GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 63-73. doi:10.1111/j.1365-2443.2005.00815.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, K.
Right arrow Articles by Kubota, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, K.
Right arrow Articles by Kubota, Y.

Intrinsic nuclear import activity of geminin is essential to prevent re-initiation of DNA replication in Xenopus eggs

Kazumasa Yoshida, Haruhiko Takisawa and Yumiko Kubota*

Department of Biology, Graduate School of Science, Osaka University, Toyonaka, Osaka 560–0043, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Prior to S phase, eukaryotic chromosomes are licensed for initiation of DNA replication, and re-licensing is prohibited after S phase has started until late mitosis, thus ensuring that genomic DNA is duplicated precisely once in each cell cycle. Here, we report that over-expression of Cdt1, an essential licensing protein, induced re-replication in Xenopus egg extracts. Geminin, a metazoan-specific inhibitor of Cdt1, was critical for preventing re-replication induced by Cdt1. Re-replication induced by the addition of recombinant Cdt1 and/or by the depletion of geminin from extracts was enhanced by a proteasome inhibitor, which suppressed the degradation of Cdt1 in the extracts. Furthermore, a nuclear localization sequence identified in Xenopus geminin had a significant role in the suppression of re-replication induced by Cdt1. These results suggest that nuclear accumulation of geminin plays a dominant role in the licensing system of Xenopus eggs.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
In eukaryotic cells, replication licensing is a mechanism that ensures the precise duplication of chromosomal DNA in a single cell division cycle (Blow & Hodgson 2002; Nishitani & Lygerou 2002). This mechanism is conserved at the molecular levels from yeasts to humans. Licensing is established by the assembly of a prereplicative complex (pre-RC) on to each origin of replication. The pre-RC is assembled during the late M to G1 phase by the sequential loading of the origin recognition complex (ORC), Cdc6, Cdt1 and Mcm2–7 on to chromatin. Re-assembly is prohibited after cells enter S-phase and until the end of mitosis, thus preventing the re-replication of genomic DNA during the cell cycle. Defect in the licensing system is potentially a major cause of chromosomal polyploidy and genomic instability, both of which occur commonly in cancer cells. Accordingly, recent investigations have focused on how licensing is controlled in proliferating cells. However, the mechanism controlling licensing differs among eukaryotes. In budding and fission yeasts, the suppression of re-licensing appears to be mediated by cyclin-dependent kinase (CDK) activity as inhibition of CDK at the G2 phase leads to the re-replication of DNA (Hayles et al. 1994; Dahmann et al. 1995). Although it is not known exactly how CDKs regulate licensing, triple mutations suppressing phosphorylation of Orc2 and degradation of Cdc6 and facilitating nuclear localization of Mcm2–7 are all required to induce re-replication in budding yeast (Nguyen et al. 2001). In fission yeast, the overproduction of Cdc18/Cdc6 leads to re-replication, with the overproduction of Cdt1 enhancing the re-replication by Cdc18 (Nishitani et al. 2000; Gopalakrishnan et al. 2001; Yanow et al. 2001). The level of the Cdc6/Cdc18 protein in yeast cells is strictly controlled by degradation during the S to G2 phase, and the regulation of the degradation is one of the targets of CDK (Blow & Hodgson 2002; Nishitani & Lygerou 2002). In mammalian cells, the level of Cdt1 but not Cdc6 is strictly regulated during the cell cycle by timely transcription and degradation, such that Cdt1 is present only during the G1 phase (Fujita et al. 1999; Nishitani et al. 2001). The overproduction of Cdt1 but not Cdc6 has been shown to induce the re-replication in mammalian cell cycle (Vaziri et al. 2003; Nishitani et al. 2004). Again, CDK exerts its inhibitory effect on the licensing by promoting the degradation of Cdt1 through its phosphorylation (Liu et al. 2004; Sugimoto et al. 2004).

In addition to the degradation of pre-RC components, metazoans have evolved an additional mechanism to prevent re-replication, namely the inhibition of licensing by geminin. Geminin was originally identified by screening cDNA libraries for proteins that were degraded during mitosis (McGarry & Kirschner 1998). Geminin has been shown to inhibit licensing by binding specifically to Cdt1 (Wohlschlegel et al. 2000). In M-phase extracts of Xenopus eggs, geminin is present in excess over Cdt1, thus preventing licensing at M-phase (Tada et al. 2001; Hodgson et al. 2002). In mammalian cells, geminin is expressed at the onset of S-phase and the depletion of geminin has recently been reported to induce re-replication (Wohlschlegel et al. 2000; Melixetian et al. 2004; Zhu et al. 2004). Moreover, the depletion of geminin has been shown to induce re-replication in Drosophila cells, and the concomitant depletion of Cdt1 prevents this re-replication (Mihaylov et al. 2002). These data reinforced the view that geminin acts as an inhibitor of re-replication through its binding to Cdt1. Since no homologous protein has been found in budding or fission yeast, geminin appears to be a metazoan-specific factor involved in the control of the licensing.

In interphase Xenopus egg extracts, the control of the licensing after the initiation of replication is only poorly understood, in particular the role of geminin. A previous report has shown that depletion of geminin from M-phase extracts is not sufficient to induce re-replication of sperm chromatin, suggesting that geminin is just one of multiple fail-safe mechanisms that prevent re-replication in these extracts (McGarry & Kirschner 1998). In M-phase extracts, both the depletion of geminin and the inhibition of CDK activity are required for the efficient licensing of chromatin (Tada et al. 2001). It is not known whether Cdt1 by itself has the ability to induce the re-replication of sperm chromatin in the interphase extracts. In addition, the original licensing factor hypothesis proposed that the nuclear envelope plays an essential role in preventing re-replication in the egg extracts because intact G2 nuclei failed to be replicated after transfer to fresh extract and re-replication of G2 nuclei was induced only after the nuclear envelope had been transiently permeabilized (Blow & Laskey 1988). However, there is as yet no reinforcing data to clarify the role of the nuclear envelope in preventing re-replication in the interphase extracts.

Here, we report that the addition of recombinant Cdt1 induced the re-replication of sperm chromatin in interphase extracts, and that the depletion of geminin from the extracts also led to re-replication. In addition, we found that the active accumulation of geminin in nuclei plays an essential role in preventing the re-replication induced by Cdt1. These results suggest that the role of the nuclear envelope in the control of the licensing is to promote the nuclear accumulation of the licensing inhibitor geminin.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Re-replication of DNA in interphase egg extracts induced by recombinant Cdt1

We first examined the effect of Cdt1 on DNA replication using interphase egg extracts, in which entry into mitosis was prevented by the addition of cycloheximide, an inhibitor of protein synthesis. We prepared recombinant Xenopus Cdt1 protein, which is more than 90% pure as judged by staining of protein following electrophoresis (Fig. 1A). The recombinant protein, which exhibited a molecular mass (74 kDa) similar to that of the endogenous Cdt1 present in the extracts (Fig. 1A), was able to rescue the replication activity of Cdt1-depleted extracts (Fig. S1). DNA replication was monitored by the incorporation of [{alpha}-32P]dCTP into sperm chromatin DNA incubated in the extracts. Replication was initiated approximately 30 min after the addition of sperm chromatin to the extracts and reached a plateau within 60–90 min (Fig. 1B). In parallel with changes in replication activity, the nuclear localization of Mcm2 was prominent at the onset of replication (30 min) and had diminished by 90 min (Fig. 1C). Only small amounts of Mcm2, Cdt1, Cdc45, and DNA polymerase {alpha} (Pol{alpha}) remained associated with chromatin following a 90 min incubation (Fig. 1D). These results indicated that the first round of DNA replication was completed 90 min after the addition of sperm chromatin. Recombinant Cdt1, or elution buffer used in its preparation, was then added to the extracts and the incorporation of [{alpha}-32P]dCTP was monitored for a further 90 min (Fig. 1B). The addition of an amount of recombinant Cdt1 equivalent to the amount of the endogenous protein induced additional DNA replication. The amount of total incorporation of [{alpha}-32P]dCTP into sperm DNA in the presence of recombinant Cdt1 at 180 min was approximately twice the level of incorporation observed in response to the addition of buffer alone, which induced no appreciable additional incorporation (Fig. 1B). Concomitant with the additional replication, Cdt1, Mcm2, Cdc45, and Pol{alpha} became re-associated with the chromatin following the addition of Cdt1. The binding of Cdc6 to chromatin decreased after the addition of Cdt1 to extracts, which is presumably due to the re-binding of Mcm2–7 on to chromatin. In contrast, the binding of Orc2 as a loading control was unchanged in response to the addition of Cdt1 (Fig. 1D). These results, in particular the re-association of Mcm2 with chromatin, suggest that Cdt1 induces the re-licensing of chromatin in the extracts, which is followed by the re-replication of DNA.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1  Additional DNA synthesis and re-licensing induced by Cdt1. (A) Characterization of recombinant Cdt1. Recombinant Cdt1 and interphase egg extracts (1 µL) were resolved by SDS-PAGE and transferred to a nitrocellulose membrane. Proteins on the membrane were visualized by Ponceau S-staining and Cdt1 was identified with an antibody to Cdt1. (B) Induction of additional DNA synthesis by recombinant Cdt1. Sperm chromatin (1000 nuclei/µL) was incubated in interphase egg extract at 23 °C in the presence of 20 µg/mL cycloheximide. Either recombinant Cdt1 (33 nM) or elution buffer was added to the extracts at 90 min. The replication of DNA was monitored by the incorporation of [{alpha}-32P]dCTP into the sperm DNA. Replication products were subjected to agarose gel electrophoresis followed by autoradiography. Relative intensities of the products as visualized by autoradiography were analysed and plotted against time, using the value of the 180 min control (+buffer) incubation as 100%. (C) Immunofluorescence detection of Mcm2 on chromatin. Sperm chromatin was incubated in interphase extracts as in B and 33 nM Cdt1 (+Cdt1) or elution buffer (+buffer) was added to the extracts 90 min after the start of incubation. At the times indicated, samples were treated with NP40 and fixed with formaldehyde, and the localization of Mcm2 was visualized with rabbit anti-Mcm2 antibody followed by Alexa 488-labelled anti-rabbit IgG. DNA was visualized with Hoechst 33258. Bar 20 µm. (D) Reloading of replication proteins on to chromatin after the addition of Cdt1. The samples were prepared as in C and the chromatin fractions were isolated at the indicated times by centrifugation through a 10% sucrose layer. The isolated fractions and 1 µL of the extracts were resolved by SDS-PAGE and immunoblotted with antibodies against the proteins indicated.

 


View larger version (31K):
[in this window]
[in a new window]
 
Figure S1  Rescue of DNA replication activity by recombinant Cdt1. The egg extracts were treated with control or anti-Cdt1 antibodies bound to a protein A matrix. Sperm chromatin was incubated in mock-depleted extracts (mock) or Cdt1-depleted extracts with ({Delta}Cdt1 + rec. Cdt1) or without ({Delta}Cdt1) 33 nM Cdt1 for 60 min at 23 oC. Samples were fixed and DNA was visualized by Hoechst 33 258 dye. Replication activities were monitored as the incorporation of Cy3-dCTP into chromatin DNA. The relative intensities of Cy3 fluorescence were measured for at least 100 nuclei and the average incorporation was compared to that found in nuclei in mock-depleted extracts, which was defined as 100%.

 
To confirm that re-replication was occurring, we have analysed replicated DNA labelled with BrdUTP and [{alpha}-32P]dCTP by CsCl density-gradient centrifugation. The distribution of radioactivity shows that the re-replicated products with heavy-heavy (HH) DNA were formed upon the addition of Cdt1. No HH DNA was detected in extracts to which buffer alone was added, indicating that only a single round of replication occurred in the absence of additional recombinant Cdt1 (Fig. 2A). Since the permeabilization of the nuclear envelope can induce re-replication in these extracts, we next examined whether the nuclear envelope remained intact following the addition of Cdt1. We monitored the integrity of the nuclear envelope by the exclusion of fluorescently labelled BSA from the nuclei and found that most of the nuclei remained intact even after the addition of Cdt1 (data not shown). Furthermore, the addition of Cdt1 at the start of the incubation, i.e. before nuclear formation had occurred, also induced re-replication although the amount of re-replicated DNA was less than that observed when the same concentration of Cdt1 was added after the completion of the first round of replication (Fig. 2A). These results suggest that the addition of recombinant Cdt1 induces the re-replication of DNA in interphase extracts, but does not lead to the breakdown of the nuclear envelope. It should also be noted that the amount of re-replicated DNA increased with increasing concentrations of recombinant Cdt1 (Fig. 2B). The lower re-replication inducing activity of Cdt1 when added at the start of the incubation may be due to the inactivation of Cdt1 during the incubation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2  Re-replication in the interphase extracts induced by Cdt1. (A) Density analysis of replication products in the presence and absence of recombinant Cdt1. Sperm chromatin was incubated in egg extracts in the presence of BrdUTP and [{alpha}-32P]dCTP for 180 min at 23 °C. At 0 or 90 min after the start of incubation, 33 nM Cdt1 or elution buffer was added to the reaction as indicated in the figure. Replication products were analysed by CsCl density gradient centrifugation. The radioactivity of 32P in each fraction was analysed by autoradiography. Density shown by arrowheads: HL (heavy-light DNA) 1.75, HH (Heavy-heavy DNA) 1.79. (B) Dose-dependent induction of re-replication by recombinant Cdt1. Sperm chromatin was incubated in the egg extracts at 23 °C in the presence of BrdUTP, [{alpha}-32P]dCTP, various concentration of Cdt1 (0, 13, 33, 66 nM). After incubation for 180 min, the density of each replicated product was examined. The percentage of re-replication for the total replicated DNA was calculated from the peak areas of HL and HH.

 
Role of Cdt1 degradation in the prevention of re-replication in interphase extracts

To explore possibility of Cdt1 inactivation during the incubation, we investigated whether Cdt1 is modified in the extracts during incubation. Figure 3A shows the results of Western blot analysis of Cdt1 and Orc2 after incubation in the extracts for various periods of times. When sperm chromatin was included in the extracts allowing nuclear formation and subsequent DNA replication, the levels of Cdt1 were decreased markedly about 30 min after the start of the incubation, while the levels of Orc2 remained constant during the incubation. In the absence of sperm chromatin (–sperm), the levels of both Cdt1 and Orc2 in the extracts remained constant. The addition of a proteasome inhibitor (MG132) or a CDK inhibitor (p21) to the extracts prevented the decrease in the levels of Cdt1 during incubation in the presence of sperm chromatin. These results suggest that the decrease in the level of Cdt1 in the extracts was due to the degradation of Cdt1 by the proteasome that was active only in the presence of sperm chromatin and CDK activity, both of which are required for DNA replication.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3  Involvement of proteasome in the inactivation of Cdt1. (A) The stability of Cdt1 in the extracts under various conditions. Egg extracts were incubated in the presence (+sperm) and the absence (–sperm) of sperm chromatin. MG132 (50 µM, +MG132) or GST-p21 (50 µg/mL, +p21) was included in the extracts in the presence of sperm nuclei. At the times indicated in the figure, 1 µL of extracts was isolated and resolved by SDS-PAGE followed by immunoblotting with antibodies against Cdt1 or Orc2. (B) Effect of a proteasome inhibitor on re-replication in the extracts. Sperm chromatin was incubated in the egg extracts in the presence (+MG132, +Cdt1 +MG132) and absence (control, +Cdt1) of 50 µM MG132. Cdt1 (33 nM) was included in the sample as indicated by +Cdt1. After 180 min incubation, replication products were analysed as described in the legend to Figure 2.

 
We next examined the role of Cdt1 degradation in the prevention of re-replication in the extracts (Fig. 3B). When re-replication was monitored in the presence of recombinant Cdt1, the amount of re-replicated DNA (HH) was increased in the presence of MG132. The total amount of re-replicated DNA in the presence of MG132 was as much as three times greater than that observed in its absence. Consistent with this result, we observed that MG132 stabilized the recombinant Cdt1 in the extracts (Fig. S2). We observed no re-replication of DNA in the absence of recombinant Cdt1 even in the presence of MG132, and detected the formation of heavy-light DNA alone. These results indicate that degradation of Cdt1 suppressed the re-replication induced by exogenously added Cdt1, and that inhibition of the proteasome is not sufficient to induce re-replication in the extracts.



View larger version (13K):
[in this window]
[in a new window]
 
Figure S2  Proteasome-dependent degradation of recombinant Cdt1. Sperm chromatin was incubated in Cdt1-depleted extracts supplemented with 33 nM Cdt1 in the absence (rec. Cdt1) or presence (rec. Cdt1 +MG132) of 50 µM MG132. At the times indicated in the figure, one µL of extracts was isolated and resolved by SDS-PAGE followed by immunobotting with antibodies against Cdt1 and Orc2. The intensity of each band was measured by NIH Image, and the amount of Cdt1 (%) was normalized to that of Orc2.

 
Re-replication of DNA in geminin-depleted extracts

Geminin is one of the critical factors preventing re-replication of metazoan chromosomes. In interphase extracts, geminin is present as an inactive form, thus allowing the formation of pre-RC. It becomes active following nuclear translocation, which is believed to contribute to the suppression of re-replication (Hodgson et al. 2002). We made use of geminin-depleted extracts to directly examine the significance of endogenous geminin in the prevention of re-replication. Approximately 70% of endogenous Cdt1 was eliminated in the geminin-depleted extracts, indicating that a fraction of Cdt1 forms a complex with geminin (Fig. 4A inset). Sperm chromatin was incubated in mock and geminin-depleted extracts in the presence and absence of recombinant Cdt1 for 180 min, and the replicated DNA was analysed by CsCl density-gradient centrifugation (Fig. 4A). The absence of heavy-heavy DNA in mock-depleted extracts in the absence of Cdt1 confirms that only a first round of DNA replication occurs in the presence of endogenous geminin. In geminin-depleted extracts, we detected the formation of a small but distinct amount of heavy-heavy DNA, even in the absence of recombinant Cdt1. In the presence of recombinant Cdt1, re-replication was observed in mock-depleted extracts, and this re-replication induced by Cdt1 was markedly increased in geminin-depleted extracts (Fig. 4A).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4  Re-replication of DNA in geminin-depleted extracts. (A) Density analysis of replication products in mock- and geminin-depleted extracts. Sperm chromatin was incubated in mock- and geminin-depleted extracts in the absence and presence of 33 nM Cdt1 (+Cdt1) for 180 min. The replication products were analysed by CsCl density gradient centrifugation. Inset: geminin depletion from the egg extracts. The interphase egg extracts were treated with control or anti-geminin antibodies bound to protein A matrix. Aliquots of mock-depleted ({Delta}mock) and geminin-depleted extracts ({Delta}geminin) were resolved by SDS-PAGE and immunoblotted with antibodies against geminin and Cdt1. (B) Promotion of re-replication in geminin-depleted extracts by a proteasome inhibitor. Sperm chromatin was incubated in the mock- or geminin-depleted extracts in the absence or presence of 50 µM MG132 for 180 min, and the replication products were analysed by CsCl density gradient centrifugation.

 
We next examined whether proteasome activity is involved in regulating re-replication in the absence of geminin. As shown in Fig. 4B, the addition of MG132 doubled the level of re-replication in the absence of geminin, although MG132 alone could not induce re-replication in the presence of endogenous geminin. These results suggest that endogenous geminin is the main factor preventing the induction of re-replication by endogenous or recombinant Cdt1, and that proteasome activity plays a role in the prevention of re-replication observed in the absence of geminin.

Identification of nuclear localization signal of Xenopus geminin

The accumulation of geminin in the nucleus is crucial to the prevention of re-replication. However, it is not known how geminin is imported into the nuclei in the extracts. In order to investigate the nuclear transport of geminin, we constructed recombinant Xenopus and human geminin fused to GFP (geminin-GFP) and examined their import into the nuclei (Fig. 5A). To monitor nuclear import, we added geminin-GFP to the extract after the formation of nuclei and observed the nuclear localization of geminin-GFP by fluorescence microscopy. Figure 5A shows that Xenopus geminin-GFP accumulated in the nuclei assembled in the extracts. Only diffuse signal was observed when the incubation was performed at 0 °C or in the presence of GTP{gamma}S (data not shown), both of which inhibit the active nuclear transport of protein. These data suggest that the nuclear accumulation of Xenopus geminin-GFP is due to transport through the nuclear pore, and not by simple diffusion and binding to chromatin. In contrast, human geminin did not efficiently accumulate in nuclei that assembled in the egg extracts (Fig. 5A). Because in cultured mammalian cells, the nuclear transport of geminin is apparently dependent on Cdt1 (T. Mizuno and F. Hanaoka, H. Nishitani, personal communication), we next examined the effect of recombinant Cdt1 on the nuclear transport of geminin-GFP (Fig. 5A). The addition of recombinant Xenopus Cdt1 induced the accumulation of human geminin in the nuclei. On the other hand, the transport of Xenopus geminin in extracts is similar in the presence and absence of recombinant Cdt1. We next examined whether endogenous Cdt1 in the extracts was required for the nuclear transport of Xenopus geminin. Both pre-RC formation and DNA replication were strongly suppressed following the depletion of endogenous Cdt1 from the extracts (data not shown). However, geminin-GFP was observed to accumulate in nuclei with a similar efficiency in mock and Cdt1-depleted extracts (Fig. 5B). These data suggest that Xenopus geminin possesses its own NLS, but that human geminin is transported into the nucleus in a complex with Cdt1.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5  Nuclear import of Xenopus and human geminin in the extracts. (A) Fluorescent detection of nuclear accumulation of geminin-GFP. Sperm chromatin was preincubated in the egg extracts for 20 min at 23 °C to allow the assembly of the nuclear envelope around the sperm DNA. Thereafter, 100 nMXenopus geminin-GFP or human geminin-GFP was added to the extracts and incubated further for 30 min in the absence and presence of 33 nM recombinant Cdt1. DNA was stained by Hoechst 33258 dye and nuclear localization of geminin was detected by the fluorescence of GFP. Nuclear formation was confirmed by phase contrast microscopy (P.C.). Bar, 20 µm. (B) The effect of Cdt1-depletion on nuclear import of Xenopus geminin. The egg extracts were treated with control or anti-Cdt1 antibodies bound to protein A matrix. Aliquots of mock-depleted ({Delta}mock) and Cdt1-depleted ({Delta}Cdt1) extracts were resolved by SDS-PAGE and immunoblotted with antibody against Cdt1. In the mock- or Cdt1-depleted extract, the import activity of Xenopus geminin-GFP was measured as described in A. Bar, 20 µm.

 
To identify the amino acid sequence responsible for the nuclear import of geminin, we constructed various N- or C-terminal truncations of Xenopus geminin fused to GFP (Fig. 6A), and measured their import activity into nuclei. Figure 6B shows that a C-terminal truncation comprising amino acids 1–79 and an N-terminal truncation comprising amino acids 59–220, but not truncations comprising amino acids 70–220 or 81–220, are efficiently accumulated into the nuclei. These results therefore indicate that the N-terminal amino acids 59–79 of Xenopus geminin (TKRKLWNDQLTSKKAKVEVAV) contain sequences responsible for the nuclear import. Comparison with the corresponding sequence of human geminin (48SKRKHKNDHLTSTTSSPGVIV69), which requires Cdt1 for its nuclear localization, reveals that the Xenopus sequence contains two clusters of basic amino acids, corresponding to amino acids 60–62 (the first cluster) and amino acids 71–74 (the second cluster), while the human sequence contains the first cluster alone (amino acids 49–53). Since truncation of the first 69 N-terminal amino acids led to the loss of nuclear transport activity, the first cluster appears to be required for transport. The second cluster also appears to be required for the nuclear transport because the N-terminal 1–68 peptide was unable to localize to the nuclei (Fig. 6B). To examine whether both clusters are sufficient for nuclear transport, we constructed peptides comprising amino acids 59–78, which contains both clusters, and amino acids 59–68, which contains only the first cluster. Figure 6C shows the nuclear transport of fluorescently labelled BSA conjugated to these peptides. Only the peptide corresponding to amino acids 59–78 could direct BSA into nuclei, thus demonstrating that N-terminal amino acids 59–78 contain a bipartite nuclear localization signal that is necessary and sufficient to direct Xenopus geminin into nuclei.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6  Identification of nuclear localization sequence of Xenopus geminin. (A) A schematic diagram of various N- and C-terminal truncations of geminin. A series of truncations of Xenopus geminin were produced as described in the Experimental procedures. The destruction box (D-Box; 33–41 amino acid) and the coiled coil domain (Coiled-coil; 118–152 amino acid) are indicated. (B) Import activities of various truncated geminin fragments. Nuclear import activities of GFP-tagged geminin fragments (amino acids 1–58, 1–68, 1–79, 59–220, 70–220, 81–220) were examined as described in the legend for Figure 5. Bar, 20 µm. (C) Import activities of peptide fragments of Xenopus geminin. Peptide fragments corresponding to amino acids 59–78 or 59–68 of Xenopus geminin were conjugated to Alexa-488 labelled BSA, and the transport activity of the labelled BSA alone or conjugated to the peptides was examined. Bar, 20 µm.

 
A significant role for the geminin NLS in the inhibition of re-replication

In order to explore the function of the geminin NLS, we prepared GFP-tagged full-length (1–220) and NLS-deleted geminin (81–220), both of that retained similar inhibitory activity towards Cdt1, as judged by the inhibition of DNA replication in the extracts (Fig. 7A). These proteins were then tested for the ability to inhibit re-replication induced by recombinant Cdt1. Because either of these proteins inhibited replication when added before the assembly of pre-RC, they were added to the extracts 30 min after the addition of sperm chromatin, just after the initiation of DNA replication. At this point in the assay, pre-RC formation has been completed but re-replication has not been initiated, thus ensuring that the addition of geminin does not inhibit the first round of DNA replication. As shown in Fig. 7B, re-replicated DNA was detected only in the presence of recombinant Cdt1 in the extracts without addition of geminin. Full-length geminin efficiently inhibited the re-replication induced by Cdt1 and suppressed the formation of heavy-heavy DNA nearly completely, as was observed in the control experiment without addition of Cdt1. In contrast, NLS-deleted geminin failed to inhibit re-replication induced by Cdt1, and we detected the formation of re-replicated DNA, which was about one third of that observed in the presence of recombinant Cdt1 alone. These results demonstrate that the NLS activity of geminin is crucial for the prevention of re-replication induced by Cdt1.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 7  Effect of NLS deletion on the inhibitory activity of geminin. (A) Inhibition of DNA replication. Sperm chromatin was incubated in control extracts or those supplemented with full-length geminin (1–220) or an NLS-deleted fragment of geminin (81–220) in the presence of Cy3-dCTP. After 60 min, samples were fixed and replication was monitored by the incorporation of Cy3-dCTP into chromatin DNA. The relative intensities of Cy3 fluorescence were measured in at least 100 nuclei and the average incorporation was shown by taking the value of the control as 100%. (B) Inhibition of Cdt1-dependent re-replication. Sperm chromatin was incubated in the extracts in the presence (+Cdt1) and absence (control) of 33 nM recombinant Cdt1. At 30 min, 100 nM full-length geminin-GFP (1–220) or NLS-deleted fragment (81–220) was added to the extracts. After a further 150 min incubation, replication products were isolated and analysed by CsCl density gradient centrifugation.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
In this work, we have clarified the essential role of geminin in preventing the re-replication of DNA in Xenopus egg extracts based on the following findings. (1) Recombinant Cdt1 added to interphase extracts sufficient to overcome the inhibitory activity of endogenous geminin induced re-replication without accompanying nuclear envelope breakdown. (2) The depletion of endogenous geminin from interphase extracts led to re-replication. (3) Geminin contains an NLS, and NLS-deleted geminin failed to prevent re-replication induced by Cdt1 after the nuclear formation although it inhibited licensing before nuclear formation as efficiently as full-length geminin. We have thus revised the original licensing factor hypothesis in terms of the inhibition of re-replication by geminin.

Re-replication induced by Cdt1

Previous studies with cultured mammalian cells have shown that over-expression of Cdt1 can induce the re-replication of genomic DNA during a single cell cycle (Vaziri et al. 2003; Nishitani et al. 2004). Cdt1 has now been acknowledged as a critical factor for the induction of re-replication in mammalian cells, although simultaneous inactivation of the p53-dependent checkpoint pathway may be required for re-replication. We have found that the addition of recombinant Cdt1 to Xenopus egg extracts induces re-replication of sperm chromatin, which is accompanied by the re-loading of Mcm2 on to chromatin. Since the nuclear envelope remained intact during the incubation, the present data indicate that exogenously added Cdt1 had been transported into the nuclei, overcoming the inhibitory activity of endogenous geminin in the nuclei and facilitating the re-licensing of chromatin. Such re-replication activity of Cdt1 has been observed with egg extracts by others (J. J. Blow, M. Mechali and J. Walter, personal communication). Although the mutant form of RanGTPase, RanT24N has been recently reported to induce re-replication in Xenopus extracts (during the course of the revision of this manuscript, the original paper was retracted by Newport (2004)), we could not detect re-replication when varying concentrations of RanT24N (from 2 to 10 µM) were added to the extracts after the completion of the first round of replication (data not shown). We further found that depletion of endogenous geminin led to re-replication in the extracts. Upon depletion of geminin, we found that although more than 70% of Cdt1 was concomitantly depleted, the remaining Cdt1 was sufficient not only to support the first round of DNA replication but also to induce a second round. In addition, the depletion of geminin promoted re-replication induced by recombinant Cdt1, thus indicating that endogenous geminin partially inhibited the activity of exogenously added Cdt1. These results therefore suggest that Cdt1 could readily induce re-replication in the extracts when the inhibitory activity of geminin was abrogated. In other words, endogenous geminin plays a crucial role in preventing re-replication in Xenopus egg extracts.

In addition to the inhibition by geminin, Cdt1 was also inactivated following the initiation of DNA replication. Indeed, Cdt1 was degraded in a manner dependent upon the presence of sperm chromatin and CDK activity in the extracts (Fig. 2). The degradation of Cdt1 was apparently mediated by the ubiquitin-proteasome system, because the proteasome inhibitor, MG132, completely inhibited the degradation. A similar result has been recently obtained by J. Walter (personal communication). These studies suggest that Cdt1 is degraded following the initiation of replication, but that the inhibition of its degradation is not sufficient to induce re-replication in the extracts (Fig. 3B). This result contrasts with that found in C. elegans, in which CUL-4, a subunit of a ubiquitin-ligase complex that mediates the proteasome-dependent proteolysis of Cdt1, is essential to suppress the re-replication of genomic DNA (Zhong et al. 2003).

In mammalian cells, Cdt1 is degraded in a manner dependent upon its N-terminal region (Cy motif), which binds to Cyclin A at the onset of S-phase (Liu et al. 2004; Sugimoto et al. 2004). Cdt1 containing a deletion of its N-terminal Cy motif is stable throughout the cell cycle, and over-expression of this deletion mutant brings about re-replication of DNA more efficiently than that of full-length Cdt1 (Nishitani et al. 2004). Taken together with our current findings, these results suggest that the degradation of Cdt1 in interphase extracts is promoted by the CDK-dependent ubiquitin-ligase system. Although the identity of the ubiquitin-ligase system is not known yet, the APC/C system is apparently also involved in the degradation of Cdt1 in egg extracts prepared by treating CSF-arrested M-phase extracts with calcium (J. J. Blow, personal communication). Since the degradation of Cdt1 in the calcium-treated extracts occurs in the absence of sperm chromatin, these results suggest that Cdt1 is degraded in the egg extracts by at least two different pathways.

Nuclear import of geminin in the extracts

The present study demonstrates that Xenopus geminin contains an NLS. During the preparation of the manuscript, Benjamin et al. (2004) have reported that N-terminal amino acids 50–62 of Xenopus geminin are considered as a bipartite NLS. They have successfully shown that a cluster of basic amino acids (60–62) is necessary for nuclear import, which is consistent with our present work. However, they failed to prove that N-terminal amino acids 50–62 are sufficient for nuclear transport. In addition, they did not examine the necessity of a region 50–52, the first basic cluster of their proposed bipartite NLS. In this study, we have shown that N-terminal amino acids 1–68 tagged with GFP could not be accumulated into the nuclei. By constructing various truncations of the geminin proteins, we have localized the sequence responsible for the nuclear import of geminin to its N-terminal region of amino acids 59–79, which contains two clusters of basic amino acids (60–62 and 71–74). Since synthetic peptide corresponding to this region supported the nuclear import of fluorescently labelled BSA, the identified sequence acts as an NLS of Xenopus geminin.

In contrast, human geminin contains only one cluster of basic amino acids, which is insufficient to target the protein to the nuclei. Indeed, nuclear transport of Xenopus geminin occurs independently of Cdt1 in the extracts, while the transport of human geminin is dependent upon the addition of recombinant Cdt1. Transport of NLS-deleted Xenopus geminin was slightly enhanced by the addition of recombinant Cdt1 to the extracts (Fig. S3), suggesting that Xenopus geminin could be transported into nuclei through its binding to Cdt1. However, the effect of Cdt1 on the import of intact Xenopus geminin was marginal, even when excess amounts of Cdt1 were added to the extracts (Fig. 5A and S3). These results suggest that nuclear import of Xenopus geminin plays a more important role than mammalian geminin in preventing re-replication.



View larger version (38K):
[in this window]
[in a new window]
 
Figure S3  Transport activity of NLS-deleted geminin. Sperm chromatin was incubated in the egg extracts in the presence (+) and absence (–) of 33 nM recombinant Cdt1. At 30 min, 100 nM full-length geminin-GFP or NLS-deleted geminin (amino acids 81–220)-GFP was added to the extracts. After a further 30-min incubation, DNA was stained by Hoechst 33 258 dye and the nuclear localization of geminin was detected by the fluorescence of GFP. Bar = 20 mm.

 
To address the physiological roles of geminin transport, we have prepared NLS-deleted geminin, which retains an inhibitory activity towards Cdt1 that is similar to the full-length protein (Fig. 7A). When these proteins were added to extracts prior to pre-RC formation, the first round of DNA replication was severely inhibited. When added to extracts just after the initiation of the first round of replication, thus circumventing the inhibition of the first round of licensing, the full-length geminin efficiently inhibited re-replication induced by recombinant Cdt1. However, the NLS-deleted geminin failed to suppress re-replication fully, and a small but significant amount of re-replicated DNA was formed (Fig. 7B). Since the extent of re-replication depends on the concentration of recombinant Cdt1 in the extracts (Fig. 2B), the addition of the NLS-deleted geminin following nuclear formation should neutralize the recombinant Cdt1 residing outside of the nuclei, leading to the partial suppression of re-replication. While, some amount of recombinant Cdt1, which had been imported into the nuclei during 30 min incubation, can induce re-replication in the presence of NLS-deleted geminin. These data suggest that the nuclear import activity of geminin plays an essential role in preventing re-replication.

Revisiting the licensing factor hypothesis

The original licensing factor hypothesis proposed that the nuclear envelope plays an essential role in the control of licensing by preventing the entry of a hypothetical licensing factor into the nuclei (Blow & Laskey 1988). Although the original report did not exclude the possibility of the existence of possible negative factors that were imported into nuclei, the existence of a negative factor alone could not explain how the resealed G2 nuclei, putatively deficient in putative negative factors, could not be re-replicated in extracts (Coverley et al. 1993). Failure of re-replication therefore suggests the existence of a positive factor that is unable to cross the nuclear envelope. However, in egg extracts, none of proteins required for the pre-RC formation is excluded from the nucleus. We previously reported that Mcm2–7 appears to be excluded from G2 nuclei, and that Xenopus Mcm3 has no NLS activity (Kubota et al. 1995, 1997). However, accumulating evidence indicates that the Mcm2–7 complex is imported into germinal vesicles of oocytes (Lemaitre et al. 2002; Whitmire et al. 2002) and isolated nuclei in the extracts upon prolonged incubation (Lu et al. 1999; Sun et al. 2000). Consistent with these observations, we have identified an NLS activity in the Xenopus Mcm2 protein (unpublished observation). Both Cdc6 and Cdt1 each apparently contain NLS sequences, and they have been shown to be present in the nuclei. In the present study, we found that the nuclear import of geminin is so efficient that nuclear Cdt1 is inactivated instantaneously upon its import. Thus, we propose that the role of the nuclear envelope in preventing re-replication is to accumulate geminin in nuclei. The failure of re-licensing in resealed G2 nuclei is due to the fact that geminin is rapidly imported into nuclei, thus inactivating Cdt1 after the resealing. The fact that geminin is found only in metazoans suggests that evolution of the geminin system makes the requirement for the CDK system redundant for preventing re-replication. The present study suggests that the import of geminin plays a central role in the control of licensing in Xenopus egg extracts. Finally, it should be noted that the central role of CDK controlling re-replication holds true in the egg extracts. CDK has been shown to inhibit the loading of Mcm2–7 on to chromatin through the phosphorylation of Mcm proteins (Hendrickson et al. 1996; Findeisen et al. 1999), and the present study suggests that CDK activity in the nuclei initiates the degradation of Cdt1. Most importantly, CDK controls the formation of the nuclear envelope, which is the key feature that prevents the re-replication by geminin in the egg extracts.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Construction and expression of recombinant proteins

The ORF of Xenopus Cdt1 was amplified from Xenopus Oocyte cDNA by PCR using the 5'primer (CGGGATCCATGGCAGACATGTCGCAA) and the 3'primer (AAAACTCGAGCTAGAGAGACTCTTCTTCCT), and the products subcloned into the BamHI-XhoI site of pBluescript. The plasmid was then digested with BamHI and KpnI, and the fragment containing the ORF was subcloned into pQE-30. The resulting plasmid was digested with BamHI and SmaI, and the fragment containing the ORF was subcloned into pGEX6P-1 (Amersham Biosciences).

The GFP geminin fusion proteins were constructed on 6 x HisTag vector pQE30 (QIAGEN). The ORF of Xenopus geminin was amplified from Xenopus Oocyte cDNA by PCR using the 5'primer (CCGAATTCCCATGAATACCAACAAGAAGCAG) and the 3'primer (GGCTCGAGCCTAGACAGTATGTGCATCCATAT), and the product was subcloned into the EcoRI-XhoI site of pGEX4T-2. The ORF of GFP was digested from pGFP mut3.1(clontech) with KpnI and HindIII and subcloned into pQE-30. Full-length geminin (1–220) was amplified by PCR using the 5'primer (GCGGATCCATGAATACCAACAAGAAGCAG) and the 3'primer (CCGGTACCACAGTATGTGCATCCATATTC). The amino-terminal fragments were amplified by PCR using the 5'primer (GCGGATCCATGAATACCAACAAGAAGCAG) and one of the following 3'primers: CCGGTACCGAATTTTTAACAGGCTCTTTGGTC for 1–58, CCGGTACCAGCTGATCATTCCACAGC for 1–68, CCGGTACCTCAACAGCCACTTCAAC for 1–79. The carboxyl-terminal fragments were amplified by PCR using one of the following 5'primers: GCGGATCCACAAAAAGAAAGCTGTGG for 59–220, GCGGATCCTCAAAAAAGGCTAAAGTTGAA for 70–220, GCGGATCCCCAGAACACAGGGAAAAC for 81–220 and the 3'primer (CCGGTACCACAGTATGTGCATCCATATTC). These PCR products were digested by BamHI and KpnI and subcloned into pQE-30 containing the ORF of GFP at their C-termini.

The ORF of human geminin was amplified from HeLa cDNA by PCR using the 5'primer (GCGGATCCATCAATCCCAGTATGAAGCAGAAACAAG) and the 3'primer (CCGGTACCGCTATACATGGCTTTGCATCC), and subcloned into the BamHI-KpnI site of pQE-30 containing the ORF of GFP at its C-terminus.

All constructs were sequenced with an automatic DNA sequencer (Applied Biosystems 310).

The recombinant Cdt1 protein was expressed in Escherichia coli BL21, purified with glutathione beads, and eluted by the prescission protease following the instructions of the supplier (Amersham Biosciences) with elution buffer (50 mM HEPES-KOH, 150 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol, pH 7.5). The recombinant geminin-GFP proteins were expressed in Escherichia Coli TG1 and purified with a Ni-NTA column following the instructions of the supplier (QIAGEN). Prior to use of the geminin-GFP proteins, the buffer was replaced to EB (50 mM HEPES-KOH, 100 mM KCl, and 2.5 mM MgCl2, pH 7.5).

Preparation of Xenopus egg extracts

Interphase extract and demembranated sperm nuclei were prepared as described (Kubota & Takisawa 1993). In all experiments, cycloheximide was added to the egg extract at a concentration of 20 µg/mL to inhibit protein synthesis. Immunodepletions of Xenopus proteins were carried out as described (Mimura & Takisawa 1998) except that rProtein A sepharose Fast Flow (Amersham Biosciences) was used instead of Affi-Prep protein A matrix (Bio-Rad).

Polyclonal rabbit antisera were raised against the recombinant full-length Xenopus geminin-GFP protein or a peptide corresponding to a C-terminal 20 amino acid sequence of Xenopus Cdt1, and further affinity-purified with the recombinant proteins immobilized on AffiGel 10 (Bio-Rad).

Fluorescence microscopy and chromatin fraction

Samples for fluorescence microscopy were prepared as described (Mimura & Takisawa 1998) and fluorescence images were captured with the Open Laboratory imaging program (Improvision). The chromatin fraction was prepared as previously described (Hashimoto & Takisawa 2003) except that the concentration of sperm DNA was 1000 nuclei/1 µL extracts.

Assay for DNA replication activity

The replication activities of egg extracts were monitored by the incorporation of [{alpha}-32P] dCTP into sperm DNA according to the method of Mimura & Takisawa (1998), except that the autoradiography was quantified by Image Gauge software (FUJIFILM).

For the CsCl gradient centrifugation, sperm DNA (1000 nuclei/1 µL extracts) was incubated in the egg extract containing [{alpha}-32P]dCTP and 0.5 mM BrdUTP for 180 min at 23 °C. The reactions were stopped by the addition of 1 mL cold Buffer A (20 mM HEPES-KOH, 50 mM NaCl and 5 mM EDTA, pH 7.6) and incubated for 5 min on ice. Nuclei were collected by centrifugation at 10 000 g for 5 min and resuspended in TE buffer (50 mM Tris-HCl and 5 mM EDTA, pH 7.5) containing 0.5 mg/mL proteinaseK, 0.5% SDS and 10 µg/mL RNase, and then incubated for 2 h at 37 °C. DNA was recovered by phenol: chloroform extraction, chloroform extraction, and ethanol precipitation. The samples were loaded on to a solution of CsCl (final density of 1.74 g/mL in TE) and centrifuged for 18 h at 72 000 r.p.m. in a Beckman TLN-100 rotor. 100 µL fractions were collected, spotted on to filter paper (DE81, Whatman) and autoradiographed with BAS 2000 (FUJIFILM).

Conjugation of peptide to BSA

BSA was labelled with Alexa-488 using the Alexa Fluor Protein Labeling Kit (Molecular Probes). The Alexa-BSA 2 mg/mL was incubated in 50 mM aliquots of phosphate buffer (pH 6.0) containing 0.3 mg/mL of the cross-linker MBS (maleimidebenzoyl-N-hydroxysuccinimide ester) for 30 min at room temperature, and excess cross-linker was removed by gel filtration. A 10-fold molar excess of the peptide (CGGTKRKLWNDQLTSKKAKVEVA or CGGTKRKLWNDQL) was added to MBS-activated Alexa-BSA. The pH was then adjusted to 7.5 and the reaction was allowed to proceed for 3 h at room temperature.


    Supplemental material
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
The following material is available from:

http://www.blackwellpublishing.com/products/journals/suppmat/GTC/GTC815/GTC815sm.htm


    Footnotes
 
Communicated by: Fumio Hanaoka

* Correspondence: E-mail: ykubota{at}bio.sci.osaka-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Benjamin, J.M., Torke, S.J., Demeler, B. & McGarry, T.J. (2004) Geminin has dimerization, Cdt1-binding, and destruction domains that are required for biological activity. J. Biol. Chem. 279, 45957–45968.[Abstract/Free Full Text]

Blow, J.J. & Laskey, R.A. (1988) A role for the nuclear envelope in controlling DNA replication within the cell cycle. Nature 332, 546–548.[CrossRef][Medline]

Blow, J.J. & Hodgson, B. (2002) Replication licensing—defining the proliferative state? Trends Cell Biol. 12, 72–78.[CrossRef][Medline]

Coverley, D., Downes, C.S., Romanowski, P. & Laskey, R.A. (1993) Reversible effects of nuclear membrane permeabilization on DNA replication: evidence for a positive licensing factor. J. Cell Biol. 122, 985–992.[Abstract/Free Full Text]

Dahmann, C., Diffley, J.F. & Nasmyth, K.A. (1995) S-phase-promoting cyclin-dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state. Curr. Biol. 5, 1257–1269.[CrossRef][Medline]

Findeisen, M., El-Denary, M., Kapitza, T., Graf, R. & Strausfeld, U. (1999) Cyclin A-dependent kinase activity affects chromatin binding of ORC, Cdc6, and MCM in egg extracts of Xenopus laevis. Eur. J. Biochem. 264, 415–426.[Medline]

Fujita, M., Yamada, C., Goto, H., et al. (1999) Cell cycle regulation of human CDC6 protein. Intracellular localization, interaction with the human mcm complex, and CDC2 kinase-mediated hyperphosphorylation. J. Biol. Chem. 274, 25927–25932.[Abstract/Free Full Text]

Gopalakrishnan, V., Simancek, P., Houchens, C., et al. (2001) Redundant control of rereplication in fission yeast. Proc. Natl. Acad. Sci. USA 98, 13114–13119.[Abstract/Free Full Text]

Hashimoto, Y. & Takisawa, H. (2003) Xenopus Cut5 is essential for a CDK-dependent process in the initiation of DNA replication. EMBO J. 22, 2526–2535.[CrossRef][Medline]

Hayles, J., Fisher, D., Woollard, A. & Nurse, P. (1994) Temporal order of S phase and mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin complex. Cell 78, 813–822.[CrossRef][Medline]

Hendrickson, M., Madine, M., Dalton, S. & Gautier, J. (1996) Phosphorylation of MCM4 by cdc2 protein kinase inhibits the activity of the minichromosome maintenance complex. Proc. Natl. Acad. Sci. USA 93, 12223–12228.[Abstract/Free Full Text]

Hodgson, B., Li, A., Tada, S. & Blow, J.J. (2002) Geminin becomes activated as an inhibitor of Cdt1/RLF-B following nuclear import. Curr. Biol. 12, 678–683.[CrossRef][Medline]

Kubota, Y., Mimura, S., Nishimoto, S., Takisawa, H. & Nojima, H. (1995) Identification of the yeast MCM3-related protein as a component of Xenopus DNA replication licensing factor. Cell 81, 601–609.[CrossRef][Medline]

Kubota, Y. & Takisawa, H. (1993) Determination of initiation of DNA replication before and after nuclear formation in Xenopus egg cell free extracts. J. Cell Biol. 123, 1321–1331.[Abstract/Free Full Text]

Kubota, Y., Mimura, S., Nishimoto, S., Masuda, T., Nojima, H. & Takisawa, H. (1997) Licensing of DNA replication by a multi-protein complex of MCM/P1 proteins in Xenopus eggs. EMBO J. 16, 3320–3331.[CrossRef][Medline]

Lemaitre, J.M., Bocquet, S. & Mechali, M. (2002) Competence to replicate in the unfertilized egg is conferred by Cdc6 during meiotic maturation. Nature 419, 718–722.[CrossRef][Medline]

Liu, E., Li, X., Yan, F., Zhao, Q. & Wu, X. (2004) Cyclin-dependent kinases phosphorylate human Cdt1 and induce its degradation. J. Biol. Chem. 279, 17283–17288.[Abstract/Free Full Text]

Lu, Z.H., Xu, H. & Leno, G.H. (1999) DNA replication in quiescent cell nuclei: regulation by the nuclear envelope and chromatin structure. Mol. Biol. Cell 10, 4091–4106.[Abstract/Free Full Text]

McGarry, T.J. & Kirschner, M.W. (1998) Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 1043–1053.[CrossRef][Medline]

Melixetian, M., Ballabeni, A., Masiero, L., et al. (2004) Loss of Geminin induces rereplication in the presence of functional p53. J. Cell Biol. 165, 473–482.[Abstract/Free Full Text]

Mihaylov, I.S., Kondo, T., Jones, L., et al. (2002) Control of DNA replication and chromosome ploidy by geminin and cyclin A. Mol. Cell. Biol. 22, 1868–1880.[Abstract/Free Full Text]

Mimura, S. & Takisawa, H. (1998) Xenopus Cdc45-dependent loading of DNA polymerase alpha onto chromatin under the control of S-phase Cdk. EMBO J. 17, 5699–5707.[CrossRef][Medline]

Newport. J. (2004) A Role for Ran-GTP and Crml in Blocking Re-Replication. Cell 119, 145.[CrossRef][Medline]

Nguyen, V.Q., Co, C. & Li, J.J. (2001) Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms. Nature 411, 1068–1073.[CrossRef][Medline]

Nishitani, H. & Lygerou, Z. (2002) Control of DNA replication licensing in a cell cycle. Genes Cells 7, 523–534.[Abstract]

Nishitani, H., Lygerou, Z., Nishimoto, T. & Nurse, P. (2000) The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404, 625–628.[CrossRef][Medline]

Nishitani, H., Taraviras, S., Lygerou, Z. & Nishimoto, T. (2001) The human licensing factor for DNA replication Cdt1 accumulates in G1 and is destabilized after initiation of S-phase. J. Biol. Chem. 276, 44905–44911.[Abstract/Free Full Text]

Nishitani, H., Lygerou, Z. & Nishimoto, T. (2004) Proteolysis of DNA replication licensing factor Cdt1 in S-phase is performed independently of geminin through its N-terminal region. J. Biol. Chem. 279, 30807–30816.[Abstract/Free Full Text]

Sugimoto, N., Tatsumi, Y., Tsurumi, T., et al. (2004) Cdt1 phosphorylation by cyclin A-dependent kinases negatively regulates its function without affecting geminin binding. J. Biol. Chem. 279, 19691–19697.[Abstract/Free Full Text]

Sun, W., Hola, M., Pedley, K., et al. (2000) The replication capacity of intact mammalian nuclei in Xenopus egg extracts declines with quiescence, but the residual DNA synthesis is independent of Xenopus MCM proteins. J. Cell Sci. 113, 683–695.[Abstract]

Tada, S., Li, A., Maiorano, D., Mechali, M. & Blow, J.J. (2001) Repression of origin assembly in metaphase depends on inhibition of RLF-B/Cdt1 by geminin. Nature Cell Biol. 3, 107–113.[CrossRef][Medline]

Vaziri, C., Saxena, S., Jeon, Y., et al. (2003) A p53-dependent checkpoint pathway prevents rereplication. Mol. Cell 11, 997–1008.[CrossRef][Medline]

Whitmire, E., Khan, B. & Coue, M. (2002) Cdc6 synthesis regulates replication competence in Xenopus oocytes. Nature 419, 722–725.[CrossRef][Medline]

Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C. & Dutta, A. (2000) Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science 290, 2309–2312.[Abstract/Free Full Text]

Yanow, S.K., Lygerou, Z. & Nurse, P. (2001) Expression of Cdc18/Cdc6 and Cdt1 during G2 phase induces initiation of DNA replication. EMBO J. 20, 4648–4656.[CrossRef][Medline]

Zhong, W., Feng, H., Santiago, F.E. & Kipreos, E.T. (2003) CUL-4 ubiquitin ligase maintains genome stability by restraining DNA-replication licensing. Nature 423, 885–889.[CrossRef][Medline]

Zhu, W., Chen, Y. & Dutta, A. (2004) Rereplication by depletion of geminin is seen regardless of p53 status and activates a G2/M checkpoint. Mol. Cell. Biol. 24, 7140–7150.[Abstract/Free Full Text]

Received: 7 September 2004
Accepted: 22 October 2004




This article has been cited by other articles:


Home page
Cancer Res.Home page
W. Zhu and M. L. DePamphilis
Selective Killing of Cancer Cells by Suppression of Geminin Activity
Cancer Res., June 1, 2009; 69(11): 4870 - 4877.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Sugimoto, K. Yoshida, Y. Tatsumi, T. Yugawa, M. Narisawa-Saito, S. Waga, T. Kiyono, and M. Fujita
Redundant and differential regulation of multiple licensing factors ensures prevention of re-replication in normal human cells
J. Cell Sci., April 15, 2009; 122(8): 1184 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. Tsuyama, S. Watanabe, A. Aoki, Y. Cho, M. Seki, T. Enomoto, and S. Tada
Repression of Nascent Strand Elongation by Deregulated Cdt1 during DNA Replication in Xenopus Egg Extracts
Mol. Biol. Cell, February 1, 2009; 20(3): 937 - 947.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Y. Kim, N. G. Starostina, and E. T. Kipreos
The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing
Genes & Dev., September 15, 2008; 22(18): 2507 - 2519.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. Liu, A. Y.-L. Lee, T. Chiba, E. Olson, P. Sun, and X. Wu
The ATR-mediated S phase checkpoint prevents rereplication in mammalian cells when licensing control is disrupted
J. Cell Biol., November 19, 2007; 179(4): 643 - 657.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. Luo, Y. Uerlings, N. Happel, N. S. Asli, H. Knoetgen, and M. Kessel
Regulation of Geminin Functions by Cell Cycle-Dependent Nuclear-Cytoplasmic Shuttling
Mol. Cell. Biol., July 1, 2007; 27(13): 4737 - 4744.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
E. E. Arias and J. C. Walter
Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells
Genes & Dev., March 1, 2007; 21(5): 497 - 518.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Tatsumi, N. Sugimoto, T. Yugawa, M. Narisawa-Saito, T. Kiyono, and M. Fujita
Deregulation of Cdt1 induces chromosomal damage without rereplication and leads to chromosomal instability
J. Cell Sci., August 1, 2006; 119(15): 3128 - 3140.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Matsuno, M. Kumano, Y. Kubota, Y. Hashimoto, and H. Takisawa
The N-Terminal Noncatalytic Region of Xenopus RecQ4 Is Required for Chromatin Binding of DNA Polymerase {alpha} in the Initiation of DNA Replication.
Mol. Cell. Biol., July 1, 2006; 26(13): 4843 - 4852.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. M. Green, R. J. Morreale, B. Ozaydin, J. L. DeRisi, and J. J. Li
Genome-wide Mapping of DNA Synthesis in Saccharomyces cerevisiae Reveals That Mechanisms Preventing Reinitiation of DNA Replication Are Not Redundant
Mol. Biol. Cell, May 1, 2006; 17(5): 2401 - 2414.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Iizuka, T. Matsui, H. Takisawa, and M. M. Smith
Regulation of Replication Licensing by Acetyltransferase Hbo1
Mol. Cell. Biol., February 1, 2006; 26(3): 1098 - 1108.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Yanagi, T. Mizuno, T. Tsuyama, S. Tada, Y. Iida, A. Sugimoto, T. Eki, T. Enomoto, and F. Hanaoka
Caenorhabditis elegans Geminin Homologue Participates in Cell Cycle Regulation and Germ Line Development
J. Biol. Chem., May 20, 2005; 280(20): 19689 - 19694.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, K.
Right arrow Articles by Kubota, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, K.
Right arrow Articles by Kubota, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS