|
|
||||||||
Department of Biology, Graduate School of Science, Osaka University, Toyonaka, Osaka 5600043, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In addition to the degradation of pre-RC components, metazoans have evolved an additional mechanism to prevent re-replication, namely the inhibition of licensing by geminin. Geminin was originally identified by screening cDNA libraries for proteins that were degraded during mitosis (McGarry & Kirschner 1998). Geminin has been shown to inhibit licensing by binding specifically to Cdt1 (Wohlschlegel et al. 2000). In M-phase extracts of Xenopus eggs, geminin is present in excess over Cdt1, thus preventing licensing at M-phase (Tada et al. 2001; Hodgson et al. 2002). In mammalian cells, geminin is expressed at the onset of S-phase and the depletion of geminin has recently been reported to induce re-replication (Wohlschlegel et al. 2000; Melixetian et al. 2004; Zhu et al. 2004). Moreover, the depletion of geminin has been shown to induce re-replication in Drosophila cells, and the concomitant depletion of Cdt1 prevents this re-replication (Mihaylov et al. 2002). These data reinforced the view that geminin acts as an inhibitor of re-replication through its binding to Cdt1. Since no homologous protein has been found in budding or fission yeast, geminin appears to be a metazoan-specific factor involved in the control of the licensing.
In interphase Xenopus egg extracts, the control of the licensing after the initiation of replication is only poorly understood, in particular the role of geminin. A previous report has shown that depletion of geminin from M-phase extracts is not sufficient to induce re-replication of sperm chromatin, suggesting that geminin is just one of multiple fail-safe mechanisms that prevent re-replication in these extracts (McGarry & Kirschner 1998). In M-phase extracts, both the depletion of geminin and the inhibition of CDK activity are required for the efficient licensing of chromatin (Tada et al. 2001). It is not known whether Cdt1 by itself has the ability to induce the re-replication of sperm chromatin in the interphase extracts. In addition, the original licensing factor hypothesis proposed that the nuclear envelope plays an essential role in preventing re-replication in the egg extracts because intact G2 nuclei failed to be replicated after transfer to fresh extract and re-replication of G2 nuclei was induced only after the nuclear envelope had been transiently permeabilized (Blow & Laskey 1988). However, there is as yet no reinforcing data to clarify the role of the nuclear envelope in preventing re-replication in the interphase extracts.
Here, we report that the addition of recombinant Cdt1 induced the re-replication of sperm chromatin in interphase extracts, and that the depletion of geminin from the extracts also led to re-replication. In addition, we found that the active accumulation of geminin in nuclei plays an essential role in preventing the re-replication induced by Cdt1. These results suggest that the role of the nuclear envelope in the control of the licensing is to promote the nuclear accumulation of the licensing inhibitor geminin.
| Results |
|---|
|
|
|---|
We first examined the effect of Cdt1 on DNA replication using interphase egg extracts, in which entry into mitosis was prevented by the addition of cycloheximide, an inhibitor of protein synthesis. We prepared recombinant Xenopus Cdt1 protein, which is more than 90% pure as judged by staining of protein following electrophoresis (Fig. 1A). The recombinant protein, which exhibited a molecular mass (74 kDa) similar to that of the endogenous Cdt1 present in the extracts (Fig. 1A), was able to rescue the replication activity of Cdt1-depleted extracts (Fig. S1). DNA replication was monitored by the incorporation of [
-32P]dCTP into sperm chromatin DNA incubated in the extracts. Replication was initiated approximately 30 min after the addition of sperm chromatin to the extracts and reached a plateau within 6090 min (Fig. 1B). In parallel with changes in replication activity, the nuclear localization of Mcm2 was prominent at the onset of replication (30 min) and had diminished by 90 min (Fig. 1C). Only small amounts of Mcm2, Cdt1, Cdc45, and DNA polymerase
(Pol
) remained associated with chromatin following a 90 min incubation (Fig. 1D). These results indicated that the first round of DNA replication was completed 90 min after the addition of sperm chromatin. Recombinant Cdt1, or elution buffer used in its preparation, was then added to the extracts and the incorporation of [
-32P]dCTP was monitored for a further 90 min (Fig. 1B). The addition of an amount of recombinant Cdt1 equivalent to the amount of the endogenous protein induced additional DNA replication. The amount of total incorporation of [
-32P]dCTP into sperm DNA in the presence of recombinant Cdt1 at 180 min was approximately twice the level of incorporation observed in response to the addition of buffer alone, which induced no appreciable additional incorporation (Fig. 1B). Concomitant with the additional replication, Cdt1, Mcm2, Cdc45, and Pol
became re-associated with the chromatin following the addition of Cdt1. The binding of Cdc6 to chromatin decreased after the addition of Cdt1 to extracts, which is presumably due to the re-binding of Mcm27 on to chromatin. In contrast, the binding of Orc2 as a loading control was unchanged in response to the addition of Cdt1 (Fig. 1D). These results, in particular the re-association of Mcm2 with chromatin, suggest that Cdt1 induces the re-licensing of chromatin in the extracts, which is followed by the re-replication of DNA.
|
|
-32P]dCTP by CsCl density-gradient centrifugation. The distribution of radioactivity shows that the re-replicated products with heavy-heavy (HH) DNA were formed upon the addition of Cdt1. No HH DNA was detected in extracts to which buffer alone was added, indicating that only a single round of replication occurred in the absence of additional recombinant Cdt1 (Fig. 2A). Since the permeabilization of the nuclear envelope can induce re-replication in these extracts, we next examined whether the nuclear envelope remained intact following the addition of Cdt1. We monitored the integrity of the nuclear envelope by the exclusion of fluorescently labelled BSA from the nuclei and found that most of the nuclei remained intact even after the addition of Cdt1 (data not shown). Furthermore, the addition of Cdt1 at the start of the incubation, i.e. before nuclear formation had occurred, also induced re-replication although the amount of re-replicated DNA was less than that observed when the same concentration of Cdt1 was added after the completion of the first round of replication (Fig. 2A). These results suggest that the addition of recombinant Cdt1 induces the re-replication of DNA in interphase extracts, but does not lead to the breakdown of the nuclear envelope. It should also be noted that the amount of re-replicated DNA increased with increasing concentrations of recombinant Cdt1 (Fig. 2B). The lower re-replication inducing activity of Cdt1 when added at the start of the incubation may be due to the inactivation of Cdt1 during the incubation.
|
To explore possibility of Cdt1 inactivation during the incubation, we investigated whether Cdt1 is modified in the extracts during incubation. Figure 3A shows the results of Western blot analysis of Cdt1 and Orc2 after incubation in the extracts for various periods of times. When sperm chromatin was included in the extracts allowing nuclear formation and subsequent DNA replication, the levels of Cdt1 were decreased markedly about 30 min after the start of the incubation, while the levels of Orc2 remained constant during the incubation. In the absence of sperm chromatin (sperm), the levels of both Cdt1 and Orc2 in the extracts remained constant. The addition of a proteasome inhibitor (MG132) or a CDK inhibitor (p21) to the extracts prevented the decrease in the levels of Cdt1 during incubation in the presence of sperm chromatin. These results suggest that the decrease in the level of Cdt1 in the extracts was due to the degradation of Cdt1 by the proteasome that was active only in the presence of sperm chromatin and CDK activity, both of which are required for DNA replication.
|
|
Geminin is one of the critical factors preventing re-replication of metazoan chromosomes. In interphase extracts, geminin is present as an inactive form, thus allowing the formation of pre-RC. It becomes active following nuclear translocation, which is believed to contribute to the suppression of re-replication (Hodgson et al. 2002). We made use of geminin-depleted extracts to directly examine the significance of endogenous geminin in the prevention of re-replication. Approximately 70% of endogenous Cdt1 was eliminated in the geminin-depleted extracts, indicating that a fraction of Cdt1 forms a complex with geminin (Fig. 4A inset). Sperm chromatin was incubated in mock and geminin-depleted extracts in the presence and absence of recombinant Cdt1 for 180 min, and the replicated DNA was analysed by CsCl density-gradient centrifugation (Fig. 4A). The absence of heavy-heavy DNA in mock-depleted extracts in the absence of Cdt1 confirms that only a first round of DNA replication occurs in the presence of endogenous geminin. In geminin-depleted extracts, we detected the formation of a small but distinct amount of heavy-heavy DNA, even in the absence of recombinant Cdt1. In the presence of recombinant Cdt1, re-replication was observed in mock-depleted extracts, and this re-replication induced by Cdt1 was markedly increased in geminin-depleted extracts (Fig. 4A).
|
Identification of nuclear localization signal of Xenopus geminin
The accumulation of geminin in the nucleus is crucial to the prevention of re-replication. However, it is not known how geminin is imported into the nuclei in the extracts. In order to investigate the nuclear transport of geminin, we constructed recombinant Xenopus and human geminin fused to GFP (geminin-GFP) and examined their import into the nuclei (Fig. 5A). To monitor nuclear import, we added geminin-GFP to the extract after the formation of nuclei and observed the nuclear localization of geminin-GFP by fluorescence microscopy. Figure 5A shows that Xenopus geminin-GFP accumulated in the nuclei assembled in the extracts. Only diffuse signal was observed when the incubation was performed at 0 °C or in the presence of GTP
S (data not shown), both of which inhibit the active nuclear transport of protein. These data suggest that the nuclear accumulation of Xenopus geminin-GFP is due to transport through the nuclear pore, and not by simple diffusion and binding to chromatin. In contrast, human geminin did not efficiently accumulate in nuclei that assembled in the egg extracts (Fig. 5A). Because in cultured mammalian cells, the nuclear transport of geminin is apparently dependent on Cdt1 (T. Mizuno and F. Hanaoka, H. Nishitani, personal communication), we next examined the effect of recombinant Cdt1 on the nuclear transport of geminin-GFP (Fig. 5A). The addition of recombinant Xenopus Cdt1 induced the accumulation of human geminin in the nuclei. On the other hand, the transport of Xenopus geminin in extracts is similar in the presence and absence of recombinant Cdt1. We next examined whether endogenous Cdt1 in the extracts was required for the nuclear transport of Xenopus geminin. Both pre-RC formation and DNA replication were strongly suppressed following the depletion of endogenous Cdt1 from the extracts (data not shown). However, geminin-GFP was observed to accumulate in nuclei with a similar efficiency in mock and Cdt1-depleted extracts (Fig. 5B). These data suggest that Xenopus geminin possesses its own NLS, but that human geminin is transported into the nucleus in a complex with Cdt1.
|
|
In order to explore the function of the geminin NLS, we prepared GFP-tagged full-length (1220) and NLS-deleted geminin (81220), both of that retained similar inhibitory activity towards Cdt1, as judged by the inhibition of DNA replication in the extracts (Fig. 7A). These proteins were then tested for the ability to inhibit re-replication induced by recombinant Cdt1. Because either of these proteins inhibited replication when added before the assembly of pre-RC, they were added to the extracts 30 min after the addition of sperm chromatin, just after the initiation of DNA replication. At this point in the assay, pre-RC formation has been completed but re-replication has not been initiated, thus ensuring that the addition of geminin does not inhibit the first round of DNA replication. As shown in Fig. 7B, re-replicated DNA was detected only in the presence of recombinant Cdt1 in the extracts without addition of geminin. Full-length geminin efficiently inhibited the re-replication induced by Cdt1 and suppressed the formation of heavy-heavy DNA nearly completely, as was observed in the control experiment without addition of Cdt1. In contrast, NLS-deleted geminin failed to inhibit re-replication induced by Cdt1, and we detected the formation of re-replicated DNA, which was about one third of that observed in the presence of recombinant Cdt1 alone. These results demonstrate that the NLS activity of geminin is crucial for the prevention of re-replication induced by Cdt1.
|
| Discussion |
|---|
|
|
|---|
Re-replication induced by Cdt1
Previous studies with cultured mammalian cells have shown that over-expression of Cdt1 can induce the re-replication of genomic DNA during a single cell cycle (Vaziri et al. 2003; Nishitani et al. 2004). Cdt1 has now been acknowledged as a critical factor for the induction of re-replication in mammalian cells, although simultaneous inactivation of the p53-dependent checkpoint pathway may be required for re-replication. We have found that the addition of recombinant Cdt1 to Xenopus egg extracts induces re-replication of sperm chromatin, which is accompanied by the re-loading of Mcm2 on to chromatin. Since the nuclear envelope remained intact during the incubation, the present data indicate that exogenously added Cdt1 had been transported into the nuclei, overcoming the inhibitory activity of endogenous geminin in the nuclei and facilitating the re-licensing of chromatin. Such re-replication activity of Cdt1 has been observed with egg extracts by others (J. J. Blow, M. Mechali and J. Walter, personal communication). Although the mutant form of RanGTPase, RanT24N has been recently reported to induce re-replication in Xenopus extracts (during the course of the revision of this manuscript, the original paper was retracted by Newport (2004)), we could not detect re-replication when varying concentrations of RanT24N (from 2 to 10 µM) were added to the extracts after the completion of the first round of replication (data not shown). We further found that depletion of endogenous geminin led to re-replication in the extracts. Upon depletion of geminin, we found that although more than 70% of Cdt1 was concomitantly depleted, the remaining Cdt1 was sufficient not only to support the first round of DNA replication but also to induce a second round. In addition, the depletion of geminin promoted re-replication induced by recombinant Cdt1, thus indicating that endogenous geminin partially inhibited the activity of exogenously added Cdt1. These results therefore suggest that Cdt1 could readily induce re-replication in the extracts when the inhibitory activity of geminin was abrogated. In other words, endogenous geminin plays a crucial role in preventing re-replication in Xenopus egg extracts.
In addition to the inhibition by geminin, Cdt1 was also inactivated following the initiation of DNA replication. Indeed, Cdt1 was degraded in a manner dependent upon the presence of sperm chromatin and CDK activity in the extracts (Fig. 2). The degradation of Cdt1 was apparently mediated by the ubiquitin-proteasome system, because the proteasome inhibitor, MG132, completely inhibited the degradation. A similar result has been recently obtained by J. Walter (personal communication). These studies suggest that Cdt1 is degraded following the initiation of replication, but that the inhibition of its degradation is not sufficient to induce re-replication in the extracts (Fig. 3B). This result contrasts with that found in C. elegans, in which CUL-4, a subunit of a ubiquitin-ligase complex that mediates the proteasome-dependent proteolysis of Cdt1, is essential to suppress the re-replication of genomic DNA (Zhong et al. 2003).
In mammalian cells, Cdt1 is degraded in a manner dependent upon its N-terminal region (Cy motif), which binds to Cyclin A at the onset of S-phase (Liu et al. 2004; Sugimoto et al. 2004). Cdt1 containing a deletion of its N-terminal Cy motif is stable throughout the cell cycle, and over-expression of this deletion mutant brings about re-replication of DNA more efficiently than that of full-length Cdt1 (Nishitani et al. 2004). Taken together with our current findings, these results suggest that the degradation of Cdt1 in interphase extracts is promoted by the CDK-dependent ubiquitin-ligase system. Although the identity of the ubiquitin-ligase system is not known yet, the APC/C system is apparently also involved in the degradation of Cdt1 in egg extracts prepared by treating CSF-arrested M-phase extracts with calcium (J. J. Blow, personal communication). Since the degradation of Cdt1 in the calcium-treated extracts occurs in the absence of sperm chromatin, these results suggest that Cdt1 is degraded in the egg extracts by at least two different pathways.
Nuclear import of geminin in the extracts
The present study demonstrates that Xenopus geminin contains an NLS. During the preparation of the manuscript, Benjamin et al. (2004) have reported that N-terminal amino acids 5062 of Xenopus geminin are considered as a bipartite NLS. They have successfully shown that a cluster of basic amino acids (6062) is necessary for nuclear import, which is consistent with our present work. However, they failed to prove that N-terminal amino acids 5062 are sufficient for nuclear transport. In addition, they did not examine the necessity of a region 5052, the first basic cluster of their proposed bipartite NLS. In this study, we have shown that N-terminal amino acids 168 tagged with GFP could not be accumulated into the nuclei. By constructing various truncations of the geminin proteins, we have localized the sequence responsible for the nuclear import of geminin to its N-terminal region of amino acids 5979, which contains two clusters of basic amino acids (6062 and 7174). Since synthetic peptide corresponding to this region supported the nuclear import of fluorescently labelled BSA, the identified sequence acts as an NLS of Xenopus geminin.
In contrast, human geminin contains only one cluster of basic amino acids, which is insufficient to target the protein to the nuclei. Indeed, nuclear transport of Xenopus geminin occurs independently of Cdt1 in the extracts, while the transport of human geminin is dependent upon the addition of recombinant Cdt1. Transport of NLS-deleted Xenopus geminin was slightly enhanced by the addition of recombinant Cdt1 to the extracts (Fig. S3), suggesting that Xenopus geminin could be transported into nuclei through its binding to Cdt1. However, the effect of Cdt1 on the import of intact Xenopus geminin was marginal, even when excess amounts of Cdt1 were added to the extracts (Fig. 5A and S3). These results suggest that nuclear import of Xenopus geminin plays a more important role than mammalian geminin in preventing re-replication.
|
Revisiting the licensing factor hypothesis
The original licensing factor hypothesis proposed that the nuclear envelope plays an essential role in the control of licensing by preventing the entry of a hypothetical licensing factor into the nuclei (Blow & Laskey 1988). Although the original report did not exclude the possibility of the existence of possible negative factors that were imported into nuclei, the existence of a negative factor alone could not explain how the resealed G2 nuclei, putatively deficient in putative negative factors, could not be re-replicated in extracts (Coverley et al. 1993). Failure of re-replication therefore suggests the existence of a positive factor that is unable to cross the nuclear envelope. However, in egg extracts, none of proteins required for the pre-RC formation is excluded from the nucleus. We previously reported that Mcm27 appears to be excluded from G2 nuclei, and that Xenopus Mcm3 has no NLS activity (Kubota et al. 1995, 1997). However, accumulating evidence indicates that the Mcm27 complex is imported into germinal vesicles of oocytes (Lemaitre et al. 2002; Whitmire et al. 2002) and isolated nuclei in the extracts upon prolonged incubation (Lu et al. 1999; Sun et al. 2000). Consistent with these observations, we have identified an NLS activity in the Xenopus Mcm2 protein (unpublished observation). Both Cdc6 and Cdt1 each apparently contain NLS sequences, and they have been shown to be present in the nuclei. In the present study, we found that the nuclear import of geminin is so efficient that nuclear Cdt1 is inactivated instantaneously upon its import. Thus, we propose that the role of the nuclear envelope in preventing re-replication is to accumulate geminin in nuclei. The failure of re-licensing in resealed G2 nuclei is due to the fact that geminin is rapidly imported into nuclei, thus inactivating Cdt1 after the resealing. The fact that geminin is found only in metazoans suggests that evolution of the geminin system makes the requirement for the CDK system redundant for preventing re-replication. The present study suggests that the import of geminin plays a central role in the control of licensing in Xenopus egg extracts. Finally, it should be noted that the central role of CDK controlling re-replication holds true in the egg extracts. CDK has been shown to inhibit the loading of Mcm27 on to chromatin through the phosphorylation of Mcm proteins (Hendrickson et al. 1996; Findeisen et al. 1999), and the present study suggests that CDK activity in the nuclei initiates the degradation of Cdt1. Most importantly, CDK controls the formation of the nuclear envelope, which is the key feature that prevents the re-replication by geminin in the egg extracts.
| Experimental procedures |
|---|
|
|
|---|
The ORF of Xenopus Cdt1 was amplified from Xenopus Oocyte cDNA by PCR using the 5'primer (CGGGATCCATGGCAGACATGTCGCAA) and the 3'primer (AAAACTCGAGCTAGAGAGACTCTTCTTCCT), and the products subcloned into the BamHI-XhoI site of pBluescript. The plasmid was then digested with BamHI and KpnI, and the fragment containing the ORF was subcloned into pQE-30. The resulting plasmid was digested with BamHI and SmaI, and the fragment containing the ORF was subcloned into pGEX6P-1 (Amersham Biosciences).
The GFP geminin fusion proteins were constructed on 6 x HisTag vector pQE30 (QIAGEN). The ORF of Xenopus geminin was amplified from Xenopus Oocyte cDNA by PCR using the 5'primer (CCGAATTCCCATGAATACCAACAAGAAGCAG) and the 3'primer (GGCTCGAGCCTAGACAGTATGTGCATCCATAT), and the product was subcloned into the EcoRI-XhoI site of pGEX4T-2. The ORF of GFP was digested from pGFP mut3.1(clontech) with KpnI and HindIII and subcloned into pQE-30. Full-length geminin (1220) was amplified by PCR using the 5'primer (GCGGATCCATGAATACCAACAAGAAGCAG) and the 3'primer (CCGGTACCACAGTATGTGCATCCATATTC). The amino-terminal fragments were amplified by PCR using the 5'primer (GCGGATCCATGAATACCAACAAGAAGCAG) and one of the following 3'primers: CCGGTACCGAATTTTTAACAGGCTCTTTGGTC for 158, CCGGTACCAGCTGATCATTCCACAGC for 168, CCGGTACCTCAACAGCCACTTCAAC for 179. The carboxyl-terminal fragments were amplified by PCR using one of the following 5'primers: GCGGATCCACAAAAAGAAAGCTGTGG for 59220, GCGGATCCTCAAAAAAGGCTAAAGTTGAA for 70220, GCGGATCCCCAGAACACAGGGAAAAC for 81220 and the 3'primer (CCGGTACCACAGTATGTGCATCCATATTC). These PCR products were digested by BamHI and KpnI and subcloned into pQE-30 containing the ORF of GFP at their C-termini.
The ORF of human geminin was amplified from HeLa cDNA by PCR using the 5'primer (GCGGATCCATCAATCCCAGTATGAAGCAGAAACAAG) and the 3'primer (CCGGTACCGCTATACATGGCTTTGCATCC), and subcloned into the BamHI-KpnI site of pQE-30 containing the ORF of GFP at its C-terminus.
All constructs were sequenced with an automatic DNA sequencer (Applied Biosystems 310).
The recombinant Cdt1 protein was expressed in Escherichia coli BL21, purified with glutathione beads, and eluted by the prescission protease following the instructions of the supplier (Amersham Biosciences) with elution buffer (50 mM HEPES-KOH, 150 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol, pH 7.5). The recombinant geminin-GFP proteins were expressed in Escherichia Coli TG1 and purified with a Ni-NTA column following the instructions of the supplier (QIAGEN). Prior to use of the geminin-GFP proteins, the buffer was replaced to EB (50 mM HEPES-KOH, 100 mM KCl, and 2.5 mM MgCl2, pH 7.5).
Preparation of Xenopus egg extracts
Interphase extract and demembranated sperm nuclei were prepared as described (Kubota & Takisawa 1993). In all experiments, cycloheximide was added to the egg extract at a concentration of 20 µg/mL to inhibit protein synthesis. Immunodepletions of Xenopus proteins were carried out as described (Mimura & Takisawa 1998) except that rProtein A sepharose Fast Flow (Amersham Biosciences) was used instead of Affi-Prep protein A matrix (Bio-Rad).
Polyclonal rabbit antisera were raised against the recombinant full-length Xenopus geminin-GFP protein or a peptide corresponding to a C-terminal 20 amino acid sequence of Xenopus Cdt1, and further affinity-purified with the recombinant proteins immobilized on AffiGel 10 (Bio-Rad).
Fluorescence microscopy and chromatin fraction
Samples for fluorescence microscopy were prepared as described (Mimura & Takisawa 1998) and fluorescence images were captured with the Open Laboratory imaging program (Improvision). The chromatin fraction was prepared as previously described (Hashimoto & Takisawa 2003) except that the concentration of sperm DNA was 1000 nuclei/1 µL extracts.
Assay for DNA replication activity
The replication activities of egg extracts were monitored by the incorporation of [
-32P] dCTP into sperm DNA according to the method of Mimura & Takisawa (1998), except that the autoradiography was quantified by Image Gauge software (FUJIFILM).
For the CsCl gradient centrifugation, sperm DNA (1000 nuclei/1 µL extracts) was incubated in the egg extract containing [
-32P]dCTP and 0.5 mM BrdUTP for 180 min at 23 °C. The reactions were stopped by the addition of 1 mL cold Buffer A (20 mM HEPES-KOH, 50 mM NaCl and 5 mM EDTA, pH 7.6) and incubated for 5 min on ice. Nuclei were collected by centrifugation at 10 000 g for 5 min and resuspended in TE buffer (50 mM Tris-HCl and 5 mM EDTA, pH 7.5) containing 0.5 mg/mL proteinaseK, 0.5% SDS and 10 µg/mL RNase, and then incubated for 2 h at 37 °C. DNA was recovered by phenol: chloroform extraction, chloroform extraction, and ethanol precipitation. The samples were loaded on to a solution of CsCl (final density of 1.74 g/mL in TE) and centrifuged for 18 h at 72 000 r.p.m. in a Beckman TLN-100 rotor. 100 µL fractions were collected, spotted on to filter paper (DE81, Whatman) and autoradiographed with BAS 2000 (FUJIFILM).
Conjugation of peptide to BSA
BSA was labelled with Alexa-488 using the Alexa Fluor Protein Labeling Kit (Molecular Probes). The Alexa-BSA 2 mg/mL was incubated in 50 mM aliquots of phosphate buffer (pH 6.0) containing 0.3 mg/mL of the cross-linker MBS (maleimidebenzoyl-N-hydroxysuccinimide ester) for 30 min at room temperature, and excess cross-linker was removed by gel filtration. A 10-fold molar excess of the peptide (CGGTKRKLWNDQLTSKKAKVEVA or CGGTKRKLWNDQL) was added to MBS-activated Alexa-BSA. The pH was then adjusted to 7.5 and the reaction was allowed to proceed for 3 h at room temperature.
| Supplemental material |
|---|
|
|
|---|
http://www.blackwellpublishing.com/products/journals/suppmat/GTC/GTC815/GTC815sm.htm
| Footnotes |
|---|
* Correspondence: E-mail: ykubota{at}bio.sci.osaka-u.ac.jp
| References |
|---|
|
|
|---|
Blow, J.J. & Laskey, R.A. (1988) A role for the nuclear envelope in controlling DNA replication within the cell cycle. Nature 332, 546548.[CrossRef][Medline]
Blow, J.J. & Hodgson, B. (2002) Replication licensingdefining the proliferative state? Trends Cell Biol. 12, 7278.[CrossRef][Medline]
Coverley, D., Downes, C.S., Romanowski, P. & Laskey, R.A. (1993) Reversible effects of nuclear membrane permeabilization on DNA replication: evidence for a positive licensing factor. J. Cell Biol.
122, 985992.
Dahmann, C., Diffley, J.F. & Nasmyth, K.A. (1995) S-phase-promoting cyclin-dependent kinases prevent re-replication by inhibiting the transition of replication origins to a pre-replicative state. Curr. Biol. 5, 12571269.[CrossRef][Medline]
Findeisen, M., El-Denary, M., Kapitza, T., Graf, R. & Strausfeld, U. (1999) Cyclin A-dependent kinase activity affects chromatin binding of ORC, Cdc6, and MCM in egg extracts of Xenopus laevis. Eur. J. Biochem. 264, 415426.[Medline]
Fujita, M., Yamada, C., Goto, H., et al. (1999) Cell cycle regulation of human CDC6 protein. Intracellular localization, interaction with the human mcm complex, and CDC2 kinase-mediated hyperphosphorylation. J. Biol. Chem.
274, 2592725932.
Gopalakrishnan, V., Simancek, P., Houchens, C., et al. (2001) Redundant control of rereplication in fission yeast. Proc. Natl. Acad. Sci. USA
98, 1311413119.
Hashimoto, Y. & Takisawa, H. (2003) Xenopus Cut5 is essential for a CDK-dependent process in the initiation of DNA replication. EMBO J. 22, 25262535.[CrossRef][Medline]
Hayles, J., Fisher, D., Woollard, A. & Nurse, P. (1994) Temporal order of S phase and mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin complex. Cell 78, 813822.[CrossRef][Medline]
Hendrickson, M., Madine, M., Dalton, S. & Gautier, J. (1996) Phosphorylation of MCM4 by cdc2 protein kinase inhibits the activity of the minichromosome maintenance complex. Proc. Natl. Acad. Sci. USA
93, 1222312228.
Hodgson, B., Li, A., Tada, S. & Blow, J.J. (2002) Geminin becomes activated as an inhibitor of Cdt1/RLF-B following nuclear import. Curr. Biol. 12, 678683.[CrossRef][Medline]
Kubota, Y., Mimura, S., Nishimoto, S., Takisawa, H. & Nojima, H. (1995) Identification of the yeast MCM3-related protein as a component of Xenopus DNA replication licensing factor. Cell 81, 601609.[CrossRef][Medline]
Kubota, Y. & Takisawa, H. (1993) Determination of initiation of DNA replication before and after nuclear formation in Xenopus egg cell free extracts. J. Cell Biol.
123, 13211331.
Kubota, Y., Mimura, S., Nishimoto, S., Masuda, T., Nojima, H. & Takisawa, H. (1997) Licensing of DNA replication by a multi-protein complex of MCM/P1 proteins in Xenopus eggs. EMBO J. 16, 33203331.[CrossRef][Medline]
Lemaitre, J.M., Bocquet, S. & Mechali, M. (2002) Competence to replicate in the unfertilized egg is conferred by Cdc6 during meiotic maturation. Nature 419, 718722.[CrossRef][Medline]
Liu, E., Li, X., Yan, F., Zhao, Q. & Wu, X. (2004) Cyclin-dependent kinases phosphorylate human Cdt1 and induce its degradation. J. Biol. Chem.
279, 1728317288.
Lu, Z.H., Xu, H. & Leno, G.H. (1999) DNA replication in quiescent cell nuclei: regulation by the nuclear envelope and chromatin structure. Mol. Biol. Cell
10, 40914106.
McGarry, T.J. & Kirschner, M.W. (1998) Geminin, an inhibitor of DNA replication, is degraded during mitosis. Cell 93, 10431053.[CrossRef][Medline]
Melixetian, M., Ballabeni, A., Masiero, L., et al. (2004) Loss of Geminin induces rereplication in the presence of functional p53. J. Cell Biol.
165, 473482.
Mihaylov, I.S., Kondo, T., Jones, L., et al. (2002) Control of DNA replication and chromosome ploidy by geminin and cyclin A. Mol. Cell. Biol.
22, 18681880.
Mimura, S. & Takisawa, H. (1998) Xenopus Cdc45-dependent loading of DNA polymerase alpha onto chromatin under the control of S-phase Cdk. EMBO J. 17, 56995707.[CrossRef][Medline]
Newport. J. (2004) A Role for Ran-GTP and Crml in Blocking Re-Replication. Cell 119, 145.[CrossRef][Medline]
Nguyen, V.Q., Co, C. & Li, J.J. (2001) Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms. Nature 411, 10681073.[CrossRef][Medline]
Nishitani, H. & Lygerou, Z. (2002) Control of DNA replication licensing in a cell cycle. Genes Cells 7, 523534.[Abstract]
Nishitani, H., Lygerou, Z., Nishimoto, T. & Nurse, P. (2000) The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404, 625628.[CrossRef][Medline]
Nishitani, H., Taraviras, S., Lygerou, Z. & Nishimoto, T. (2001) The human licensing factor for DNA replication Cdt1 accumulates in G1 and is destabilized after initiation of S-phase. J. Biol. Chem.
276, 4490544911.
Nishitani, H., Lygerou, Z. & Nishimoto, T. (2004) Proteolysis of DNA replication licensing factor Cdt1 in S-phase is performed independently of geminin through its N-terminal region. J. Biol. Chem.
279, 3080730816.
Sugimoto, N., Tatsumi, Y., Tsurumi, T., et al. (2004) Cdt1 phosphorylation by cyclin A-dependent kinases negatively regulates its function without affecting geminin binding. J. Biol. Chem.
279, 1969119697.
Sun, W., Hola, M., Pedley, K., et al. (2000) The replication capacity of intact mammalian nuclei in Xenopus egg extracts declines with quiescence, but the residual DNA synthesis is independent of Xenopus MCM proteins. J. Cell Sci. 113, 683695.[Abstract]
Tada, S., Li, A., Maiorano, D., Mechali, M. & Blow, J.J. (2001) Repression of origin assembly in metaphase depends on inhibition of RLF-B/Cdt1 by geminin. Nature Cell Biol. 3, 107113.[CrossRef][Medline]
Vaziri, C., Saxena, S., Jeon, Y., et al. (2003) A p53-dependent checkpoint pathway prevents rereplication. Mol. Cell 11, 9971008.[CrossRef][Medline]
Whitmire, E., Khan, B. & Coue, M. (2002) Cdc6 synthesis regulates replication competence in Xenopus oocytes. Nature 419, 722725.[CrossRef][Medline]
Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C. & Dutta, A. (2000) Inhibition of eukaryotic DNA replication by geminin binding to Cdt1. Science
290, 23092312.
Yanow, S.K., Lygerou, Z. & Nurse, P. (2001) Expression of Cdc18/Cdc6 and Cdt1 during G2 phase induces initiation of DNA replication. EMBO J. 20, 46484656.[CrossRef][Medline]
Zhong, W., Feng, H., Santiago, F.E. & Kipreos, E.T. (2003) CUL-4 ubiquitin ligase maintains genome stability by restraining DNA-replication licensing. Nature 423, 885889.[CrossRef][Medline]
Zhu, W., Chen, Y. & Dutta, A. (2004) Rereplication by depletion of geminin is seen regardless of p53 status and activates a G2/M checkpoint. Mol. Cell. Biol.
24, 71407150.
Received: 7 September 2004
Accepted: 22 October 2004
This article has been cited by other articles:
![]() |
K. Yoshida, N. Sugimoto, S. Iwahori, T. Yugawa, M. Narisawa-Saito, T. Kiyono, and M. Fujita CDC6 interaction with ATR regulates activation of a replication checkpoint in higher eukaryotic cells J. Cell Sci., January 15, 2010; 123(2): 225 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. De Marco, P. J. Gillespie, A. Li, N. Karantzelis, E. Christodoulou, R. Klompmaker, S. van Gerwen, A. Fish, M. V. Petoukhov, M. S. Iliou, et al. Quaternary structure of the human Cdt1-Geminin complex regulates DNA replication licensing PNAS, November 24, 2009; 106(47): 19807 - 19812. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Narasimhachar and M. Coue Geminin Stabilizes Cdt1 during Meiosis in Xenopus Oocytes J. Biol. Chem., October 2, 2009; 284(40): 27235 - 27242. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhu and M. L. DePamphilis Selective Killing of Cancer Cells by Suppression of Geminin Activity Cancer Res., June 1, 2009; 69(11): 4870 - 4877. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sugimoto, K. Yoshida, Y. Tatsumi, T. Yugawa, M. Narisawa-Saito, S. Waga, T. Kiyono, and M. Fujita Redundant and differential regulation of multiple licensing factors ensures prevention of re-replication in normal human cells J. Cell Sci., April 15, 2009; 122(8): 1184 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsuyama, S. Watanabe, A. Aoki, Y. Cho, M. Seki, T. Enomoto, and S. Tada Repression of Nascent Strand Elongation by Deregulated Cdt1 during DNA Replication in Xenopus Egg Extracts Mol. Biol. Cell, February 1, 2009; 20(3): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kim, N. G. Starostina, and E. T. Kipreos The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing Genes & Dev., September 15, 2008; 22(18): 2507 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Liu, A. Y.-L. Lee, T. Chiba, E. Olson, P. Sun, and X. Wu The ATR-mediated S phase checkpoint prevents rereplication in mammalian cells when licensing control is disrupted J. Cell Biol., November 19, 2007; 179(4): 643 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Luo, Y. Uerlings, N. Happel, N. S. Asli, H. Knoetgen, and M. Kessel Regulation of Geminin Functions by Cell Cycle-Dependent Nuclear-Cytoplasmic Shuttling Mol. Cell. Biol., July 1, 2007; 27(13): 4737 - 4744. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Arias and J. C. Walter Strength in numbers: preventing rereplication via multiple mechanisms in eukaryotic cells Genes & Dev., March 1, 2007; 21(5): 497 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tatsumi, N. Sugimoto, T. Yugawa, M. Narisawa-Saito, T. Kiyono, and M. Fujita Deregulation of Cdt1 induces chromosomal damage without rereplication and leads to chromosomal instability J. Cell Sci., August 1, 2006; 119(15): 3128 - 3140. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matsuno, M. Kumano, Y. Kubota, Y. Hashimoto, and H. Takisawa The N-Terminal Noncatalytic Region of Xenopus RecQ4 Is Required for Chromatin Binding of DNA Polymerase {alpha} in the Initiation of DNA Replication Mol. Cell. Biol., July 1, 2006; 26(13): 4843 - 4852. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Green, R. J. Morreale, B. Ozaydin, J. L. DeRisi, and J. J. Li Genome-wide Mapping of DNA Synthesis in Saccharomyces cerevisiae Reveals That Mechanisms Preventing Reinitiation of DNA Replication Are Not Redundant Mol. Biol. Cell, May 1, 2006; 17(5): 2401 - 2414. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iizuka, T. Matsui, H. Takisawa, and M. M. Smith Regulation of Replication Licensing by Acetyltransferase Hbo1 Mol. Cell. Biol., February 1, 2006; 26(3): 1098 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Yanagi, T. Mizuno, T. Tsuyama, S. Tada, Y. Iida, A. Sugimoto, T. Eki, T. Enomoto, and F. Hanaoka Caenorhabditis elegans Geminin Homologue Participates in Cell Cycle Regulation and Germ Line Development J. Biol. Chem., May 20, 2005; 280(20): 19689 - 19694. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |