GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2005) 10, 953-962. doi:10.1111/j.1365-2443.2005.00896.x
© 2005 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuda, H.
Right arrow Articles by Nakagama, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuda, H.
Right arrow Articles by Nakagama, H.

Unfolding of higher DNA structures formed by the d(CGG) triplet repeat by UP1 protein

Hirokazu Fukuda1, Masato Katahira2,3, Etsuko Tanaka1, Yoshiaki Enokizono2, Naoto Tsuchiya1, Kumiko Higuchi1, Minako Nagao1 and Hitoshi Nakagama1,*

1 Biochemistry Division, National Cancer Center Research Institute, 1-1, Tsukiji 5, Chuo-ku, Tokyo 104-0045, Japanv
2 Department of Environment and Natural Sciences, Graduate School of Environment and Information Sciences, Yokohama National University, 79-7 Tokiwadai, Hodogaya-ku, Yokohama 240-8501, Japan
3 Division of Molecular Biophysics, Science of Biological Supramolecular Systems, Yokohama City University, 1-7-29 Suehiro, Tsurumi-ku, Yokohama 230-0045, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Fragile X syndrome is caused by expansion of a d(CGG) triplet repeat in the 5'-untranslated region of the first exon of the FMR1 gene resulting in silencing of the gene. The d(CGG) repeat has been reported to form hairpin and quadruplex structures in vitro, and formation of these higher structures could be responsible for its unstable expansion in the syndrome, although molecular mechanisms underlying the repeat expansion still remain elusive. We have previously proved that UP1, a proteolytic product of hnRNP A1, unfolds the intramolecular quadruplex structures of d(GGCAG)5 and d(TTAGGG)4 and abrogates the arrest of DNA synthesis at d(GGG)n sites. Here, we demonstrate that the d(CGG) repeat forms a peculiar DNA structure, which deviates from the canonical B-form structure. In addition, UP1 was demonstrated by CD spectrum analysis to unfold this characteristic higher structure of the d(CGG) repeat and to abrogate the arrest of DNA synthesis at the site. This ability of UP1 suggests that unfolding of unusual DNA structures of a triplet repeat is required for DNA synthesis processes.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Fragile X syndrome is the most common form of inherited mental retardation in humans, and is caused by the silencing of the FMR1 gene (for reviews, see Rousseau et al. 1992; Mandel 1993; Crawford et al. 2001). Transcriptional silencing of the FMR1 gene results from expansion of a d(CGG) trinucleotide repeat in the 5'-untranslated region of the first exon of the gene and following hypermethylation in the repeat and promoter region. Allelic forms of the FMR1 gene are classified by the number of CGG repeats into three groups: normal alleles are less than 50, premutation alleles range between 50 and 200, and fully affected alleles carry 200–2000 repeats. The d(CGG)n tract was reported to form hairpin (Chen et al. 1995; Gacy et al. 1995; Nadel et al. 1995; Fojtík et al. 2004), quadruplex (Fry & Loeb 1994; Kettani et al. 1995; Usdin & Woodford 1995), and homoduplex (Fojtík et al. 2004) structures in vitro under physiologic-like conditions. These higher structures of d(CGG)n were reported to cause the arrest of DNA synthesis in the repeat both in vitro and in vivo (Kang et al. 1995; Usdin & Woodford 1995; Samadashwily et al. 1997; Kamath-Loeb et al. 2001).

It is supposed that there are some mechanisms that unfold these unusual higher structures of the triplet repeat. However, molecular details underlying stable maintenance of the repeat are largely unknown. Several proteins have been reported to unfold or destabilize the higher structures of d(CGG)n. WRN helicase unwinds these structures and abrogates the arrest of DNA synthesis at the site (Fry & Loeb 1999; Kamath-Loeb et al. 2001). Two quadruplex telomeric DNA binding proteins purified from rat liver, qTBP42 and uqTBP25, destabilize the quadruplex forms of the repeat (Weisman-Shomer et al. 2000). We previously identified UP1, a proteolytic product of hnRNP A1, as a d(GGCAG)n binding protein, and demonstrated UP1 to unfold the intramolecular quadruplex structure of d(GGCAG)5 and d(TTAGGG)4 (Fukuda et al. 2001, 2002). In the present report, we document that UP1 unfolds higher structures of d(CGG)n and abrogates the arrest of DNA synthesis at the repeat.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
CD spectra of d(CGG)n

According to previous reports, the d(CGG)n sequences form unusual DNA structures, hairpins, and quadruplexes under physiologic-like conditions (Fry & Loeb 1994; Chen et al. 1995; Gacy et al. 1995; Kettani et al. 1995; Nadel et al. 1995; Usdin & Woodford 1995; Fojtík et al. 2004). Whether the structure of the d(CGG) repeats could form either hairpins or quadruplexes seems to depend on the experimental conditions, including repeat sizes and coexistence of metal ions. We carried out CD spectrum analysis of the oligonucleotides CGG7 and CGG16 (see Experimental procedures) in the presence or absence of 150 mM KCl at 25 °C.

The CD spectrum of CGG7 showed a positive peak at 280 nm and a negative peak at 255 nm with comparable intensity in the absence of KCl, and this CD spectrum is characteristic of the canonical B-form structure (Fig. 1A). In the presence of 150 mM KCl, the CD spectrum of CGG7 showed a decrease of the positive peak at 280 nm and an increase of the negative peak at 255 nm (Fig. 1B). The pattern differed from the typical CD spectrum of the B-form structure, and suggested a structural conversion of the oligonucleotide from a B to a non-B structure. The CD spectrum of CGG7 at 150 mM KCl was obviously different from those of the quadruplexes with guanine quartets, the parallel stranded quadruplex (positive maxima at 260 and 210 nm), and the antiparallel stranded quadruplex (positive maxima at 295 and 210 nm, or at 295, 260, and 210 nm) (Dapic et al. 2003).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 1  CD spectra of d(CGG) repeats. CD spectra of CGG7 (A, B), CGG16 (C, D), and CGG16mut (E, F) in the absence of KCl (A, C, E) and presence of 150 mM KCl (B, D, F). The concentrations of each oligonucleotide are 5.64 µM (A, C, E), 9.94 µM (B, D, F).

 
The CD spectrum of the oligonucleotide CGG16 in either the presence or absence of 150 mM KCl showed a characteristic pattern similar to that of CGG7 under 150 mM KCl conditions, in the sense that the negative peak at 255 nm is large while the positive peak at 280 nm is small (Fig. 1C,D). This suggests that the oligonucleotide CGG16 can mainly form a non-B structure regardless of the presence of K+ ions. The CD spectrum of oligonucleotide CGG16mut, having C to A substitutions at two sites in CGG16 (see Experimental procedures), represented a typical pattern of the B structure with comparable negative and positive peaks at 255 nm and 280 nm, respectively, both in the presence and absence of 150 mM KCl (Fig. 1E,F), indicating that destruction of the continuation of d(CGG) repeats caused by C to A mutation strongly inhibits the formation of the non-B structure.

Effects of UP1 protein on DNA structures of d(CGG) repeats

Because UP1 was previously demonstrated to unfold the intramolecular quadruplex structure of d(GGCAG)5 and d(TTAGGG)4 (Fukuda et al. 2002; Myers et al. 2003), we investigated the effect of UP1 on secondary structures of the oligonucleotides, CGG7, CGG16, and CGG16mut, by CD analysis. In the presence of 150 mM KCl, in either CGG7 or CGG16, no drastic change in CD bands was observed on addition of GST-UP1 protein (Fig. 2B,D), the positive peak at 280 nm still being rather small. This indicates that UP1 does not have a sufficient effect on the non-B form of d(CGG) repeats under 150 mM KCl conditions. In the absence of KCl, the positive peak of CGG16 at 280 nm was increased by addition of GST-UP1 in a concentration-dependent manner (Fig. 2C), suggesting that UP1 partially unfolded the non-B structure of CGG16 without KCl.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 2  CD spectra showing effects of UP1 on secondary structures of d(CGG) repeat. (A) CGG7 titrated with GST-UP1 in the absence of KCl (A) and in the presence of 150 mM KCl (B). CGG16 with GST-UP1 at 0 mM KCl (C) and at 150 mM KCl (D). CGG16mut with GST-UP1 at 0 mM KCl (E) and at 150 mM KCl (F). From each spectrum, the spectrum of the corresponding protein is subtracted. Arrows indicate the changes of positive or negative peaks of CD spectra as the concentration of the added GST-UP1 increased.

 
The oligonucleotide CGG7 forms a slowly migrating electrophoretic species after incubating with 300 mM KCl at 4 °C overnight and subsequent diluting by 30-fold to a concentration of 10 mM KCl (Fig. 3 lane 2). The slowly migrating band disappeared by denaturing at 95 °C for 2 min (Fig. 3 lane 1). The addition of UP1 converts this slowly migrating band to the fast migrating band for the single-stranded monomolecular form (Fig. 3 lane 3). This data indicates that UP1 can dissolve a non-B structure of d(CGG)7 repeats with slow mobility. Increase of the positive CD peak of CGG7 at 280 nm by addition of GST-UP1 (Fig. 2A) may indicate the conversion of this non-B structure with slow mobility into a B-form structure.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 3  An electrophoretic mobility shift assay of CGG7 and UP1. A gel shows the formation of a bimolecular secondary structure from oligonucleotide CGG7 and the unwinding of the structure by UP1. Concentration of CGG7 was 20 nM and 10 nM, respectively. Concentrations of GST-UP1 were 0 µM (lanes 1, 2), and 3.7 µM (lanes 3, 4). Lane 1 was a heat-denatured control at 95 °C for 3 min just before electrophoresis. The sample mixtures were treated with proteinase K before electrophoresis, except for those in lane 4.

 
Abrogation of DNA synthesis arrest by UP1 on a single-stranded template containing d(CGG)16

Several reports stressed that the d(CGG)n repeats on the template block DNA synthesis both in vivo and in vitro (Kang et al. 1995; Usdin & Woodford 1995; Samadashwily et al. 1997; Kamath-Loeb et al. 2001). Because UP1 was proved to abrogate DNA synthesis arrests on d(TTAGGG)n and d(GGCAG)n templates (Fukuda et al. 2002), the effect of UP1 on DNA synthesis at d(CGG)nin vitro was examined. A synthetic 92-mer oligonucleotide pSubCGG16 containing a d(CGG)16 repeat was used as a template for the primer extension reaction at 15 mM KCl (Fig. 4A). DNA synthesis was obstructed within the d(CGG) repeats (Fig. 4B lane 1). As we expected, addition of a 75-fold molar excess of GST-UP1 over the template reduced the arrest of DNA synthesis in vitro and enhanced the full length (92 nt) DNA synthesis (Fig. 4B lane 3). On the other hand, addition of GST did not have an obvious effect on the arrest of DNA synthesis, although GST subtly enhanced DNA polymerase progression itself at high concentrations (~400 µM) (data not shown). This may reflect an effect of the GST protein to stabilize DNA polymerase. Experiments using a human DNA polymerase {alpha} (pol {alpha}) gave similar results, although pol {alpha} paused more preferentially at much closer sites to the 3' end of the primer than bacterial DNA polymerases (Fig. 4C). Addition of GST-UP1 reduced the arrest of DNA synthesis (Fig. 4C lane 3) and the same amount of GST had no effect on the arrest of DNA synthesis (Fig. 4C lane 2).



View larger version (45K):
[in this window]
[in a new window]
  		Figure 4  Effect of UP1 on the arrest of DNA synthesis at d(CGG) repeats. (A) Schematic representation of oligonucleotides used for the primer extension is depicted. The synthetic oligonucleotides, pM13-20 of 24 mer and pSubCG16 of 92 mer carrying d(CGG)16, were used as primer and template, respectively. The zigzag line indicates d(CGG)16 repeat on pSubCGG16. (B) Results of the primer extension reaction of BcaBEST DNA polymerase with or without GST-UP1, using the pSubCGG16 (final 10 nM) as a template. The concentrations of GST-UP1 were 0 M (lane 1), 125 nM (lane 2), and 750 nM (lane 3), respectively. The sizes of the fragments are indicated in nucleotides (nt) under the panel. (C) Results of the primer extension reaction of DNA polymerase {alpha} using the pSubCGG16 as a template without other proteins (lane 1), with GST (lane 2), and with GST-UP1 (lane 3). The concentrations of both GST and GST-UP1 were 3 µM. Grey portions in the bands of 34 and 35 nt show the areas over-exposed, in other words, beyond linearity. (D) CD spectra of CGG16 titrated with GST-UP1 in the presence of 15 mM KCl. From each spectrum, the spectrum of the corresponding protein is subtracted. Arrows indicate the changes of positive peaks of CD spectra as the concentration of the added GST-UP1 increased.

 
Next, we examined the effect of UP1 on the CD spectrum of CGG16 under conditions similar to that for the primer extension reaction. The primer-annealed template was first incubated in the presence of 150 mM KCl at 37 °C for 3 h and diluted ten-fold with the reaction mixture (final 15 mM KCl). After the same treatment as described previously, the CD pattern of oligonucleotide CGG16 in the presence of 15 mM KCl was similar to that observed in the presence of 150 mM KCl, namely a weak positive CD band at 280 nm and a strong negative CD band at 255 nm (Fig. 4D). The positive peak at 280 nm was increased by the addition of GST-UP1 dose-dependently (Fig. 4D), suggesting that UP-1 unfolded the non-B structure of the CGG16 to a certain extent under the same potassium ion concentration used in the primer extension reaction.

Kinetic analysis of the interaction between UP1 and d(CGG) repeats

Because stable binding of UP1 to the oligonucleotides CGG7 and CGG16 was hardly detected by electrophoretic mobility shift assay (see Fig. 3 lane 4), we performed kinetic analysis of the interaction between UP1 and d(CGG) repeats using a surface plasmon resonance (SPR) biosensor, BIACORE system. By monitoring the real-time interaction between GST-UP1 and d(CGG)10 repeats with the BIACORE system, the association of UP1 with d(CGG)10 was revealed to be rather fast, although the dissociation was still faster (Table 1). Although the affinity of GST-UP1 to d(CGG)10 was 80-fold lower than that to d(GGCAG)8, it is nevertheless rather high (see KD values in Table 1). The affinity at 15 mM NaCl rose 40-fold compared with that at 150 mM NaCl. The KD values of GST to d(CGG)10 were more than 1000-fold higher than that of GST-UP1 (data not shown), and the affinity of GST-UP1 to d(CGG)10 can be therefore equally estimated as that of UP1 without the GST-tag.


View this table:
[in this window]
[in a new window]
  		Table 1 Kinetic parameters for interactions between GST-UP1 and d(CGG)10
 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
The expansion of the d(CGG) repeat in the FMR1 gene leading to the onset of Fragile X syndrome could be caused by formation of unusual DNA structures within the repeat during DNA replication. There are many reports analyzing the secondary higher structure of the repeat in vitro using various methods including CD, NMR, electron microscopy, and DMS-methylation analysis. The conclusions of previous reports on d(CGG) structure were mainly categorized into two forms, quadruplex and hairpin. Fry and Loeb (1994) reported CGG7 to form a bimolecular tetraplex from their DMS methylation protection experiment (Fry & Loeb 1994). On the other hand, Fojtík et al. (2004) considered CGG7 to form a bimolecular homoduplex and CGG16 a hairpin structure judged from CD spectra and their electrophoretic mobility on PAGE. The CD spectra reported by Fojtík et al. (2004) demonstrated a strong negative peak at 260 nm and a weak positive peak at 290 nm, being similar to ours and different from either a typical B structure or quadruplex. Interpretations that Fojtík et al. (2004) gave are as follows: CD spectra that they obtained represented a homoduplex and hairpin, and the difference from a typical B-structure could be derived from the winding of the DNA double helix because of high ionic strength. At present, we conclude the secondary structure of CGG16 is not a simple hairpin or quadruplex but some other non-B structure under physiologic-like conditions. However, it is reasonable to consider that the CD spectra we obtained in the present study for CGG16 indicate a formation of a hairpin having a non-B structured duplex.

Previously, CGG7 was reported to form a bimolecular quadruplex as described previously (Fry & Loeb 1994). However, it is demonstrated in the present study to form a non-B structure, being different from the quadruplex (Fig. 1B). d(CGG)8 was also reported to form a bimolecular homoduplex (Fojtík et al. 2004). In any case, the d(CGG) repeat can form some bimolecular secondary structure when its repetitive number (n) is relatively small, being seven or eight. In contrast, the triplet repeat of CGG with 16 repetitive units, or even more, is able to form some unimolecular unusual higher structure, probably a hairpin having a stem deviating from a B-formed duplex. The formation of these peculiar DNA secondary structures could cause the arrest of DNA synthesis at the site leading to expansion of the repeat.

Some proteins of the RecQ helicase family, such as BLM helicase and WRN helicase, unwind quadruplex DNA (Sun et al. 1998, 1999; Fry & Loeb 1999; Mohaghegh et al. 2001). Especially, WRN helicase can unwind bimolecular quadruplexes of the d(CGG) repeat (Fry & Loeb 1999). In addition, several members of the hnRNP family were demonstrated to destabilize quadruplexes, and three of them, CBF-A, uqTBP25, and hnRNP A2, were reported to destabilize a bimolecular quadruplex of CGG7 (Weisman-Shomer et al. 2000; Khateb et al. 2004). We demonstrated previously that hnRNP A1/UP1 unfolds a unimolecular quadruplex of d(TTAGGG)4 and d(GGCAG)5. Similar results were also reported by Myers et al. (2003). In this study, we extended our research and revealed that UP1 unfolds the non-B structure of d(CGG)n and abrogates DNA synthesis arrests on d(CGG)n templates. UP1 was originally isolated from calf thymus as a single-stranded DNA-binding protein (Herrick & Alberts 1976), and later demonstrated to be a proteolytic product corresponding to the N-terminal 195 amino acids of 34 kDa hnRNP A1 containing the two RNA binding domains (Merrill et al. 1986). hnRNP A1 is a pre-mRNA binding protein and is suspected to be involved in pre-mRNA transport, protection, and splicing (Dreyfuss et al. 1993), as well as telomere maintenance (LaBranche et al. 1998). Although UP1 bound to single-stranded d(TTAGGG)n and d(CAGGG)n with a high affinity (Fukuda et al. 2002), only a small amount of stable complex between UP1 and the d(CGG) repeat could be detected by electrophoretic mobility shift assay (data not shown). In accordance with this observation, the real-time monitoring of interaction between UP1 and a d(CGG)10 repeat by an SPR biosensor suggests that the association of UP1 to d(CGG)10 is very quick and the dissociation of UP1 from the repeats is immediate after unfolding the unusual secondary structure of the repeat. The affinity of UP1 to d(CGG)10 was on a similar level as that to pRandom40, a random 40-mer oligonucleotide (Table 1), while those to d(TTAGGG)8 and d(GGCAG)8 were higher (Fukuda et al. 2001, 2002; Table 1). In addition to our results, UP1 was previously reported to bind to single-stranded DNA with no significant base specificity (Nadler et al. 1991) and, on the other hand, to bind to single-stranded d(TTAGGG)n with a high affinity in other reports (LaBranche et al. 1998). Structural studies indicated that conserved RNP motifs of UP1 play a key role in specific interaction with AG dinucleotides of the d(TTAGGG) repeat (Ding et al. 1999; Myers et al. 2003). Taking these data together, it is plausible that UP1 binds to single-stranded DNA with two different binding modes, and UP1 interacts with d(CGG) repeats in a low sequence-specific mode, different from a high-affinity mode in the cases of d(TTAGGG) and d(GGCAG) repeats. In the case of Escherichia coli single-stranded DNA binding protein (SSB), detailed kinetic studies have been carried out and have identified multiple DNA-binding modes and cooperation for the interaction of SSB with single-stranded (ss) DNA (Bujalowski & Lohman 1986; Kozlov & Lohman 2002; for review, see Lohman & Ferrari 1994). Although further detailed studies are necessary to clarify how UP1 recognizes d(CGG) and d(TTAGGG) repeats, it is possible that UP1 interacts with ssDNA in two different modes through different RNP motifs. As for the effect of UP1 on the non-B form of CGG16, UP1 does not have a prominent effect under a concentration of 150 mM KCl, but unfolds the secondary structure under a concentration of 0–15 mM KCl (Figs 2C and 4C). This data suggests that the non-B structure of the CGG16 under low concentrations of potassium ions may be unstable, and UP1 converts this unstable non-B structure into the B structure. Abrogation of the arrest of DNA synthesis on the d(CGG)n template by UP1 was also observed under a low concentration of KCl (15 mM), supporting the conversion of the non-B secondary structure of d(CGG) repeats into a single-stranded form by UP1. One of the possible explanations is that hnRNP A1/UP1 unfolds the secondary structure in vivo by cooperating with other proteins, such as WRN helicase. In fact, it was recently reported that hnRNP A1 has the domains of both positive and negative mediators for destabilization of a bimolecular quadruplex of d(CGG)n, and a mutant hnRNP A1 deleted RNP21, the negative mediator domain, displays robust destabilization activity for a bimolecular quadruplex of CGG7 (Khateb et al. 2004). An intriguing scenario is that binding of some unknown proteins or smaller molecules to hnRNP A1/UP1 may thereby inhibit the function of negative mediators and enhance the destabilization activity of hnRNP A1/UP1 itself to unfold the secondary structure of d(CGG)n, even in the presence of 150 mM KCl.

Our finding that UP1 has the activity to unfold the secondary structure of the d(CGG) repeat in vitro and to abrogate the pausings of DNA polymerase progression at the repeat suggests that UP1 may prevent the onset of Fragile X syndrome and other diseases implicated in the alteration of CGG or GCG repeats by inhibiting the expansion of this repeat in vivo through this activity. Further studies on mutation and expression of hnRNP A1/UP1 in Fragile X syndrome patients are indispensable to prove if this hypothesis is true.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Oligonucleotides

All synthetic oligonucleotides were purified by electrophoresis (Grainer Japan Co.). The names and nucleotide sequences of oligonucleotides are as follows: CGG7, d(CGG)7CGTGGACTC; CGG16, d(CGG)16; CGG16mut, d(CGG)5(AGG)(CGG)4(AGG)(CGG)5. SubCGG16: dCGACTCTAGA(CGG)16TGACTCTAGTACTGGCCGTCGTTTTACAACGTCG and its 3'-complementary 24 mer sequence pM13-20 were used for primer extension experiments.

Expression and purification of recombinant UP1

UP1 was expressed in E. coli XL1-Blue as a GST-fusion protein and purified as previously described (Fukuda et al. 2002). All purification steps were monitored by electrophoretic mobility-shift assay and SDS-polyacrylamide gel electrophoresis.

CD analysis

For CD measurement, lyophilized DNA, CGG7, and CGG16, were dissolved in 20 mM sodium phosphate buffer (pH 7.0) containing 150 mM KCl. The strand concentration was 10 µM. Each sample was heated at 90 °C for 5 min, followed by gradual cooling to room temperature, and stored at 4 °C until use. Either GST-UP1 or GST, dissolved in 20 mM sodium phosphate buffer (pH 7.0) containing 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 1 mM benzamidine, and 0.2% acetone, was added step by step to each DNA sample with DNA to protein ratios of 1 : 0.5, 1 : 1, and 1 : 2. CD spectra of the DNA and DNA-protein complexes were recorded with a Jasco J-720 spectropolarimeter and a 1 mm cell. CD spectra of GST-UP1 and GST were also recorded. From the CD spectrum obtained for the DNA-protein complex, the spectrum for the corresponding protein was subtracted.

Protein-DNA interaction analysis by SPR-based biosensor

Binding experiments were performed by monitoring the association and dissociation reactions in real time using an SPR biosensor, BIACORE3000 system. GST-UP1 was diluted to various concentrations with HBS-EP buffer [10 mM HEPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, 0.005% Tween 20 (pH 7.4)] or the HBS-EP buffer containing 15 mM NaCl, and injected in the oligonucleotide-immobilized sensor chip at a constant flow rate of 20 µL/min. The kinetic parameters of the interactions were calculated by non-linear curve fitting analysis of the association and dissociation curves using BIA evaluation version 3.0 software (Biacore).

In vitro DNA synthesis assay

A primer extension reaction was performed as previously described (Fukuda et al. 2002) with some modifications. A mixture of the pSubCGG16 and the pM13-20 primer, which was labeled with 32P at the 5' end (final 100 nM each), in TE buffer containing 150 mM KCl was heated at 95 °C for 5 min and then at 72 °C for 5 min, followed by gradual cooling, and incubated at 37 °C for 3 h. An aliquot of 0.75 µL of this primer-annealed template was mixed with 0.75 µL of 10x BcaBEST buffer [200 mM Tris-HCl (pH 8.5), 100 mM MgCl2] and 0.5 µL of dNTPs mixture (50 µM each). After adding 1 µL of the GST-UP1 suspended in buffer P [20 mM sodium phosphate (pH 7.0), 0.5 mM DTT], the mixture was incubated at 37 °C for 5 min, and then the primer extension reaction was carried out at 37 °C for 8 min in the presence of BcaBEST DNA polymerase (final 66 U/mL, Takara Biomedicals). The concentrations of BcaBEST DNA polymerase, the primer-annealed template, and dNTPs were 18 U/mL, 10 nM, and 1.7 µM, respectively. The reaction was terminated by adding 1.5 µL of stop solution (160 mM EDTA, 0.7% SDS, 6 mg/mL proteinase K), and then the samples were incubated at 37 °C for 30 min. A primer extension reaction using DNA polymerase {alpha} was performed as described previously with some modifications. Human DNA polymerase {alpha} (Chimerx) 0.2 units were used per reaction. The reaction solution was as follows; 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 2 mM DTT, 250 µg/mL BSA, dNTPs mixture (10 µM each). The reaction time for primer extension was 20 min.


   Acknowledgements
 
This work was supported by a Grant-in-Aid for Cancer Research from the Ministry of Health, Labor and Welfare of Japan, and Grants-in-Aid for Scientific Research (Nos.15030214 and 16048209 for M.K., No.15570131 for H.F.) and the Protein 3000 Project (for M.K.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. H.F. was supported by a Research Grant of the Princess Takamatsu Cancer Research Fund, and the Senri Life Science Foundation. We thank Professor S. Uesugi (Yokohama Natl. University) and Dr T. Sugimura (National Cancer Center Research Institute) for helpful discussions.


   Footnotes
 
Communicated by: Fuyuki Ishikawa

* Correspondence: E-mail: hnakagam{at}gan2.res.ncc.go.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bujalowski, W. & Lohman, T.M. (1986) Escherichia coli single-strand binding protein forms multiple, distinct complexes with single-stranded DNA. Biochemistry 25, 7799–7802.[CrossRef][Medline]

Chen, X., Mariappan, S.V., Catasti, P., et al. (1995) Hairpins are formed by the single DNA strands of the fragile X triplet repeats: structure and biological implications. Proc. Natl. Acad. Sci. USA 92, 5199–5203.[Abstract/Free Full Text]

Crawford, D.C., Acuna, J.M. & Sherman, S.L. (2001) FMR1 and the fragile X syndrome: human genome epidemiology review. Genet. Med. 3, 359–371.[Medline]

Dapic, V., Abdomerovic, V., Marrington, R., et al. (2003) Biophysical and biological properties of quadruplex oligodeoxyribonucleotides. Nucleic Acids Res. 31, 2097–2107.[Abstract/Free Full Text]

Ding, J., Hayashi, M.K., Zhang, Y., et al. (1999) Crystal structure of the two-RRM domain of hnRNP A1 (UP1) complexed with single-stranded telomeric DNA. Genes Dev. 13, 1102–1115.[Abstract/Free Full Text]

Dreyfuss, G., Matunis, M.J., Pionl-Roma, S. & Burd, C.G. (1993) hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 269, 289–321.[CrossRef]

Fojtík, P., Kejnovská, I. & Vorlicková, M. (2004) The guanine-rich fragile X chromosome repeats are reluctant to form tetraplexes. Nucleic Acids Res. 32, 298–306.[Abstract/Free Full Text]

Fry, M. & Loeb, L.A. (1994) The fragile X syndrome d(CGG)n nucleotide repeats form a stable tetrahelical structure. Proc. Natl. Acad. Sci. USA 91, 4950–4954.[Abstract/Free Full Text]

Fry, M. & Loeb, L.A. (1999) Human Werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. J. Biol. Chem. 274, 12797–12802.[Abstract/Free Full Text]

Fukuda, H., Sugimura, T., Nagao, M. & Nakagama, H. (2001) Detection and isolation of minisatellite Pc-1 binding proteins. Biochim. Biophys. Acta 1528, 152–158.[Medline]

Fukuda, H., Katahira, M., Tsuchiya, N., et al. (2002) Unfolding of quadruplex structure in the G-rich strand of the minisatellite repeat by the binding protein UP1. Proc. Natl. Acad. Sci. USA 99, 12685–12690.[Abstract/Free Full Text]

Gacy, A.M., Goellner, G., Juranic, N., et al. (1995) Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell 81, 533–540.[CrossRef][Medline]

Herrick, G. & Alberts, B. (1976) Purification and physical characterization of nucleic acid helix-unwinding proteins from calf thymus. J. Biol. Chem. 251, 2124–2132.[Abstract/Free Full Text]

Kamath-Loeb, A.S., Loeb, L.A., Johansson, E., et al. (2001) Interactions between the Werner syndrome helicase and DNA polymerase delta specifically facilitate copying of tetraplex and hairpin structures of the d(CGG)n trinucleotide repeat sequence. J. Biol. Chem. 276, 16439–16446.[Abstract/Free Full Text]

Kang, S., Ohshima, K., Shimizu, M., et al. (1995) Pausing of DNA synthesis in vitro at specific loci in CTG and CGG triplet repeats from human hereditary disease genes. J. Biol. Chem. 270, 27014–27021.[Abstract/Free Full Text]

Kettani, A., Kumar, R.A. & Patel, D.J. (1995) Solution structure of a DNA quadruplex containing the fragile X syndrome triplet repeat. J. Mol. Biol. 254, 638–656.[CrossRef][Medline]

Khateb, S., Weisman-Shomer, P., Hershco, I., et al. (2004) Destabilization of tetraplex structures of the fragile X repeat sequence (CGG)n is mediated by homolog-conserved domains in three members of the hnRNP family. Nucleic Acids Res. 32, 4145–4154.[Abstract/Free Full Text]

Kozlov, A.G. & Lohman, T.M. (2002) Kinetic mechanism of direct transfer Escherichia coli SSB tetramer between single-stranded DNA molecules. Biochemistry 41, 11611–11627.[CrossRef][Medline]

LaBranche, H., Dupuis, S., Ben-David, Y., et al. (1998) Telomere elongation by hnRNP A1 and a derivative that interacts with telomeric repeats and telomerase. Nature Genet. 19, 199–202.[CrossRef][Medline]

Lohman, T.M. & Ferrari, M.E. (1994) Escherichia coli single-stranded DNA-binding protein: multiple DNA-binding modes and cooperativities. Annu. Rev. Biochem. 63, 527–570.[Medline]

Mandel, J.L. (1993) Questions of expansion. Nature Genet. 4, 8–9.[CrossRef][Medline]

Merrill, B.M., LoPresti, M.B., Stone, K.L. & Williams, K.R. (1986) High pressure liquid chromatography purification of UP1 and UP2, two related single-stranded nucleic acid-binding protein from calf thymus. J. Biol. Chem. 261, 878–883.

Mohaghegh, P., Karow, J.K., Brosh Jr., R.M., et al. (2001) The Bloom's and Werner's syndrome proteins are DNA structure-specific helicases. Nucleic Acids Res. 29, 2843–2849.[Abstract/Free Full Text]

Myers, J.C., Moore, S.A. & Shamoo, Y. (2003) Structure-based incorporation of 6-methyl-8-(2-deoxy-ß-ribofuranosyl) isoxanthopteridine into the human telomeric repeat DNA as a probe for UP1 binding and destabilization of G-tetrad structures. J. Biol. Chem. 278, 42300–42306.[Abstract/Free Full Text]

Nadel, Y., Weisman-Shomer, P. & Fry, M. (1995) The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures. J. Biol. Chem. 270, 28970–28977.[Abstract/Free Full Text]

Nadler, S.G., Merrill, B.M., Roberts, W.J., et al. (1991) Interactions of the A1 heterogeneous nuclear ribonucleoprotein and its proteolytic derivative, UP1, with RNA and DNA: evidence for multiple RNA binding domains and salt-dependent binding mode transitions. Biochemistry 30, 2968–2976.[CrossRef][Medline]

Rousseau, F., Heitz, D. & Mandel, J.L. (1992) The unstable and methylatable mutations causing the fragile X syndrome. Hum. Mutat. 1, 91–96.[CrossRef][Medline]

Samadashwily, G.M., Raca, G. & Mirkin, S.M. (1997) Trinucleotide repeats affect DNA replication in vivo. Nature Genet. 17, 298–304.[Medline]

Sun, H., Karow, J.K., Hickson, I.D. & Maizels, N. (1998) The Bloom's syndrome helicase unwinds G4 DNA. J. Biol. Chem. 273, 27587–27592.[Abstract/Free Full Text]

Sun, H., Bennett, R.J. & Maizels, N. (1999) The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. Nucleic Acids Res. 27, 1978–1984.[Abstract/Free Full Text]

Usdin, K. & Woodford, K.J. (1995) CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro. Nucleic Acids Res. 23, 4202–4209.[Abstract/Free Full Text]

Weisman-Shomer, P., Naot, Y. & Fry, M. (2000) Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins. J. Biol. Chem. 275, 2231–2238.[Abstract/Free Full Text]

Received: 21 April 2005
Accepted: 10 July 2005




This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
S. Khateb, P. Weisman-Shomer, I. Hershco-Shani, A. L. Ludwig, and M. Fry
The tetraplex (CGG)n destabilizing proteins hnRNP A2 and CBF-A enhance the in vivo translation of fragile X premutation mRNA
Nucleic Acids Res., September 27, 2007; 35(17): 5775 - 5788.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuda, H.
Right arrow Articles by Nakagama, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuda, H.
Right arrow Articles by Nakagama, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS