT40 cells (Fig. 2B) in spite of the similar progression of apoptosis to wild-type cells (Fig. 1B,C) and therefore, cytochrome c release from mitochondria seems to be dispensable for BCR-induced apoptosis at least at the same time point when the lysosomal permeability is increased. Any way, these results strongly suggest that the fusion of BCR-carrying endosomes to lysosomes might act as an initiation signal of the apoptotic program and triggers the enhanced lysosomal permeability before lysosomal enzymes are released into the cytosol.

As described above, it is certain that at least a lysosomal protease acts as an executor of BCR-induced apoptosis but it appears to be difficult to specify what kind of enzymes actually act among lysosomal proteases. Cathepsin B is one of the most stable proteases at physiological pH. Microscopic analysis detecting fluorescence-linked cathepsin B activity revealed that after BCR-crosslinking active cathepsin B was released from lysosomes to cytosol (Fig. 3C) and a cathepsin B inhibitor E64d showed apoptosis-suppressing effect (Fig. 3D). Judging from these results, cathepsin B must contribute in part to the commitment to BCR-induced apoptosis, but other lysosomal enzymes will also participate in this process. In fact, one report using the same inhibitor indicated that BCR-driven nuclear fragmentation is independent of the activity of caspases and cathepsins (Mlinaric-Rascan & Turk 2003). Mlinaric-Rascan & Turk (2003) analysed the effect of the inhibitor at the final apoptotic stage, whereas we specified it at the early stage. In accordance with the progress of apoptosis, the more proteolytic enzymes might be involved. However, in contrast to our expectation, we found that after BCR-crosslinking accumulated lysosomes retained their morphology, acidic pH and activity of cathepsin B until the final stage of cell death (Figs 3C and 4A). We speculate that lysosomal proteases work tenaciously and lysosomes themselves function as the centre of degradation until the last stage of cell death.

It is known that an adequate costimulatory signalling from T cells can rescue B cells from BCR-mediated apoptosis (Hase et al. 2002; Katz et al. 2004). Therefore, a rescue-signalling to cancel apoptotic cell death might affect the lysosomal functions, but the significance of rescue-signalling in lysosomes remains to be determined.

There are a series of reports that Syk is a key molecule and indispensable for BCR-mediated signalling including apoptosis (Kurosaki et al. 1994, 1995; Takata et al. 1994, 1995; Cheng et al. 1995; Turner et al. 1995; Kurosaki 2002). However, BCR-crosslinking produces multiple outcomes to the cells at various developmental stages of B cells other than apoptosis, such as proliferation, survival and differentiation, and Syk also plays critical roles in all stages related to these signalling pathways (Takata et al. 1994; Sada et al. 2001; Kurosaki 2002). The precise mechanism by which Syk is involved in BCR-induced apoptosis remains unclear. Our study demonstrated that Syk plays an essential role in the dynamic changes of lysosomes, that is, their accumulation in the cytosol and fusion to BCR-carrying endosomes, and in this way Syk contributes to BCR-induced apoptosis. We showed that such a lysosomal-endosomal fusion did not occur in Syk-deficient DT40 cells but was restored by gene transfer of wild-type Syk into these cells accompanied with apoptosis (Figs 4A,B and 6A,B). To produce these effects on lysosomes, Syk may possibly be involved in such molecular mechanisms as the movement of BCR on the cell membrane, the accumulation of BCR at the raft (Stoddart et al. 2002; Gupta & DeFranco 2003), its internalization via clathrin (Stoddart et al. 2002) and polymerization of microtubules that support the endocytosis (Faruki et al. 2000). A recent report also suggests a mechanism that Syk is involved in the translocation of BCR into lipid rafts (Hao et al. 2004). In this report F-actin binding protein HS1 translocates into rafts dependently on Syk-mediated tyrosine phosphorylation in response to BCR-crosslinking. Because the requirement of tyrosine phosphorylation of HS1 by Syk to BCR-induced apoptosis was already reported (Yamanashi et al. 1997), BCR-accumulation at lipid rafts through Syk–HS1 pathway seems to be a possible event prior to fusion of BCR-endosomes to lysosomes. In fact, pretreatment with raft-modifying compound, methyl-ß-cyclodextrin (MCD), also known as a depleting agent of cholesterol, caused neither internalization of BCR nor fusion to lysosomes (data not shown).

To clarify the mechanism how Syk transduces signal from BCR to lysosomes, we examined the dynamics of Syk and tyrosine-phosphorylated proteins using immunofluorescence staining by analysing Syk-deficient DT40 cells over-expressing Flag-tagged human Syk. As a result, BCR-crosslinking led to the recruitment of Syk to the site of the cross-linked BCR at the plasma membrane as described in the previous reports (Ma et al. 2001; Gupta & DeFranco 2003). After that a part of Syk and tyrosine-phosphorylated proteins were detected under juxta-membrane in punctuate structure and the phosphorylation was completely attenuated at the time when the fusion of endosomes to lysosomes was almost finished (data not shown). In the case of kinase-inactive Syk, the increase of tyrosine phosphorylation was suppressed as indicated in the previous reports. From these results we expect that activity of Syk kinase is necessary for the formation and transport of BCR-endosomes to lysosomes, that is, movement of BCR to one pole on plasma membrane, internalization and vesicular transport to lysosomes.

In conclusion, a lysosomal pathway followed by the release of lysosomal enzymes is mainly involved in the initiation and/or execution of a BCR-mediated apoptosis, and this pathway originates in a fusion of BCR-carrying endosomes to lysosomes. Syk is considered to be responsible for this fusion.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cells and cell culture

WEHI-231, wild-type DT40 and its mutant cell clones were cultured in RPMI1640 medium (Sigma, St Louis, MO, USA) supplemented with 10% foetal calf serum (FCS) in 5% CO2 humidified air at 37 °C. Syk-deficient DT40 cells were generously provided by Dr Kurosaki (Takata et al. 1994) and c-Abl-deficient DT40 cells were established as previously described (Takao et al. 2000).

Antibodies and reagents

Anti-chicken IgM polyclonal antibody and its FITC-conjugated form were obtained from Bethyl Laboratories (Montgomery, TX, USA). Anti-mouse IgM polyclonal antibody F(ab’)2 for BCR-crosslinking was from Southern Biotechnology Associates, Inc. Anti-Flag epitope monoclonal antibody (mAb) M2 (Sigma), anti-{alpha}-tubulin mAb (Sigma), anti-Syk polyclonal antibody (Sc-1077, Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA), anti-cathepsin B polyclonal antibody (Upstate biotechnology, Lake Placid, NY) and anti-cytochrome c mAb (BD Pharmingen, San Diego, CA, USA) were used for immunoblotting. Anti-phosphotyrosine (4G10), FITC-conjugated mAb (Upstate biotechnology) and anti-Flag mAb M2, Cy3-conjugated form (Sigma) were used for immunofluorescent staining according to the manufacturer's recommendation. Vybrant Apoptosis Assay Kit #2 for detection of apoptosis, Mitotracker Orange, Lysotracker Green and Lysotracker Red were purchased from Molecular Probes, Inc (Eugene, OR, USA).

FITC-dextran (Sigma) was used for flow cytometric detection of the change in lysosomal pH. Hygromycin B and digitonin were purchased from Wako Pure Chemical Industries (Osaka, Japan). Cathepsin B detection kit, Magic Red, was obtained from Immunochemistry Technologies, LLC (Bloomington, MN, USA), a cathepsin B inhibitor, L-trans-Epoxysuccinyl-Leu-3-methylbutylamide ethyl ester (E64d), from Calbiochem (Cambridge, MA, USA), a caspases inhibitor, z-VAD-fmk, from Promega Corporation (Madison, WI, USA) and methyl-ß-cyclodextrin (MCD) from Sigma.

Site-directed mutagenesis and DNA transfection

Human syk cDNA, provided by Dr Muller (Muller et al. 1994) was modified with a Flag-epitope tag (DYKDDDDK) at the amino-terminal by polymerase chain reaction (PCR) and subcloned into the BamHI (5') and EcoRI (3') site of pcDNA4/TO (Invitrogen, Carlsbad, CA, USA). The Flag-tagged kinase-inactive form of human syk cDNA was created by replacement of Lys 402 by Arg (K402R), by using a PCR-based method. In brief, to generate a new AflII restriction site together with replacement of Lys 402 by Arg (K402R), two fragments containing mutations of the nucleotides 1205 (A to G) and 1242 (A to G) were created using human syk/pcDNA4/TO as a template. The first fragment was created using 5' primer (5'- TCATACTCCTTCCCAAAGCCTGGCCACAG -3'), and the mutagenic-3' primer, with the sequence (5'- CATCCTTAAGAGCGGGGTCATTGGCCTCGTTTTTCAGTATTCTCACAGCCACG -3'; underlines show the AflII site and the K402R replacement site, respectively). The second fragment was created using the mutagenic primer with the sequence (5'- GCTCTTAAGGATGAGTTATTAGCAGAAGC -3'; underline shows the AflII site) and 3' primer (5'-CGGAATTCTTAGTTCACCACGTCATAG -3'; underline shows the EcoRI site). The first fragment was digested with ScaI and AflII and the second one with AflII and EcoRI, respectively. These fragments were ligated and inserted between the ScaI and EcoRI sites of human syk inserted in pEGFP-C1 (Clontech Laboratories, Palo Alto, CA, USA). Mutations were verified by sequencing both strands (ABI PRISM Cycle Sequencing FS Ready Reaction Kit, Applied Biosystems, Foster City, CA, USA). The wild-type and mutant syk were subcloned in pcDNA3.1/Hygro (Invitrogen, Carlsbad, CA) and were introduced into Syk-deficient DT40 cells by electroporation and clones were selected with 2 mg/mL hygromycin B. The expression of Flag-tagged Syk was confirmed by immunoblotting analysis with the anti-Flag epitope mAb M2 and anti-Syk polyclonal antibody.

Detection of apoptosis by flow cytometry and cell morphology

To determine the proportion of apoptotic cells, the cells were analysed with annexin V and propidium iodide (PI) staining. According to the manufacturer's protocols, the cells were washed with cold PBS, resuspended in 100 µL binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2), incubated with 5 µL Alexa fluor488-conjugated-annexin V and 1 µL of 100 µg/mL PI for 15 min at room temperature and subjected to flow cytometry. For the morphological assessment of apoptosis, the cell smears were prepared with cytospin centrifugation for 5 min at 70 x g (Shandon Cytospin3, Thermo Electron Corporation, Pittsburgh, PA, USA) and stained with May–Gruenwald-Giemsa solutions.

Flow cytometric detection of the mitochondrial membrane potential

Mitotracker Orange (CMTMRos) was used according to the manufacturer's recommendations. A decrease in Mitotracker fluorescence was considered to be a measure for loss of the mitochondrial transmembrane potential (MTP). Cells were incubated with 100 nM Mitotracker Orange for 30 min at 37 °C, washed twice with PBS and immediately analysed by flow cytometry.

Flow cytometric detection of the change in lysosomal pH

To measure lysosomal pH, BCR-crosslinked cells were incubated with 0.65 mg/mL FITC-dextran in the culture medium for 30 min at 37 °C. Such treated cells were washed twice with PBS, resuspended in PBS and subjected to flow cytometry.

Microscopic detection of the cathepsin B activity in living cells

Cathepsin B substrate-based assay kit was used according to the manufacturer's recommendations. Cells treated or untreated with anti-IgM antibody were incubated with (z-Arginine-Arginine)2 derivatives of the cresyl violet fluorophore for 30 min. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope.

Immunoblotting

To prepare the mitochondria-free cytosolic fraction a digitonin-permeabilization technique was used (Jiang et al. 1999). Briefly, the cells (2 x 106) treated or untreated with anti-IgM antibody were washed once with PBS and then resuspended in 40 µL solution containing 70 mM Tris and 250 mM sucrose at pH 7.0. Digitonin was added to a final concentration of 75 µg/mL. The cells were immediately centrifuged at 1500 g for 10 min at 4 °C and the supernatants were collected. To examine the amount of Syk protein introduced into Syk-deficient DT40 cells, the cells were lysed with ice-cold lysis buffer (10 mM Tris, pH 7.8, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 1 mM Na3VO4, 2 mM PMSF and 10 µg/mL aprotinin) and the lysates were clarified by centrifugation at 12 000 g for 10 min at 4 °C. To examine the amount of the active bands of cathepsin B by proteolytic cleavage whole cell lysates were used. Cell lysates were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The membrane blots were blocked with 5% skim milk in TBST (10 mM Tris, pH 7.4, 150 mM NaCl and 0.1% Tween 20) for 1 h at room temperature and then incubated with anti-cytochrome c mAb, anti-Flag epitope mAb M2, anti-Syk polyclonal antibody or anti-cathepsin B polyclonal antibody in TBST for 1 h at room temperature. The membranes were then washed and incubated with HRP-conjugated secondary antibodies in TBST for 30 min at room temperature. After washing with TBST, enhanced chemiluminescence assays were performed to visualize positive bands. In some experiments, the blots were stripped and re-probed with another antibody.

Analysis of the movement of BCR from early endosomes to lysosomes

The cells were pretreated with FITC-conjugated or unconjugated anti-IgM antibody for 30 min at 4 °C. After washing the cells were further incubated in the culture medium for the indicated times in the presence of 1 µM Lysotracker Green or 0.6 µM Lysotracker Red for 30 min at 37 °C. For a control assay the cells were incubated with 0.6 µM Lysotracker Red for 30 min at 37 °C then treated with FITC-conjugated anti-chicken IgM antibody for 30 min at 4 °C. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope.


    Acknowledgements
 
This study was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science and the 21st Century COE Program of the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    Footnotes
 
Communicated by: Tadashi Yamamoto

* Correspondence: E-mail: yamamura{at}kobe-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bidere, N., Lorenzo, H.K., Carmona, S., et al. (2003) Cathepsin D triggers Bax activation, resulting in selective apoptosis-inducing factor (AIF) relocation in T lymphocytes entering the early commitment phase to apoptosis. J. Biol. Chem. 278, 31401–31411.[Abstract/Free Full Text]

Broker, L.E., Huisman, C., Span, S.W., Rodriguez, J.A., Kruyt, F.A. & Giaccone, G. (2004) Cathepsin B mediates caspase-independent cell death induced by microtubule stabilizing agents in non-small cell lung cancer cells. Cancer Res. 64, 27–30.[Abstract/Free Full Text]

Cao, C., Leng, Y. & Kufe, D. (2003) Catalase activity is regulated by c-Abl and Arg in the oxidative stress response. J. Biol. Chem. 278, 29667–29675.[Abstract/Free Full Text]

Cheng, A.M., Rowley, B., Pao, W., Hayday, A., Bolen, J.B. & Pawson, T. (1995) Syk tyrosine kinase required for mouse viability and B-cell development. Nature 378, 303–306.[CrossRef][Medline]

Cirman, T., Oresic, K., Mazovec, G.D., et al. (2004) Selective disruption of lysosomes in Hela cells triggers apoptosis mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins. J. Biol. Chem. 279, 3578–3587.

Coopman, P.J.P., Do, M.T.H., Barth, M., et al. (2000) The Syk tyrosine kinase suppresses malignant growth of human breast cancer cells. Nature 406, 742–747.[CrossRef][Medline]

Deiss, L.P., Galinka, H., Berissi, H., Cohen, O. & Kimchi, A. (1996) Cathepsin D protease mediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha. EMBO J. 15, 3861–3870.[Medline]

Faruki, S., Geahlen, R.L. & Asai, D.J. (2000) Syk-dependent phosphorylation of microtubules in activated B-lymphocytes. J. Cell Sci. 113, 2557–2565.[Abstract]

Foghsgaard, L., Wissing, D., Mauch, D., et al. (2001) Cathepsin B acts as a dominant execution protease in tumor cell apoptosis induced by tumor necrosis factor. J. Cell Biol. 153, 999–1009.

Guicciardi, M.E., Leist, M. & Gores, G.J. (2004) Lysosomes in cell death. Oncogene 23, 2881–2890.[CrossRef][Medline]

Gupta, N. & DeFranco, A.L. (2003) Visualizing lipid raft dynamics and early signaling events during antigen receptor-mediated B-lymphocyte activation. Mol. Biol. Cell 14, 432–444.[Abstract/Free Full Text]

Hao, J.J., Carey, G.B. & Zhan, X. (2004) Syk-mediated tyrosine phosphorylation is required for the association of HS1 with lipid rafts and BCR signalosome complex. J. Biol. Chem. in press.[Abstract/Free Full Text]

Hase, H., Kanno, Y., Kojima, H., Morimoto, C., Okumura, K. & Kobata, T. (2002) CD27 and CD40 inhibit p53-independent mitochondrial pathways in apoptosis of B cells induced by B cell receptor ligation. J. Biol. Chem. 277, 46950–46958.[Abstract/Free Full Text]

Herold, M.J., Kuss, A.W., Kraus, C. & Berberich, I. (2002) Mitochondria-dependent caspase-9 activation is necessary for antigen receptor-mediated effector caspase activation and apoptosis in WEHI 231 lymphoma cells. J. Immunol. 168, 3902–3909.[Abstract/Free Full Text]

Hishita, T., Tada-Oikawa, S., Tohyama, K., et al. (2001) Caspase-3 activation by lysosomal enzymes in cytochrome c-independent apoptosis in myelodysplastic syndrome-derived cell line P39. Cancer Res. 61, 2878–2884.[Abstract/Free Full Text]

Ito, Y., Pandey, P., Mishira, N., et al. (2001) Targeting of the c-Abl tyrosine kinase to mitochondria in endoplasmic reticulum stress-induced apoptosis. Mol. Cell. Biol. 21, 6233–6242.[Abstract/Free Full Text]

Jiang, S., Cai, J., Wallace, D.C. & Jones, D.P. (1999) Cytochrome c-mediated apoptosis in cells lacking mitochondrial DNA. J. Biol. Chem. 274, 29905–29911.[Abstract/Free Full Text]

Katz, E., Lord, C., Ford, C.A., Gauld, S.B., Carter, N.A. & Harnett, M.M. (2004) Bcl-xL antagonism of BCR-coupled mitochondrial phospholipase A2 signaling correlates with protection from apoptosis in WEHI-231 B cells. Blood 103, 168–176.[Abstract/Free Full Text]

Katz, E., Deehan, M.R., Seatter, S., Lord, C., Sturrock, R.D. & Harnett, M.M. (2001) B cell receptor-stimulated mitochondrial phospholipase A2 activation and resultant disruption of mitochondrial membrane potential correlate with the induction of apoptosis in WEHI-231 B cells. J. Immunol. 166, 137–147.[Abstract/Free Full Text]

Kurosaki, T. (2002) Regulation of B cell fates by BCR signaling components. Curr. Opin. Immunol. 14, 341–347.[CrossRef][Medline]

Kurosaki, T., Johnson, S.A., Pao, L., Sada, K., Yamamura, H. & Cambier, J.C. (1995) Role of the Syk autophosphorylation site and SH2 domains in B cell antigen receptor signaling. J. Exp. Med. 182, 1815–1823.[Abstract/Free Full Text]

Kurosaki, T., Takata, M., Yamanashi, Y., et al. (1994) Syk activation by the Src-family tyrosine kinase in the B cell receptor signaling. J. Exp. Med. 179, 1725–1729.[Abstract/Free Full Text]

Ma, H., Yankee, T.M., Hu, J., Asai, D.J., Harrison, M.L. & Geahlen, R.L. (2001) Visualization of Syk–antigen receptor interactions using green fluorescent protein: differential roles for Syk and Lyn in the regulation of receptor capping and internalization. J. Immunol. 166, 1507–1516.[Abstract/Free Full Text]

Marzo, I., Brenner, C., Zamzami, N., et al. (1998) The permeability transition pore complex: a target for apoptosis regulation by caspases and bcl-2-related proteins. J. Exp. Med. 187, 1261–1271.[Abstract/Free Full Text]

Michallet, M.C., Saltel, F., Preville, X., Flacher, M., Revillard, J.P. & Genestier, L. (2003) Cathepsin-B-dependent apoptosis triggered by antithymocyte globulins: a novel mechanism of T-cell deletion. Blood 102, 3719–3726.[Abstract/Free Full Text]

Mlinaric-Rascan, I. & Turk, B. (2003) B cell receptor-mediated nuclear fragmentation proceeds in WEHI 231 cells in the absence of detectable DEVDase and Frase activity. FEBS Lett. 553, 51–55.[CrossRef][Medline]

Muller, B., Cooper, L. & Terhorst, C. (1994) Molecular cloning of the human homologue to the pig protein-tyrosine kinase syk. Immunogenetics 39, 359–362.[Medline]

Nossal, G.J. (1994) Negative selection of lymphocytes. Cell 76, 229–239.[CrossRef][Medline]

Sada, K., Takano, T., Yanagi, S. & Yamamura, H. (2001) Structure and function of Syk protein-tyrosine kinase. J. Biochem. 130, 177–186.[Abstract/Free Full Text]

Siemasko, K., Eisfelder, B.J., Williamson, E., Kabak, S. & Clark, M.R. (1998) Cutting edge: signals from the B lymphocyte antigen receptor regulate MHC class II containing late endosomes. J. Immunol. 160, 5203–5208.[Abstract/Free Full Text]

Stoddart, A., Dykstra, M.L., Brown, B.K., Song, W., Pierce, S.K. & Brodsky, F.M. (2002) Lipid rafts unite signaling cascades with clathrin to regulate BCR internalization. Immunity 17, 451–462.[CrossRef][Medline]

Takao, N., Mori, R., Kato, H., Shinohara, A. & Yamamoto, K. (2000) c-Abl tyrosine kinase is not essential for ataxia telangiectasia mutated functions in chromosomal maintenance. J. Biol. Chem. 275, 725–728.[Abstract/Free Full Text]

Takata, M., Homma, Y. & Kurosaki, T. (1995) Requirement of phospholipase C-{gamma}2 activation in surface immunoglobulin M-induced B cell apoptosis. J. Exp. Med. 182, 907–914.[Abstract/Free Full Text]

Takata, M., Sabe, H., Hata, A., et al. (1994) Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca2+ mobilization through distinct pathways. EMBO J. 13, 1341–1349.[Medline]

Taniguchi, T., Kobayashi, T., Kondo, J., et al. (1991) Molecular cloning of a porcine gene syk that encodes a 72-kDa protein-tyrosine kinase showing high susceptibility to proteolysis. J. Biol. Chem. 266, 15790–15796.[Abstract/Free Full Text]

Tsubata, T., Wu, J. & Honjo, T. (1993) B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40. Nature 364, 645–648.[CrossRef][Medline]

Turner, M., Mee, P.J., Costello, P.S., et al. (1995) Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378, 298–302.[CrossRef][Medline]

Wang, J.Y. (2000) Regulation of cell death by Abl tyrosine kinase. Oncogene 19, 5643–5650.[CrossRef][Medline]

Yamanashi, Y., Fukuda, T., Nishizumi, H., et al. (1997) Role of tyrosine phosphorylation of HS1 in B cell antigen receptor-mediated apoptosis. J. Exp. Med. 185, 1387–1392.[Abstract/Free Full Text]

Yanagi, S., Inatome, R., Ding, J., Kitaguchi, H., Tybulewicz, V.L.J. & Yamamura, H. (2001) Syk expression in endothelial cells and their morphologic defects in embryonic Syk-deficient mice. Blood 98, 2869–2871.[Abstract/Free Full Text]

Received: 11 July 2004
Accepted: 13 October 2004




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
F. M. Uckun, S. Qazi, H. Ma, L. Tuel-Ahlgren, and Z. Ozer
STAT3 is a substrate of SYK tyrosine kinase in B-lineage leukemia/lymphoma cells exposed to oxidative stress
PNAS, February 16, 2010; 107(7): 2902 - 2907.
[Abstract] [Full Text] [PDF]


Home page
Acta Biochim Biophys SinHome page
Q. Wang, J. Li, J. Gu, B. Huang, Y. Zhao, D. Zheng, Y. Ding, and L. Zeng
Potentiation of (-)-epigallocatechin-3-gallate-induced apoptosis by bortezomib in multiple myeloma cells
Acta Biochim Biophys Sin, December 1, 2009; 41(12): 1018 - 1026.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Tohyama and H. Yamamura
Protein Tyrosine Kinase, Syk: A Key Player in Phagocytic Cells
J. Biochem., March 1, 2009; 145(3): 267 - 273.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhang, A. C. Zambon, K. Vranizan, K. Pothula, B. R. Conklin, and P. A. Insel
Gene Expression Signatures of cAMP/Protein Kinase A (PKA)-promoted, Mitochondrial-dependent Apoptosis: COMPARATIVE ANALYSIS OF WILD-TYPE AND cAMP-DEATHLESS S49 LYMPHOMA CELLS
J. Biol. Chem., February 15, 2008; 283(7): 4304 - 4313.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Lau, X. Wang, L. Song, M. North, S. Wiehler, D. Proud, and C.-W. Chow
Syk Associates with Clathrin and Mediates Phosphatidylinositol 3-Kinase Activation during Human Rhinovirus Internalization
J. Immunol., January 15, 2008; 180(2): 870 - 880.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Wang, C. Lau, S. Wiehler, A. Pow, T. Mazzulli, C. Gutierrez, D. Proud, and C.-W. Chow
Syk Is Downstream of Intercellular Adhesion Molecule-1 and Mediates Human Rhinovirus Activation of p38 MAPK in Airway Epithelial Cells
J. Immunol., November 15, 2006; 177(10): 6859 - 6870.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Shi, Y. Tohyama, T. Kadono, J. He, S. M. Shahjahan Miah, R. Hazama, C. Tanaka, K. Tohyama, and H. Yamamura
Protein-tyrosine kinase Syk is required for pathogen engulfment in complement-mediated phagocytosis
Blood, June 1, 2006; 107(11): 4554 - 4562.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, J.
Right arrow Articles by Yamamura, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, J.
Right arrow Articles by Yamamura, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS