|
|
||||||||
1 Department of Genome Sciences, Kobe University Graduate School of Medicine, Kobe 650-0017, Japan
2 Department of Molecular Pathology, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan
3 Department of Nutrition Management, Hyogo University, Kakogawa 675-0101, Japan
4 Department of Laboratory Medicine and Clinical Pathology, Kawasaki Medical School, Kurashiki 701-0192, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The aim of this study is to evaluate the mechanism by which BCR-ligation promotes apoptosis in the absence of an adequate costimulation and the functional relationship with the vesicular traffic of BCR and apoptotic pathways. Our findings showed that after BCR-crosslinking lysosomal permeability is enhanced with the release of lysosomal enzymes correlated with the early apoptotic hallmarks, suggesting that this lysosomal change is a primary step of BCR-induced apoptosis and Syk is responsible for this change through a fusion of BCR-carrying endosomes to lysosomes.
| Results |
|---|
|
|
|---|
To investigate the mechanism by which a commitment to B cell receptor (BCR)-mediated apoptosis is determined, we used immature B cell lines DT40 and WEHI-231 as model systems (Takata et al. 1995; Katz et al. 2001; Herold et al. 2002; Mlinaric-Rascan & Turk 2003; Katz et al. 2004). The levels of cell surface expression of BCR on wild-type, c-Abl-deficient and Syk-deficient DT40 cells were checked and found to be the same as one another (Fig. 1A).
|
Disruption of MTP and release of cytochrome c are not essential for BCR-induced apoptosis
On the basis of previous reports that BCR-crosslinking activates the mitochondriamediated apoptotic pathway (Katz et al. 2001, 2004; Hase et al. 2002; Herold et al. 2002), we examined the disruption of MTP in DT40 and WEHI-231 cells. To analyse the change of MTP quantitatively the cells were crosslinked with anti-BCR antibodies and then the incorporation of Mitotracker Orange was measured by flow cytometry together with the binding of annexinV. In DT40 cells MTP was kept unchanged for 24 h (4 h, 8 h, 16 h and 24 h) after BCR-crosslinking. In WEHI-231 cells MTP was not changed at 4 h and 8 h (data not shown) but the disruption was detected at 16 h (Fig. 2A) and 24 h (data not shown) after BCR-crosslinking. These results indicated that the disruption of MTP is not essential for BCR-induced apoptosis in DT40 cells unlike WEHI-231 cells. To further investigate mitochondria-mediated apoptosis, release of cytochrome c from the mitochondria into the cytosol was assessed by immunoblotting analysis. After BCR-crosslinking the amount of cytochrome c in the cytosolic fraction increased in wild-type cells while both Syk-deficient and c-Abl-deficient cells showed only a negligible release of cytochrome c into the cytosol (Fig. 2B), suggesting that the degree of apoptosis and the release of cytochrome c were not parallel among mutant cell lines in BCR-induced apoptosis.
|
We then directed our attention to the role of lysosomes in the apoptosis of these cells. The change in lysosomal pH was measured by flow cytometry with FITC-dextran, a pH-sensitive fluorescent probe that enters lysosomes via fluid-phase endocytosis (Hishita et al. 2001). In both DT40 and WEHI-231 cells BCR-crosslinking resulted in a gradual and time-dependent increase in fluorescence intensity up to 24 h, indicating that lysosomal pH was increased by BCR-crosslinking (Fig. 3A). The change in lysosomal pH showed a good correlation with early apoptotic hallmarks such as chromatin condensation and phosphatidylserine exposure (Fig. 3B), suggesting that this change may be involved in the initiation of the apoptotic program. Then we examined whether the change in lysosomal pH also correlates with the difference of early apoptotic hallmarks. After BCR-crosslinking c-Abl-deficient cells revealed a similar increase in lysosomal pH as wild-type cells, but Syk-deficient cells hardly showed the increase (Fig. 3A, lower), and this difference corresponded to the degree of apoptosis (Fig. 1B,C).
|
BCR-crosslinking leads to enlargement and accumulation of lysosomes whose acidic nature was retained until the collapse of nuclear morphology
To identify the BCR-induced morphological changes of lysosomes, we labelled lysosomes with Lysotracker Green, which is a fluorescent acidic probe for labelling and tracing acidic organelles in living cells. In wild-type DT40 cells, quiescent lysosomes showed a punctate localization in the cytoplasm. After BCR-crosslinking lysosomes became enlarged and gradually accumulated one another and formed a focus in the cytoplasm (within 45 min at the latest), and these lysosomal changes persisted with acidic nature until the collapse of nuclear morphology (4 h; Fig. 4A, upper left). These changes in the distribution of lysosomes appeared the same as the localization of cathepsin B after BCR-crosslinking (Fig. 3C), and at 8 h or 16 h, these accumulated lysosomes were observed in most of cells that were still alive (data not shown). In contrast, neither enlargement nor accumulation of lysosomes was observed in Syk-deficient cells (Fig. 4A, upper right). In WEHI-231 cells, enlarged lysosomes were also observed (4 h; Fig. 4A, lower).
|
Transfer of wild-type Syk in Syk-deficient cells restores the BCR-induced lysosomal changes with apoptosis
To confirm an essential role of Syk in BCR-induced lysosomal changes, we transferred the Flag-tagged wild-type Syk or kinase-inactive Syk into Syk-deficient cells. The cell clones stably expressing either type of Syk were isolated and the amount of protein expression was examined by immunoblotting analysis using anti-Flag epitope mAb and anti-Syk polyclonal antibody (Fig. 5A). The levels of BCR expression on cell surface were found to be the same as parental Syk-deficient cells by flow cytometry with FITC-anti-chicken IgM antibody (data not shown). Then we examined the effects of transfer of wild-type Syk or kinase-inactive Syk on the change of lysosomal pH (Fig. 5B) and the percentage of apoptotic cells (Fig. 5C). Transfer of wild-type Syk but not kinase-inactive Syk into Syk-deficient cells restored the increase of lysosomal pH together with the increase in apoptotic cells (Fig. 5B,C).
|
|
| Discussion |
|---|
|
|
|---|
As previously reported, by crosslinking with anti-surface IgM antibody BCR is rapidly internalized (Ma et al. 2001; Stoddart et al. 2002) and BCR-carrying endosomes fuse to lysosomes (Siemasko et al. 1998). Then in this study we investigated how this dynamic movement of BCR leads to apoptosis and found that the change in lysosomal permeability, which might be a result of lysosomal fusion, is the first event that directly induces apoptosis. As for BCR-induced apoptosis some reports showed the involvement of mitochondrial pathway via the change of MTP (Katz et al. 2001, 2004; Herold et al. 2002), especially by the use of WEHI-231 cells. Then to prove the impact of the lysosomal pathway on BCR-induced apoptosis, we analysed WEHI-231 cells as well as DT40. Time course study revealed that WEHI-231 cells showed the similar increase in lysosomal pH to DT40 cells as shown in Fig. 3A (early increase occurred from 4 h after the stimulation; data not shown), but change of morphology occurred later than DT40 cells (from 16 h after the stimulation; data not shown) and coincided with the change of MTP (Fig. 2A and data not shown). Judging from these results, the increase in lysosomal pH is the common event in the early apoptosis both in DT40 cells and in WEHI-231 cells, but execution of apoptotic program is different between these cell lines. In DT40 cells lysosomal change rapidly links to nuclear disruption without any change in MTP and therefore the early phase of apoptosis seems to proceed independently of mitochondrial change. On the other hand, the change of MTP occurred in WEHI-231 cells in execution of the early phase of apoptosis. These distinct as well as common responses in both cell lines show a generality of lysosomal pathway of BCR-crosslinking-induced apoptosis in immature B cells.
We further utilized c-Abl-deficient DT40 cells in addition to Syk-deficient cells. Previous reports showed that c-Abl sometimes acts as a transducer of anti-apoptotic (Wang 2000; Cao et al. 2003) as well as pro-apoptotic (Ito et al. 2001) effector pathways according to the time and circumstances. In our experiments, the basal value of apoptosis in c-Abl-deficient DT40 cells was so high as compared to that of wild-type DT40 cells in the usual culture (Fig. 1C), but deficiency of c-Abl did not affect the increase in apoptosis induced by BCR-crosslinking. These results suggest that c-Abl acts as anti-apoptotic effector in the usual culture but does not affect the early events of BCR-induced apoptosis in DT40 cells. As c-Abl is involved in mitochondrial function in the case of ER-stress-induced apoptosis, it cannot be denied that c-Abl might act some roles in the late phase of apoptosis in WEHI-231 cells. As to cytochrome c release from mitochondria, the release was suppressed in c-Abl-deficient DT40 cells (Fig. 2B) in spite of the similar progression of apoptosis to wild-type cells (Fig. 1B,C) and therefore, cytochrome c release from mitochondria seems to be dispensable for BCR-induced apoptosis at least at the same time point when the lysosomal permeability is increased. Any way, these results strongly suggest that the fusion of BCR-carrying endosomes to lysosomes might act as an initiation signal of the apoptotic program and triggers the enhanced lysosomal permeability before lysosomal enzymes are released into the cytosol.
As described above, it is certain that at least a lysosomal protease acts as an executor of BCR-induced apoptosis but it appears to be difficult to specify what kind of enzymes actually act among lysosomal proteases. Cathepsin B is one of the most stable proteases at physiological pH. Microscopic analysis detecting fluorescence-linked cathepsin B activity revealed that after BCR-crosslinking active cathepsin B was released from lysosomes to cytosol (Fig. 3C) and a cathepsin B inhibitor E64d showed apoptosis-suppressing effect (Fig. 3D). Judging from these results, cathepsin B must contribute in part to the commitment to BCR-induced apoptosis, but other lysosomal enzymes will also participate in this process. In fact, one report using the same inhibitor indicated that BCR-driven nuclear fragmentation is independent of the activity of caspases and cathepsins (Mlinaric-Rascan & Turk 2003). Mlinaric-Rascan & Turk (2003) analysed the effect of the inhibitor at the final apoptotic stage, whereas we specified it at the early stage. In accordance with the progress of apoptosis, the more proteolytic enzymes might be involved. However, in contrast to our expectation, we found that after BCR-crosslinking accumulated lysosomes retained their morphology, acidic pH and activity of cathepsin B until the final stage of cell death (Figs 3C and 4A). We speculate that lysosomal proteases work tenaciously and lysosomes themselves function as the centre of degradation until the last stage of cell death.
It is known that an adequate costimulatory signalling from T cells can rescue B cells from BCR-mediated apoptosis (Hase et al. 2002; Katz et al. 2004). Therefore, a rescue-signalling to cancel apoptotic cell death might affect the lysosomal functions, but the significance of rescue-signalling in lysosomes remains to be determined.
There are a series of reports that Syk is a key molecule and indispensable for BCR-mediated signalling including apoptosis (Kurosaki et al. 1994, 1995; Takata et al. 1994, 1995; Cheng et al. 1995; Turner et al. 1995; Kurosaki 2002). However, BCR-crosslinking produces multiple outcomes to the cells at various developmental stages of B cells other than apoptosis, such as proliferation, survival and differentiation, and Syk also plays critical roles in all stages related to these signalling pathways (Takata et al. 1994; Sada et al. 2001; Kurosaki 2002). The precise mechanism by which Syk is involved in BCR-induced apoptosis remains unclear. Our study demonstrated that Syk plays an essential role in the dynamic changes of lysosomes, that is, their accumulation in the cytosol and fusion to BCR-carrying endosomes, and in this way Syk contributes to BCR-induced apoptosis. We showed that such a lysosomal-endosomal fusion did not occur in Syk-deficient DT40 cells but was restored by gene transfer of wild-type Syk into these cells accompanied with apoptosis (Figs 4A,B and 6A,B). To produce these effects on lysosomes, Syk may possibly be involved in such molecular mechanisms as the movement of BCR on the cell membrane, the accumulation of BCR at the raft (Stoddart et al. 2002; Gupta & DeFranco 2003), its internalization via clathrin (Stoddart et al. 2002) and polymerization of microtubules that support the endocytosis (Faruki et al. 2000). A recent report also suggests a mechanism that Syk is involved in the translocation of BCR into lipid rafts (Hao et al. 2004). In this report F-actin binding protein HS1 translocates into rafts dependently on Syk-mediated tyrosine phosphorylation in response to BCR-crosslinking. Because the requirement of tyrosine phosphorylation of HS1 by Syk to BCR-induced apoptosis was already reported (Yamanashi et al. 1997), BCR-accumulation at lipid rafts through SykHS1 pathway seems to be a possible event prior to fusion of BCR-endosomes to lysosomes. In fact, pretreatment with raft-modifying compound, methyl-ß-cyclodextrin (MCD), also known as a depleting agent of cholesterol, caused neither internalization of BCR nor fusion to lysosomes (data not shown).
To clarify the mechanism how Syk transduces signal from BCR to lysosomes, we examined the dynamics of Syk and tyrosine-phosphorylated proteins using immunofluorescence staining by analysing Syk-deficient DT40 cells over-expressing Flag-tagged human Syk. As a result, BCR-crosslinking led to the recruitment of Syk to the site of the cross-linked BCR at the plasma membrane as described in the previous reports (Ma et al. 2001; Gupta & DeFranco 2003). After that a part of Syk and tyrosine-phosphorylated proteins were detected under juxta-membrane in punctuate structure and the phosphorylation was completely attenuated at the time when the fusion of endosomes to lysosomes was almost finished (data not shown). In the case of kinase-inactive Syk, the increase of tyrosine phosphorylation was suppressed as indicated in the previous reports. From these results we expect that activity of Syk kinase is necessary for the formation and transport of BCR-endosomes to lysosomes, that is, movement of BCR to one pole on plasma membrane, internalization and vesicular transport to lysosomes.
In conclusion, a lysosomal pathway followed by the release of lysosomal enzymes is mainly involved in the initiation and/or execution of a BCR-mediated apoptosis, and this pathway originates in a fusion of BCR-carrying endosomes to lysosomes. Syk is considered to be responsible for this fusion.
| Experimental procedures |
|---|
|
|
|---|
WEHI-231, wild-type DT40 and its mutant cell clones were cultured in RPMI1640 medium (Sigma, St Louis, MO, USA) supplemented with 10% foetal calf serum (FCS) in 5% CO2 humidified air at 37 °C. Syk-deficient DT40 cells were generously provided by Dr Kurosaki (Takata et al. 1994) and c-Abl-deficient DT40 cells were established as previously described (Takao et al. 2000).
Antibodies and reagents
Anti-chicken IgM polyclonal antibody and its FITC-conjugated form were obtained from Bethyl Laboratories (Montgomery, TX, USA). Anti-mouse IgM polyclonal antibody F(ab)2 for BCR-crosslinking was from Southern Biotechnology Associates, Inc. Anti-Flag epitope monoclonal antibody (mAb) M2 (Sigma), anti-
-tubulin mAb (Sigma), anti-Syk polyclonal antibody (Sc-1077, Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA), anti-cathepsin B polyclonal antibody (Upstate biotechnology, Lake Placid, NY) and anti-cytochrome c mAb (BD Pharmingen, San Diego, CA, USA) were used for immunoblotting. Anti-phosphotyrosine (4G10), FITC-conjugated mAb (Upstate biotechnology) and anti-Flag mAb M2, Cy3-conjugated form (Sigma) were used for immunofluorescent staining according to the manufacturer's recommendation. Vybrant Apoptosis Assay Kit #2 for detection of apoptosis, Mitotracker Orange, Lysotracker Green and Lysotracker Red were purchased from Molecular Probes, Inc (Eugene, OR, USA).
FITC-dextran (Sigma) was used for flow cytometric detection of the change in lysosomal pH. Hygromycin B and digitonin were purchased from Wako Pure Chemical Industries (Osaka, Japan). Cathepsin B detection kit, Magic Red, was obtained from Immunochemistry Technologies, LLC (Bloomington, MN, USA), a cathepsin B inhibitor, L-trans-Epoxysuccinyl-Leu-3-methylbutylamide ethyl ester (E64d), from Calbiochem (Cambridge, MA, USA), a caspases inhibitor, z-VAD-fmk, from Promega Corporation (Madison, WI, USA) and methyl-ß-cyclodextrin (MCD) from Sigma.
Site-directed mutagenesis and DNA transfection
Human syk cDNA, provided by Dr Muller (Muller et al. 1994) was modified with a Flag-epitope tag (DYKDDDDK) at the amino-terminal by polymerase chain reaction (PCR) and subcloned into the BamHI (5') and EcoRI (3') site of pcDNA4/TO (Invitrogen, Carlsbad, CA, USA). The Flag-tagged kinase-inactive form of human syk cDNA was created by replacement of Lys 402 by Arg (K402R), by using a PCR-based method. In brief, to generate a new AflII restriction site together with replacement of Lys 402 by Arg (K402R), two fragments containing mutations of the nucleotides 1205 (A to G) and 1242 (A to G) were created using human syk/pcDNA4/TO as a template. The first fragment was created using 5' primer (5'- TCATACTCCTTCCCAAAGCCTGGCCACAG -3'), and the mutagenic-3' primer, with the sequence (5'- CATCCTTAAGAGCGGGGTCATTGGCCTCGTTTTTCAGTATTCTCACAGCCACG -3'; underlines show the AflII site and the K402R replacement site, respectively). The second fragment was created using the mutagenic primer with the sequence (5'- GCTCTTAAGGATGAGTTATTAGCAGAAGC -3'; underline shows the AflII site) and 3' primer (5'-CGGAATTCTTAGTTCACCACGTCATAG -3'; underline shows the EcoRI site). The first fragment was digested with ScaI and AflII and the second one with AflII and EcoRI, respectively. These fragments were ligated and inserted between the ScaI and EcoRI sites of human syk inserted in pEGFP-C1 (Clontech Laboratories, Palo Alto, CA, USA). Mutations were verified by sequencing both strands (ABI PRISM Cycle Sequencing FS Ready Reaction Kit, Applied Biosystems, Foster City, CA, USA). The wild-type and mutant syk were subcloned in pcDNA3.1/Hygro (Invitrogen, Carlsbad, CA) and were introduced into Syk-deficient DT40 cells by electroporation and clones were selected with 2 mg/mL hygromycin B. The expression of Flag-tagged Syk was confirmed by immunoblotting analysis with the anti-Flag epitope mAb M2 and anti-Syk polyclonal antibody.
Detection of apoptosis by flow cytometry and cell morphology
To determine the proportion of apoptotic cells, the cells were analysed with annexin V and propidium iodide (PI) staining. According to the manufacturer's protocols, the cells were washed with cold PBS, resuspended in 100 µL binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2), incubated with 5 µL Alexa fluor488-conjugated-annexin V and 1 µL of 100 µg/mL PI for 15 min at room temperature and subjected to flow cytometry. For the morphological assessment of apoptosis, the cell smears were prepared with cytospin centrifugation for 5 min at 70 x g (Shandon Cytospin3, Thermo Electron Corporation, Pittsburgh, PA, USA) and stained with MayGruenwald-Giemsa solutions.
Flow cytometric detection of the mitochondrial membrane potential
Mitotracker Orange (CMTMRos) was used according to the manufacturer's recommendations. A decrease in Mitotracker fluorescence was considered to be a measure for loss of the mitochondrial transmembrane potential (MTP). Cells were incubated with 100 nM Mitotracker Orange for 30 min at 37 °C, washed twice with PBS and immediately analysed by flow cytometry.
Flow cytometric detection of the change in lysosomal pH
To measure lysosomal pH, BCR-crosslinked cells were incubated with 0.65 mg/mL FITC-dextran in the culture medium for 30 min at 37 °C. Such treated cells were washed twice with PBS, resuspended in PBS and subjected to flow cytometry.
Microscopic detection of the cathepsin B activity in living cells
Cathepsin B substrate-based assay kit was used according to the manufacturer's recommendations. Cells treated or untreated with anti-IgM antibody were incubated with (z-Arginine-Arginine)2 derivatives of the cresyl violet fluorophore for 30 min. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope.
Immunoblotting
To prepare the mitochondria-free cytosolic fraction a digitonin-permeabilization technique was used (Jiang et al. 1999). Briefly, the cells (2 x 106) treated or untreated with anti-IgM antibody were washed once with PBS and then resuspended in 40 µL solution containing 70 mM Tris and 250 mM sucrose at pH 7.0. Digitonin was added to a final concentration of 75 µg/mL. The cells were immediately centrifuged at 1500 g for 10 min at 4 °C and the supernatants were collected. To examine the amount of Syk protein introduced into Syk-deficient DT40 cells, the cells were lysed with ice-cold lysis buffer (10 mM Tris, pH 7.8, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 1 mM Na3VO4, 2 mM PMSF and 10 µg/mL aprotinin) and the lysates were clarified by centrifugation at 12 000 g for 10 min at 4 °C. To examine the amount of the active bands of cathepsin B by proteolytic cleavage whole cell lysates were used. Cell lysates were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The membrane blots were blocked with 5% skim milk in TBST (10 mM Tris, pH 7.4, 150 mM NaCl and 0.1% Tween 20) for 1 h at room temperature and then incubated with anti-cytochrome c mAb, anti-Flag epitope mAb M2, anti-Syk polyclonal antibody or anti-cathepsin B polyclonal antibody in TBST for 1 h at room temperature. The membranes were then washed and incubated with HRP-conjugated secondary antibodies in TBST for 30 min at room temperature. After washing with TBST, enhanced chemiluminescence assays were performed to visualize positive bands. In some experiments, the blots were stripped and re-probed with another antibody.
Analysis of the movement of BCR from early endosomes to lysosomes
The cells were pretreated with FITC-conjugated or unconjugated anti-IgM antibody for 30 min at 4 °C. After washing the cells were further incubated in the culture medium for the indicated times in the presence of 1 µM Lysotracker Green or 0.6 µM Lysotracker Red for 30 min at 37 °C. For a control assay the cells were incubated with 0.6 µM Lysotracker Red for 30 min at 37 °C then treated with FITC-conjugated anti-chicken IgM antibody for 30 min at 4 °C. After incubation the living cells were kept on ice and immediately observed with a confocal laser-scanning microscope.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: yamamura{at}kobe-u.ac.jp
| References |
|---|
|
|
|---|
Broker, L.E., Huisman, C., Span, S.W., Rodriguez, J.A., Kruyt, F.A. & Giaccone, G. (2004) Cathepsin B mediates caspase-independent cell death induced by microtubule stabilizing agents in non-small cell lung cancer cells. Cancer Res.
64, 2730.
Cao, C., Leng, Y. & Kufe, D. (2003) Catalase activity is regulated by c-Abl and Arg in the oxidative stress response. J. Biol. Chem.
278, 2966729675.
Cheng, A.M., Rowley, B., Pao, W., Hayday, A., Bolen, J.B. & Pawson, T. (1995) Syk tyrosine kinase required for mouse viability and B-cell development. Nature 378, 303306.[CrossRef][Medline]
Cirman, T., Oresic, K., Mazovec, G.D., et al. (2004) Selective disruption of lysosomes in Hela cells triggers apoptosis mediated by cleavage of Bid by multiple papain-like lysosomal cathepsins. J. Biol. Chem. 279, 35783587.
Coopman, P.J.P., Do, M.T.H., Barth, M., et al. (2000) The Syk tyrosine kinase suppresses malignant growth of human breast cancer cells. Nature 406, 742747.[CrossRef][Medline]
Deiss, L.P., Galinka, H., Berissi, H., Cohen, O. & Kimchi, A. (1996) Cathepsin D protease mediates programmed cell death induced by interferon-gamma, Fas/APO-1 and TNF-alpha. EMBO J. 15, 38613870.[Medline]
Faruki, S., Geahlen, R.L. & Asai, D.J. (2000) Syk-dependent phosphorylation of microtubules in activated B-lymphocytes. J. Cell Sci. 113, 25572565.[Abstract]
Foghsgaard, L., Wissing, D., Mauch, D., et al. (2001) Cathepsin B acts as a dominant execution protease in tumor cell apoptosis induced by tumor necrosis factor. J. Cell Biol. 153, 9991009.
Guicciardi, M.E., Leist, M. & Gores, G.J. (2004) Lysosomes in cell death. Oncogene 23, 28812890.[CrossRef][Medline]
Gupta, N. & DeFranco, A.L. (2003) Visualizing lipid raft dynamics and early signaling events during antigen receptor-mediated B-lymphocyte activation. Mol. Biol. Cell
14, 432444.
Hao, J.J., Carey, G.B. & Zhan, X. (2004) Syk-mediated tyrosine phosphorylation is required for the association of HS1 with lipid rafts and BCR signalosome complex. J. Biol. Chem.
in press.
Hase, H., Kanno, Y., Kojima, H., Morimoto, C., Okumura, K. & Kobata, T. (2002) CD27 and CD40 inhibit p53-independent mitochondrial pathways in apoptosis of B cells induced by B cell receptor ligation. J. Biol. Chem.
277, 4695046958.
Herold, M.J., Kuss, A.W., Kraus, C. & Berberich, I. (2002) Mitochondria-dependent caspase-9 activation is necessary for antigen receptor-mediated effector caspase activation and apoptosis in WEHI 231 lymphoma cells. J. Immunol.
168, 39023909.
Hishita, T., Tada-Oikawa, S., Tohyama, K., et al. (2001) Caspase-3 activation by lysosomal enzymes in cytochrome c-independent apoptosis in myelodysplastic syndrome-derived cell line P39. Cancer Res.
61, 28782884.
Ito, Y., Pandey, P., Mishira, N., et al. (2001) Targeting of the c-Abl tyrosine kinase to mitochondria in endoplasmic reticulum stress-induced apoptosis. Mol. Cell. Biol.
21, 62336242.
Jiang, S., Cai, J., Wallace, D.C. & Jones, D.P. (1999) Cytochrome c-mediated apoptosis in cells lacking mitochondrial DNA. J. Biol. Chem.
274, 2990529911.
Katz, E., Lord, C., Ford, C.A., Gauld, S.B., Carter, N.A. & Harnett, M.M. (2004) Bcl-xL antagonism of BCR-coupled mitochondrial phospholipase A2 signaling correlates with protection from apoptosis in WEHI-231 B cells. Blood
103, 168176.
Katz, E., Deehan, M.R., Seatter, S., Lord, C., Sturrock, R.D. & Harnett, M.M. (2001) B cell receptor-stimulated mitochondrial phospholipase A2 activation and resultant disruption of mitochondrial membrane potential correlate with the induction of apoptosis in WEHI-231 B cells. J. Immunol.
166, 137147.
Kurosaki, T. (2002) Regulation of B cell fates by BCR signaling components. Curr. Opin. Immunol. 14, 341347.[CrossRef][Medline]
Kurosaki, T., Johnson, S.A., Pao, L., Sada, K., Yamamura, H. & Cambier, J.C. (1995) Role of the Syk autophosphorylation site and SH2 domains in B cell antigen receptor signaling. J. Exp. Med.
182, 18151823.
Kurosaki, T., Takata, M., Yamanashi, Y., et al. (1994) Syk activation by the Src-family tyrosine kinase in the B cell receptor signaling. J. Exp. Med.
179, 17251729.
Ma, H., Yankee, T.M., Hu, J., Asai, D.J., Harrison, M.L. & Geahlen, R.L. (2001) Visualization of Sykantigen receptor interactions using green fluorescent protein: differential roles for Syk and Lyn in the regulation of receptor capping and internalization. J. Immunol.
166, 15071516.
Marzo, I., Brenner, C., Zamzami, N., et al. (1998) The permeability transition pore complex: a target for apoptosis regulation by caspases and bcl-2-related proteins. J. Exp. Med.
187, 12611271.
Michallet, M.C., Saltel, F., Preville, X., Flacher, M., Revillard, J.P. & Genestier, L. (2003) Cathepsin-B-dependent apoptosis triggered by antithymocyte globulins: a novel mechanism of T-cell deletion. Blood
102, 37193726.
Mlinaric-Rascan, I. & Turk, B. (2003) B cell receptor-mediated nuclear fragmentation proceeds in WEHI 231 cells in the absence of detectable DEVDase and Frase activity. FEBS Lett. 553, 5155.[CrossRef][Medline]
Muller, B., Cooper, L. & Terhorst, C. (1994) Molecular cloning of the human homologue to the pig protein-tyrosine kinase syk. Immunogenetics 39, 359362.[Medline]
Nossal, G.J. (1994) Negative selection of lymphocytes. Cell 76, 229239.[CrossRef][Medline]
Sada, K., Takano, T., Yanagi, S. & Yamamura, H. (2001) Structure and function of Syk protein-tyrosine kinase. J. Biochem.
130, 177186.
Siemasko, K., Eisfelder, B.J., Williamson, E., Kabak, S. & Clark, M.R. (1998) Cutting edge: signals from the B lymphocyte antigen receptor regulate MHC class II containing late endosomes. J. Immunol.
160, 52035208.
Stoddart, A., Dykstra, M.L., Brown, B.K., Song, W., Pierce, S.K. & Brodsky, F.M. (2002) Lipid rafts unite signaling cascades with clathrin to regulate BCR internalization. Immunity 17, 451462.[CrossRef][Medline]
Takao, N., Mori, R., Kato, H., Shinohara, A. & Yamamoto, K. (2000) c-Abl tyrosine kinase is not essential for ataxia telangiectasia mutated functions in chromosomal maintenance. J. Biol. Chem.
275, 725728.
Takata, M., Homma, Y. & Kurosaki, T. (1995) Requirement of phospholipase C-
2 activation in surface immunoglobulin M-induced B cell apoptosis. J. Exp. Med.
182, 907914.
Takata, M., Sabe, H., Hata, A., et al. (1994) Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca2+ mobilization through distinct pathways. EMBO J. 13, 13411349.[Medline]
Taniguchi, T., Kobayashi, T., Kondo, J., et al. (1991) Molecular cloning of a porcine gene syk that encodes a 72-kDa protein-tyrosine kinase showing high susceptibility to proteolysis. J. Biol. Chem.
266, 1579015796.
Tsubata, T., Wu, J. & Honjo, T. (1993) B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40. Nature 364, 645648.[CrossRef][Medline]
Turner, M., Mee, P.J., Costello, P.S., et al. (1995) Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378, 298302.[CrossRef][Medline]
Wang, J.Y. (2000) Regulation of cell death by Abl tyrosine kinase. Oncogene 19, 56435650.[CrossRef][Medline]
Yamanashi, Y., Fukuda, T., Nishizumi, H., et al. (1997) Role of tyrosine phosphorylation of HS1 in B cell antigen receptor-mediated apoptosis. J. Exp. Med.
185, 13871392.
Yanagi, S., Inatome, R., Ding, J., Kitaguchi, H., Tybulewicz, V.L.J. & Yamamura, H. (2001) Syk expression in endothelial cells and their morphologic defects in embryonic Syk-deficient mice. Blood
98, 28692871.
Received: 11 July 2004
Accepted: 13 October 2004
This article has been cited by other articles:
![]() |
Q. Wang, J. Li, J. Gu, B. Huang, Y. Zhao, D. Zheng, Y. Ding, and L. Zeng Potentiation of (-)-epigallocatechin-3-gallate-induced apoptosis by bortezomib in multiple myeloma cells Acta Biochim Biophys Sin, December 1, 2009; 41(12): 1018 - 1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tohyama and H. Yamamura Protein Tyrosine Kinase, Syk: A Key Player in Phagocytic Cells J. Biochem., March 1, 2009; 145(3): 267 - 273. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhang, A. C. Zambon, K. Vranizan, K. Pothula, B. R. Conklin, and P. A. Insel Gene Expression Signatures of cAMP/Protein Kinase A (PKA)-promoted, Mitochondrial-dependent Apoptosis: COMPARATIVE ANALYSIS OF WILD-TYPE AND cAMP-DEATHLESS S49 LYMPHOMA CELLS J. Biol. Chem., February 15, 2008; 283(7): 4304 - 4313. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lau, X. Wang, L. Song, M. North, S. Wiehler, D. Proud, and C.-W. Chow Syk Associates with Clathrin and Mediates Phosphatidylinositol 3-Kinase Activation during Human Rhinovirus Internalization J. Immunol., January 15, 2008; 180(2): 870 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, C. Lau, S. Wiehler, A. Pow, T. Mazzulli, C. Gutierrez, D. Proud, and C.-W. Chow Syk Is Downstream of Intercellular Adhesion Molecule-1 and Mediates Human Rhinovirus Activation of p38 MAPK in Airway Epithelial Cells J. Immunol., November 15, 2006; 177(10): 6859 - 6870. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shi, Y. Tohyama, T. Kadono, J. He, S. M. Shahjahan Miah, R. Hazama, C. Tanaka, K. Tohyama, and H. Yamamura Protein-tyrosine kinase Syk is required for pathogen engulfment in complement-mediated phagocytosis Blood, June 1, 2006; 107(11): 4554 - 4562. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |