| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B-mediated serum amyloid A gene expression
1 Molecular Medicine, Osaka University Graduate School of Medicine and 2 Department of Medical Science I, School of Health and Sport Sciences, Osaka University, 2-1 Yamada-Oka, Suita, Osaka 565-0871, Japan
3 Department of Cell Fate Modulation, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Kumamoto 860-0811, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
B (NF-B) p65 first form a complex following interleukin (IL)-1 and IL-6 (IL-1+6) stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the SAA gene promoter's NF-B RE. Moreover, co-expression of p300 with STAT3 dramatically enhances the transcriptional activity of SAA. The formation of a complex with STAT3, NF-B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation. Our findings are expected to aid the understanding of the inflammatory status of AA amyloidosis to aid development of a therapeutic strategy for this disease by means of normalization of serum SAA levels. |
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Since various pro-inflammatory cytokines, e.g., IL-1, tumor necrosis factor 
(TNF), and IL-6, are produced in RA patients (Feldmann et al. 1996), anticytokine therapy has been used for their treatment (Maini & Taylor 2000). We observed that IL-6 blocking therapy normalized serum SAA levels in a majority of RA patients although IL-1 and TNF remained enhanced (Nishimoto et al. 2004). It has been reported that the induction of the SAA2 gene is regulated by nuclear factor B (NF-B) and CAAT enhancer-binding protein ß (C/EBPß) in response to stimulation by IL-1 together with IL-6 (IL-1+6) (Betts et al. 1993). However, this induction model does not fully explain our clinical results. We therefore examined our clinical results by using an SAA isoform real-time quantitative RT-PCR assay system for three hepatic cell lines. Only blocking of IL-6, but not of IL-1 or TNF, completely inhibited the synergistic induction of SAA1 and SAA2 mRNA during triple stimulation with IL-6, IL-1, and TNF, whereas JAK2 inhibitor-AG490, but not MEK1/2 inhibitor-U0126, reduced SAA1 gene expression in response to IL-1+6 stimulation (Hagihara et al. 2003). Our results are consistent with the findings for signal transducers and activators of transcription 3 (STAT3) in the liver of conditional mutant mice, thus suggesting that STAT3 plays an essential role in cytokine-driven SAA expression because SAA1 and SAA2 expression becomes nearly defective after IL-6 or LPS stimulation in spite of the normal expression of C/EBPß (Alonzi et al. 2001).
STAT3, which activates various cytokine-driven inflammatory genes, was cloned as a transcription factor that interacts with the acute-phase response element (APRE; -CCTTCCCGGAATTC) when IL-6 induces the acute-phase response in the liver during inflammation (Akira et al. 1994). STAT3 has been observed to specifically bind to a 
-interferon activation sequence (GAS)-like sequence (- TTNNNGAA) (Seidel et al. 1995). For instance, the C-reactive protein (CRP) gene, which is a major acute-phase protein active in the response to IL-6, has a STAT3 response element (RE) (-TTCCCGAA) in its promoter (Zhang et al. 1996a). It should be noted, however, that no typical STAT3 RE seems to be present in the promoter region of SAA1 and SAA2 genes. To understand the effect of SAA on the pathogenesis of inflammatory diseases, such as coronary artery disease (Johnson et al. 2004) and AA amyloidosis (Gillmore et al. 2001), the exact involvement of STAT3 in the transcriptional mechanism of SAA must be clarified.
In this study, we provide evidence of a novel cis-acting mechanism of STAT3. We demonstrate that STAT3 forms a complex with NF-B p65, but not with NF-B p50 following IL-1+6 stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the SAA gene promoter's NF-B RE. Moreover, co-expression of p300 with STAT3 dramatically enhanced the transcriptional activity of SAA in a dose-dependent manner. The formation of a complex with STAT3, NF-B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
We first examined the kinetics of cytokine stimulation by using the pGL3-SAA1 promoter–luciferase construct (–796/+24) (pGL3-SAA1), transfected into the HepG2 hepatoblastoma cell line. The time course study from 1 to 24 h showed that the transcriptional activity following IL-1 and IL-6 stimulation reached its maximum at 3 h (data not shown). On the basis of this and previously reported observations (Uhlar et al. 1997; Thorn & Whitehead 2002), we examined what role STAT3 plays in human SAA1 and SAA2 promoter activity. pEF-BOS dominant negative STAT3 Y705F (dn STAT3) or pEF-BOS wild-type STAT3 (wt STAT3) were co-transfected with both SAA promoter constructs. The co-expression of dn STAT3 completely inhibited transcriptional activity of both pGL3-SAA1 and pGL3-SAA2 (–816/+20) even after stimulation with IL-1+6. On the other hand, the co-expression of wt STAT3 augmented the transcriptional activity of both pGL3-SAA1 and pGL3-SAA2 three times more than that obtained with IL-6 and IL-1+6 stimulation (Fig. 1A). These results indicate that STAT3 plays an important role in the transcriptional augmentation of SAA1 and SAA2 genes. Since no typical STAT3 consensus sequence has been identified in human SAA1 and SAA2 promoters, it is necessary to determine how STAT3 is involved in the transcriptional activation of SAA genes. First, we investigated whether a still unknown STAT3 RE might be located in the promoter region of the SAA1 and SAA2 genes by using 5' deletion mutants of each of the promoters. We observed that the promoter activity of both SAA genes was partly reduced by deletion of C/EBPß RE and completely eliminated by deletion of NF-B RE (Fig. 1B). These results were consistent with those reported by Betts et al. (1993), but also suggested that STAT3 might interact with the whole domain from C/EBPß RE to NF-B RE.
|
Next, we performed an electromobility shift assay (EMSA) using the oligonucleotide that contains C/EBPß and NF-B RE located between –196 and –73 in the human SAA1 promoter. Ray et al. (1995) previously used such a long oligonucleotide-rabbit SAA promoter and demonstrated the formation of heteromeric complexes of C/EBPß and NF-B after LPS stimulation. On the basis of their results, we first performed a 2-h time course study of the effect of IL-6, IL-1ß, or IL-1+6 stimulation and detected two major nucleoprotein complexes after cytokine stimulation. The C1 complex was slightly induced by IL-6, but enhanced by IL-1 and more strongly so by IL-1+6. Formation of the C2 complex was enhanced after stimulation by any of the cytokines (Fig. 2A). These results indicated that the C1 complex was associated with the augmentation of transcriptional activation by IL-1+6. With a super shift assay using specific antibodies, we confirmed that the C1 complex was composed of at least NF-B p65 and C/EBPß, and the C2 complex consisted of NF-B p50. Moreover, we observed that anti-phospho-STAT3 Ser727 monoclonal antibody (6E4, Cell Signaling Technology, Beverly, MA) inhibited the formation of the C1 and C2 complexes (Fig. 2B). These results suggested that STAT3 was present in the C1 and C2 complexes. Unexpectedly, the anti-STAT3 (C20) antibody, which is commonly used for super shift assay of STAT3 (Zhang et al. 1996a), did not shift the C1 and C2 complexes. We hypothesized that anti-phospho-STAT3 Ser727 monoclonal antibody has a nonspecific effect on the super shift assay. To rule out this possibility, we performed a dose-dependent study of anti-phospho-STAT3 Ser727 monoclonal antibody, anti-STAT3 (C20) antibody, and IgG and found that only anti-phospho-STAT3 Ser727 monoclonal antibody showed a dose-dependent effect in the super shift assay (data not shown). The phospho-STAT3 Ser727 monoclonal antibody also inhibited the formation of the C1 and the C2 complexes induced by IL-1 (data not shown). The following experiments focused on the C1 complex, which was related to the synergistic induction of SAA.
|
B RE-containing region after complex formation with NF-B p65
To examine the possibility that STAT3 might act on the transcriptional activity of SAA through the C/EBPß and NF-B RE-containing region, an expression vector for wt STAT3 was co-transfected with a pGL3-SAA1, pGL3-SAA1 C/EBPß RE deleted mutant (
C/EBPß RE), and a pGL3-SAA1 NF-B RE deleted mutant (NF-B RE). As shown in Fig. 2C, the co-expression of wt STAT3 augmented the transcriptional activity of pGL3-SAA1 and pGL3-SAA1C/EBPß RE almost threefold. However, co-expression of wt STAT3 did not enhance the transcriptional activity of pGL3-SAA1NF-B RE. These results suggest that STAT3 is involved in the transcriptional activity of SAA, most likely through NF-B RE. Competitive binding of STAT3 and NF-B has been found in rat fibrinogen (Zhang & Fuller 2000) and 2-macroglobulin gene promoters (Zhang & Fuller 1997; Bode et al. 2001). In the case of rat fibrinogen, the CTGGGAATCCC sequence is responsible for transactivation by both STAT3 and NF-B. In fact, Zhang and Fuller (2000) reported that TCC was necessary for NF-B binding and that the CTGGGAA sequence was needed for STAT3 binding because of the loss of transcriptional activity in an AGATCTATCCC mutant. These findings led us to examine whether STAT3 binds to the CAGGGACTTTCCC sequence of NF-B RE on the SAA1 promoter region. For this purpose, we created two mutated constructs, pGL3-SAA1 NF-B RE M1 (AGATCTATTTCCC) and M2 (CAGGGACTTGTAC), which were mutated upstream and downstream of the NF-B RE. We expected that STAT3 would bind to NF-B RE M2, but not NF-B RE M1. However, transfection with NF-B RE M1, as well as M2, did not result in transcriptional activity even when wt STAT3 was co-expressed (Fig. 2C). These results suggest that STAT3 does not bind to NF-B RE, which mediates the transcriptional activity of the human SAA1 gene.
To confirm the results from the luciferase assay using SAA1 mutated constructs, we performed EMSA using either mutated C/EBPß-wt NF-B RE (SAA1 mt C/EBPß RE) or wt C/EBPß-mt NF-B RE M2 probe (SAA1 mt NF-B RE M2). Formation of the C1 complex by IL-1 or IL-1+6 was diminished using the SAA1 mt C/EBPß RE probe. In the case of the SAA1 mt NF-B RE probe, a small complex consisting of C/EBPß remained (data not shown), but the C1 complex by IL-1 or IL-1+6 was completely eliminated (Fig. 2D). These results are consistent with those obtained with deletion mutants of the SAA promoter as shown in Figs 1B and 2C, and suggest that NF-B RE is essential for the formation of the transcriptional complex containing STAT3 and for the augmentation of transcriptional activity.
We assumed that STAT3 forms a complex with NF-B and contributes to the transcriptional augmentation of the human SAA gene. To examine our hypothesis, we performed immunoprecipitation-Western blot analysis (IP-Western) of STAT3 and NF-B. Nuclear extracts of HepG2 cells were immunoprecipitated with anti-STAT3 (C20) antibody, and the immunoprecipitates were blotted against NF-B p65 and p50. Figure 2E clearly shows that STAT3 is associated with NF-B p65 following IL-1+6 treatment. However, no specific band of NF-B p50 was detected when a specific antibody for the NF-B p50 subunit was used (data not shown). A specific band of NF-B p65 was weakly expressed by immunoprecipitates with anti-STAT3 (C20) antibody following stimulation with IL-1, but not IL-6 (data not shown). These findings are consistent with those reported by Betts et al. (1993) that over-expression of NF-B p65, but not p50, enhanced the transcriptional activity of human SAA2 in a dose-dependent manner, and indicating that cross talk between STAT3 and NF-B p65 contributes to the transcriptional augmentation of SAA by IL-1+6 stimulation.
STAT3 forms transcriptional complex with NF-B p65 and p300 on SAA promoter region
The question remained as to how STAT3 contributes to the formation of the C1 complex comprising NF-B, C/EBPß, and STAT3. The CREB-binding protein (CBP)/p300 family of transcriptional co-activators interacts with STAT1, 2, and 5 (Bhattacharya et al. 1996; Zhang et al. 1996b; Horvai et al. 1997), while STAT3 is reportedly associated with p300 (Nakashima et al. 1999; Paulson et al. 1999). This indicates the possibility that heteromeric complex formation of STAT3, NF-B p65, and p300 is involved in the transcriptional activity of human SAA gene. We therefore used IP-Western to investigate whether endogenous STAT3 interacts with p300 in HepG2 cells following IL-1+6 treatment. A specific band corresponding to p300 was detected with the anti-p300 antibody from the nuclear extracts of HepG2 cells immunoprecipitated with the anti-STAT3 (C20) antibody (data not shown). These results indicated the possibility that the heteromeric complex containing STAT3 and p300 was involved in transcriptional activity of the human SAA gene. We therefore performed a luciferase assay using pGL3-SAA1 (–226/+24) co-transfected with p300 wt in pCMVß (wt p300) and wt STAT3, and found that co-expression of wt p300 alone did not augment the luciferase activity of pGL3-SAA1 (–226/+24), but that co-expression of wt p300 with wt STAT3 dramatically enhanced the luciferase activity in a dose-dependent manner (Fig. 3A). It has been reported that the STAT3 carboxyl terminus is capable of recruiting p300/CBP (Paulson et al. 1999) and that Ser727 in the C-terminal region of STAT3 is required for transactivation by association with p300 (Schuringa et al. 2001). We next used the pEF-BOS STAT3 S727A mutant (STAT3 S727A) to examine whether the phosphorylated STAT3 Ser727 is involved in the transcriptional activity of the human SAA gene. STAT3 S727A alone and co-expression of wt p300 with STAT3 S727A did not augment the luciferase activity of pGL3-SAA1 (–226/+24) to the same degree as that realized with wt STAT3 (Fig. 3B). These results suggest that STAT3 interacts with p300 in the transcriptional activity of the human SAA gene. To confirm that STAT3 forms a transcriptional complex with NF-B p65 and p300 on the SAA promoter region, we performed a chromatin immunoprecipitation (ChIP) assay using chromatin isolated from HepG2 cells. STAT3 and p300 were evidently recruited to the SAA1 promoter region (–226/+24) in response to IL-6 or IL-1+6 and weakly recruited by IL-1. NF-B p65 was recruited by IL-1 or IL-1+6 and slightly recruited by IL-6 (Fig. 3C). These results clearly demonstrate that STAT3 forms a transcriptional complex with NF-B p65 and p300 on the SAA promoter region.
|
B RE on human SAA promoter via a newly discovered cis-acting mechanism
Since no typical STAT3 RE seems to be located in the promoter region of the human SAA gene, it is likely that STAT3 either binds to the promoter region of the SAA gene indirectly or obtains binding affinity for an unknown DNA sequence in a complex with NF-B p65. To clarify whether STAT3 binds to the promoter region directly or indirectly, we performed DNA affinity chromatography using an SAA1 oligonucleotide (–196/–73) probe (wt SAA1 probe). Nuclear extracts from HepG2 cells were incubated with a biotinylated wt SAA1 probe. Proteins specifically interacting with DNA fragments were collected with the aid of streptavidin dynabeads with a magnet, and transcriptional factors were analyzed by Western blotting (Suzuki et al. 1993). GAS sequences and an NF-B decoy were used as positive controls for STAT3 and NF-B p65, respectively. As shown in Fig. 4A, STAT3 bound to the GAS sequence after IL-6 or IL-1+6 stimulation, and specific bands of NF-B p65 were identified with the NF-B decoy after IL-1 or IL-1+6 stimulation. This finding ascertained the specificity of the DNA affinity chromatography system. In the same assay, specific bands for NF-B p65 and STAT3 were both pulled down by the wt SAA1 probe from the nuclear extracts of HepG2 cells after IL-1+6 stimulation, suggesting that STAT3 acts on the SAA promoter via a cis-acting mechanism. However, since STAT3 binds to the wt SAA1 probe after IL-6 stimulation even in the presence of small amounts of NF-B p65, it is therefore reasonable to assume that STAT3 binds directly to the wt SAA1 probe. To explain these phenomena, a new cis-acting mechanism of STAT3 had to be postulated. We next used the SAA1 mt NF-B RE M2 probe, which has no binding affinity to NF-B p65, to examine the possibility that NF-B p65 has an effect on the binding affinity of STAT3 to the SAA1 promoter region. As shown in Fig. 4B, neither NF-B p65 nor STAT3 was detected by the probe, indicating that the interaction between STAT3 and NF-B p65 is essential for the binding affinity of STAT3 to the wt SAA1 probe. Moreover, these results were consistent with the previous results obtained with the luciferase assay (Fig. 2C) or with EMSA (Fig. 2D). Consequently, it is reasonable to assume that the formation of the heteromeric complex of STAT3 and NF-B p65 gives STAT3 binding affinity to the SAA1 promoter region. On the basis of our results and those obtained with rat fibrinogen (Zhang & Fuller 2000), we focused our attention on the 3' site of NF-B RE (CAGGGACTTTCCCCAGGGAC) as a candidate of STAT3 binding site, because sequences contiguous to NF-B RE might have influenced the binding affinity of STAT3. Moreover, the CTGGGAA sequence is needed for STAT3 in the case of rat fibrinogen (Zhang & Fuller 2000). On the assumption that mutation of this site could influence the binding affinity of STAT3, but not NF-B p65, we created a SAA1 mt NF-B RE M3 probe (CAGGGACTTTCCCAGATCTA). As expected, the specific bands of STAT3 from the nuclear extracts of HepG2 cells after IL-1+6 stimulation were markedly reduced by the SAA1 mt NF-B RE M3 probe compared to the effect obtained with the wild-type SAA1 probe, although the specific bands of NF-B p65 were observed almost as intact as with the wild type (Fig. 4C). The same results were obtained from the nuclear extract after IL-6 stimulation (data not shown). In fact, using pGL3-SAA1 (–226/+24) NF-B RE M3 reduced the augmentation of STAT3 and p300 on the transcriptional activity of SAA as compared to when pGL3-SAA1 (–226/+24) was used (Fig. 4D). These results support our assumption that binding affinity of STAT3 for the human SAA promoter region is the result of the formation of a heteromeric complex comprising STAT3 and NF-B p65. To verify this supposition, we performed a luciferase assay using the pCMV-IBM vector, which can block NF-B signaling and eliminate the low-level activation of NF-B produced from fetal bovine serum. We observed that pCMV-IBM eliminated the augmentation of wt STAT3 on pGL3-SAA1 (–796/+24) following IL-1+6 stimulation (Fig. 4E). The same results were obtained for IL-6 stimulation (data not shown), indicating that a small amount of NF-B p65, activated by an in vitro culture containing fetal bovine serum, can form the heteromeric complex of STAT3 and NF-B p65 after STAT3 has been activated by IL-6. This is thought to be the reason why STAT3 was detected in the nuclear extracts stimulated by IL-6.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
B and C/EBPß in the stimulation of IL-1+6. However, this induction model of SAA does not fully explain the clinical results of anti-IL-6 receptor antibody therapy for RA patients (Nishimoto et al. 2004) and the findings in the liver of STAT3 conditional mutant mice (Alonzi et al. 2001). Moreover, no typical consensus sequence of STAT3 has been observed in the promoter region of SAA genes. The aim of our study was to clarify the exact induction mechanism of SAA from the clinical point of view. We were able to demonstrate that STAT3 acts on the human SAA promoter via a newly discovered cis-acting mechanism, that is, the formation of a heteromeric complex containing STAT3, NF-B p65, and p300 at a 3' site of the NF-B RE. We also presented a schematic model to explain the synergistic induction of human SAA gene by IL-1+6 stimulation (Fig. 5). Next, we will discuss some of our experimental results to confirm the validity of this schematic model.
|
B p65 in the nucleus determines the formation of the C1 complex, and the second is that phosphorylation of STAT3 is required for the full transcriptional activation of the SAA gene. This accounts for the fact that IL-1 markedly induces nuclear translocation of NF-B p65, whereas STAT3 is only slightly phosphorylated by IL-1. On the other hand, a little nuclear translocation of NF-B p65 is induced by fetal bovine serum in the treatment with IL-6, but IL-6 dramatically induces the phosphorylation of STAT3. Putting these findings together suggests that the synergistic expression of SAA in response to IL-1+6 is induced by the combination of nuclear translocation of NF-B p65 and the phosphorylation of STAT3. Although the significance of the C2 complex remains unclear, the complex itself is composed of at least NF-B p50. It is reported that the NF-B p50 homodimer forms a complex with HDAC1, which can bind to DNA and repress transcription (Zhong et al. 2002). In fact, overexpression of NF-B p50 did not enhance the transcriptional activity of human SAA2 (Betts et al. 1993). This indicates that further study is needed to clarify how NF-B p50 contributes to the expression of the SAA gene. We confirmed, by using the super shift assay, ChIP assay, and DNA affinity choromatography assay systems, that STAT3 contributes to the transcriptional activation of SAA via a cis-acting mechanism. We were also able to demonstrate that the phosphorylation of STAT3 Tyr705 and Ser727 is important for the transcriptional activation of SAA.
While it is known that the phosphorylation of STAT3 Tyr705 is required for the nuclear translocation of STAT3, the question remains how the phosphorylation of STAT3 Ser727 is involved in the induction of SAA genes. It has been proposed that the phosphorylation of STAT3 Ser727 is needed for the maximal activation of transcription, but not for the DNA-binding activity (Wen et al. 1995; Wen & Darnell 1997). In addition, it has been found that the STAT3 C-terminus is capable of recruiting CBP/p300 (Paulson et al. 1999) and the phosphorylation of STAT3 Ser727 is required for an association with p300 (Schuringa et al. 2001). Our results show that phosphorylated STAT3 Ser727 is needed for the full activation of the SAA gene for an association with p300. It is thus reasonable to postulate that the phosphorylated STAT3 Ser727 contributes to the formation of the transcriptional complex. However, the question remains whether antiphospho-STAT3 Ser727 monoclonal antibody inhibited the formation of the C1 complex in the super shift assay because, unlike STAT3 Y705F, STAT3 S727A did not eliminate the transactivation of SAA.
In the study reported here, we provide the first direct evidence that the interaction of STAT3 and NF-B p65 contributes to the synergistic induction mechanism of the acute-phase response. The competitive binding of STAT3 and NF-B has been cited as an inhibitory mechanism in the rat fibrinogen (Zhang & Fuller 2000) and 2-macroglobulin gene promoters (Zhang & Fuller 1997; Bode et al. 2001). Furthermore, STAT3 reportedly forms a complex with NF-B p65 in the GAS/B sequence, which is derived from the rat 2-macroglobulin and contains the overlapping binding site of STAT3 and NF-B. This suggests that asymmetric cross talk between STAT3 and NF-B p65 can explain the inhibitory effect of IL-1 on IL-6 activity during the acute-phase response (Yoshida et al. 2004). The question has been raised why the interaction of STAT3 and NF-B p65 leads to two opposite effects, synergistic and inhibitory. We assumed that these opposite roles may be determined by the adjacent sequence of NF-B or STAT3 RE, which seems to be of little importance in the transcriptional activation. In fact, we were able to obtain, with the aid of a DNA affinity chromatography assay, direct evidence that STAT3 is present in the promoter of the SAA gene. In this assay, we found that the nonconsensus sequence at a 3' site of the NF-B RE interacts with STAT3 when STAT3 forms a complex with NF-B p65. The luciferase activity of pGL3-SAA1 (–226/+24) NF-B RE M3 then co-transfected with wt STAT3 and wt p300 was reduced.
STAT3 has been reported to form a complex with the CRE-binding protein in the jun B gene (Kojima et al. 1996), or with c-Jun for the 2-macrogloblin APRE (Schaefer et al. 1995). Other findings suggest that STAT3 has an effect on CRE-like sites in the C/EBPß promoter (Niehof et al. 2001) or glucocorticoid RE (Zhang et al. 1997) without the presence of the classical GAS sequence. These reported findings together support the validity of our finding of a discovered cis-acting mechanism of STAT3.
However, a limitation of our study is that we were not able to show in detail how STAT3 binds to NF-B p65, specifically whether STAT3 binds to NF-B p65 directly or indirectly. The inhibitory effect of the mutation of NF-B RE M3 is much smaller than that of NF-B RE M1 and M2 in the transcriptional activation of SAA gene. This would lead to the assumption that STAT3 binds directly to NF-B p65, which is inconsistent with the results of the DNA affinity chromatography assay. This means that another factor must contribute to the formation of the complex with STAT3 and NF-B p65. In addition, we could not determine which domain of STAT3 is critical for the binding to NF-B p65. The crystal structure of the heterodimer of NF-B p65/P50 or the homodimer of STAT3 ß bound to DNA has been described elsewhere (Becker et al. 1998; Chen et al. 1998), but further study is needed to clarify the three-dimensional structure of the heteromeric complex containing STAT3 and NF-B p65 bound to the SAA gene promoter.
Another important thing is that SAA is the precursor of amyloid A protein in AA amyloidosis. From the clinical point of view, two important findings should be mentioned in this connection. The first is that humanized anti-IL-6 receptor antibody therapy normalizes serum levels of SAA and improves the clinical symptoms of AA amyloidosis in some patients with Castleman disease (Nishimoto et al. 2000). Second, Gillmore et al. (2001) reported that normalization of the serum SAA level can lead to amyloid regression in patients with AA amyloidosis. Our findings in this context therefore constitute an aid for the development of a new therapeutic strategy for AA amyloidosis by using normalization of the serum SAA level.
In summary, we have been able to demonstrate that STAT3 plays an essential role in the synergistic induction of SAA by IL-1+6 stimulation. STAT3 forms a complex with NF-B p65 following IL-1+6 stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the NF-B RE of the SAA gene promoter. The formation of a complex with STAT3, NF-B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation. Our results further suggest that the SAA level is affected by the intensity of the interaction between STAT3 and NF-B p65, a finding that is expected to aid understanding of inflammatory status. NF-B is a key regulator of pro-inflammatory cytokines, matrix metalloproteinases, inducible nitric oxide synthase, cyclooxygenase 2, and other pro-inflammatory genes (Li & Verma 2002). The interaction between STAT3 and NF-B p65 may thus contribute to the expression of these pro-inflammatory genes.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Recombinant human IL-6 was provided by Ajinomoto (Tokyo, Japan) and used at a final concentration of 10 ng/mL, whereas recombinant human IL-1ß was purchased from Biosource International (Camarillo, CA) and used at 0.1 ng/mL. HepG2 cells were obtained from Dainihon Pharmaceutical Co. (Tokyo, Japan) and grown in Dulbecco's Modified Eagle's Medium supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-Glutamine, and 50 U/mL penicillin–streptomycin.
Plasmids construction
The 796-bp upstream region of human SAA1 and 24 bp of exon1 were amplified by PCR with the MluI and XhoI restriction sites introduced at the 5' and 3' ends, respectively, 5' primer: 5'-TCGACGCGTTCTAGACTGAGGGTGAAGGA; 3' primer: 5'-CCGCTCGAGTGTAGCTGAGCTGCGGGTCC. The PCR product was then inserted into a pGL3-Basic vector (Promega, Madison, WI). 5' deletion mutants pGL3-SAA1 (–526/+24, –226/+24, –156/+24, –76/+24) were generated with the same method, as were the upstream sequences of human SAA2 (–816/+20) and 5' deletion mutants (–496/+20, –246/+20, –146/+20, –76/+20). C/EBPß RE (–188/–175) and NF-B RE (–95/–85) of the pGL3-SAA1 (–796/+24) were deleted or mutated with the Quick Change Site-Directed Mutagenesis Kit (Stratagene, Birmingham, AL) according to the manufacturer's instructions. pEF-BOS wt STAT3 and pEF-BOS dn STAT3 Y705F were kindly provided by Dr Shizuo Akira (Research Institute for Microbial Diseases, Osaka University). pEF-BOS STAT3 S727A (STAT3 S727A) was mutated with the Quick Change Site-Directed Mutagenesis Kit. p300 wt in pCMVß was purchased from Upstate Biotechnology (Lake Placid, NY) and pCMV-IBM from Clontech (San Diego, CA).
Transfection and luciferase assay
HepG2 cells were seeded at 2 x 0.5 x 105 cells/well in 6-well plates, and after 24 h the cells were transfected with 1 µg of plasmid DNA by using Fugene 6 (Roche Molecular Biochemicals, Indianapolis, IN) and following the manufacturer's instructions. The cells were stimulated with various combinations of cytokines 48 h after transfection, lysed in passive lysate buffer and assayed with the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's specifications. Luciferase activity was normalized with the activity of renilla luciferase. Assays were conducted in triplicate, and the experiments were repeated at least three times.
Nuclear extracts and electromobility shift assays
Nuclear extracts were prepared from HepG2 cells as previously described (Youqi & Brasie 1997), after which the supernatant was subjected to dialysis with Akira et al.'s method (1994). Briefly, binding reactions used 10 µg of nuclear extracts in 10 mM Tris-Cl (pH 7.5), 1 mM EDTA, 4% glycerol, 5 mM dithiothreitol, 100 mM NaCl, 100 ng/µL bovine serum albumin, and 600 ng/µL poly (dI-dC), with the addition of 5 fmol of 5'-biotin end-labeled oligonucleotide, for a final volume of 20 µL. After incubation at 25 °C for 30 min, the complexes were detected with a LightShiftTM Chemiluminescent EMSA kit (Pierce Biotechnology, Rockford, IL). SAA1 oligonucleotides (–196/–73) were obtained with the PCR technique, and pGL3-SAA1 (–796/+24) was used as a template. The SAA1 (–196/–73) mt C/EBPß RE probe (mt C/EBPß-wt NF-B RE) or SAA1 (–196/–73) mt NF-B RE probe (wt C/EBPß-mt NF-B RE) was created using the same method. For the super shift assay, antibodies against NF-B p65, C/EBPß (Santa Cruz Biotechnology Inc, Santa Cruz, CA), STAT3 (Santa Cruz), and Phospho-STAT3 Ser727 (6E4, Cell Signaling Technology, Beverly, MA) were added to the reaction mixture prior to the addition of the 5'-biotin end-labeled oligonucleotides. The SAA1 (–196/–73) mt C/EBPß RE probe was mutated to 5'-AGGCTGCACACCTG-3' as previously described (Betts et al. 1993).
Immunoprecipitation and Western blot analysis
Nuclear extracts (200–300 µg) obtained 30 min after cytokine stimulation were mixed with antibodies overnight at 4 °C. Immunocomplexes were precipitated with Protein-A Sepharose beads (Amersham Pharmacia Biotech, Amersham, UK), and washed four times with lysis buffer. All precipitated proteins were resolved by 6–7.5% SDS-PAGE followed by Western blot analysis. We used the following antibodies: anti-STAT3 (C20) (Santa Cruz), anti-phospho-STAT3 Y705 (Cell Signaling Technology), anti-NF-B p65 (Upstate Biotechnology), anti-NF-B p50 (Santa Cruz), and anti-p300 antibody (Upstate Biotechnology).
DNA affinity chromatography
Nuclear extracts (200 µg) were mixed with the biotinylated oligonucleotide probe (1 µg) at 25 °C for 30 min under the same buffer conditions as for the EMSA. Fifty microliters of streptavidin-Dynabeads (Dynal, Great Neck, NY) were mixed in by rotation for 30 min (Suzuki et al. 1993). The Dynabeads were then collected with a magnet and washed three times with the buffer. The trapped proteins were analyzed by Western blotting in the same manner as previously described.
Oligonucleotide probes consisted of the GAS sequence: 5'-CATTTCCCGTAAATC-3' (Ward et al. 1999), the NF-B decoy: 5'-CCTTGAAGGGATTTCCCTCC-3' (Tomita et al. 1999), the SAA1 (–196/–73) wt NF-B RE probe: 5'-CAGGGACTTTCCCCAGGGAC-3', the SAA1 (–196/–73) mt NF-B RE M1 probe: 5'-AGATCTATTTCCCCAGGGAC-3', the SAA1 (–196/–73) mt NF-B RE M2 probe: 5'-CAGGGACTTGTACCAGGGAC-3', and the SAA1 (–196/–73) mt NF-B RE M3 probe: 5'-CAGGGACTTTCCCAGATCTA-3'.
Chromatin immunoprecipitation (ChIP) assay
Chromatin IP was performed essentially as described elsewhere (Agata et al. 2001) with minor modifications. HepG2 cells were fixed in 1% formaldehyde for 10 min at room temperature. Cells were washed two times with FACS solution buffer (PBS, 2% FCS 0.05% NaN3) and sucrose density-purified nuclear pellets were obtained as previously described (Youqi & Brasie 1997). Nuclear pellets were resuspended in 0.8 mL of lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.0, protease inhibitor cocktail; Roche) and sonicated five times for 10 s. Immunoprecipitation was performed overnight at 4 °C with specific antibodies and a negative control without antibody was also processed. We used the following antibodies: anti-STAT3 (C20) (Santa Cruz), anti-NF-B p65 (Santa Cruz), anti-p300 (Santa Cruz), and anti-acetylated histone H3 antibody (Upstate Biotechnology). Immunoprecipitates were recovered with 20 µL of 50% protein G-Sepharose/salmon sperm DNA for 3 h and washed with the buffer as described elsewhere (Agata et al. 2001). DNA was purified using classical procedures and 1 µL from a 20 µL DNA extraction was amplified for 25–30 cycles of 94 °C for 30 s, 55 °C (ß-actin 60 °C) for 60 s, 72 °C for 2 min. The primers used were –226/+24 of the SAA1 promoter 5'-TCCTGCCCTGACAGCTGCCA, 3'-TGTAGCTGAGCTGCGGGTCC and ß-actin 5'-TGCCTAGGTCACCCACTAATG 3'-GTGGCCCGTGATGAAGGCTA (Hough et al. 2005).
|
Acknowledgements |
|---|
|
Footnotes |
|---|
* Correspondence: E-mail: kyoshizaki{at}hpc.cmc.osaka-u.ac.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Akira, S., Nishio, Y., Inoue, M., et al. (1994) Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell 77, 63–71.[CrossRef][Medline]
Alonzi, T., Maritano, D., Gorgoni, B., et al. (2001) Essential role of STAT3 in the control of acute-phase response as revealed by inducible gene activation in the liver. Mol. Cell. Biol.
21, 1621–1632.
Becker, S., Groner, B. & Muller, C.W. (1998) Three-dimensional structure of the Stat3ß homodimer bound to DNA. Nature 394, 145–151.[CrossRef][Medline]
Betts, J.C., Cheshire, J.K., Akira, S., Kishimoto, T. & Woo, P. (1993) The role of NF-B and NF-IL6 transactivating factors in the synergistic activation of human serum amyloid A gene expression by interleukin-1 and interleukin-6. J. Biol. Chem.
268, 25624–25631.
Bhattacharya, S., Eckner, R., Grossman, S., et al. (1996) Cooperation of Stat2 and p300/CBP in signalling induced by interferon-. Nature
383, 344–347.[CrossRef][Medline]
Bode, J.G., Fischer, R., Haussinger, D., et al. (2001) The inhibitory effect of IL-1ß on IL-6-induced 2-macroglobulin expression is due to activation of NF-B. J. Immunol.
167, 1469–1481.
Chen, F.E., Huang, D.B., Chen, Y.Q. & Ghosh, G. (1998) Crystal structure of p50/p65 heterodimer of transcription factor NF-B bound to DNA. Nature
391, 410–413.[CrossRef][Medline]
Feldmann, M., Bennan, F.B. & Maini, R.N. (1996) Role of cytokines in rheumatoid arthritis. Annu. Rev. Immunol. 14, 397–440.[CrossRef][Medline]
Gillmore, J.D., Laurence, B.L., Persey, M.R., Pepys, M.B. & Hawkins, P.N. (2001) Amyloid load and clinical outcome in AA amyloidosis in relation to circulating concentration of serum amyloid A protein. Lancet 358, 24–29.[CrossRef][Medline]
Hagihara, K., Nishikawa, T., Isobe, T., et al. (2003) IL-6 plays a critical role in the synergistic induction of human serum amyloid A (SAA) gene when stimulated with proinflammatory cytokines as analyzed with an SAA isoform real-time quantitative RT-PCR assay system. Biochem. Biophys. Res. Commun. 314, 363–369.
He, R., Sang, H. & Ye, R.D. (2003) Serum amyloid A induces IL-8 secretion through a G protein-coupled receptor, FPRL1/LXA4R. Blood
101, 1572–1581.
Horvai, A.E., Xu, L., Korzus, E., et al. (1997) Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc. Natl. Acad. Sci. USA
94, 1074–1079.
Hough, C., Cuthbert, C.D., Notley, C., et al. (2005) Cell type-specific regulation of von Willebrand factor expression by the E4BP4 transcriptional repressor. Blood
105, 1531–1539.
Johnson, B.D., Kip, K.E., Marroquin, O.C., et al. (2004) Serum amyloid A as a predictor of coronary artery disease and cardiovascular outcome in women. Circulation
109, 726–732.
Kojima, H., Nakajima, K. & Hirano, T. (1996) IL-6-inducible complexes on an IL-6 response element of the junB promoter contain Stat3 and 36 kDa CRE-like site binding protein(s). Oncogene 12, 547–554.[Medline]
Li, Q. & Verma, I.M. (2002) NF-B regulation in the immune system. Nat. Rev. Immunol.
2, 725–734.[CrossRef][Medline]
Maini, R.N. & Taylor, P.C. (2000) Anti-cytokine therapy for rheumatoid arthritis. Annu. Rev. Med. 51, 207–229.[CrossRef][Medline]
Nakashima, K., Yanagisawa, M., Arakawa, H., et al. (1999) Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science
284, 479–482.
Niehof, M., Streetz, K., Rakemann, T., et al. (2001) Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPß promoter suggests a new mechanism of transcriptional regulation by STAT3. J. Biol. Chem.
276, 9016–9027.
Nishimoto, N., Sasai, M., Shima, Y., et al. (2000) Improvement in Castleman's disease by humanized anti-interleukin-6 receptor antibody therapy. Blood 99, 56–61.
Nishimoto, N., Yoshizaki, K., Miyasaka, N., et al. (2004) Treatment of rheumatoid arthritis with humanized anti-interleukin-6 receptor antibody: a multicenter, double-blind, placebo-controlled trial. Arthritis Rheum. 50, 1761–1769.[CrossRef][Medline]
Paulson, M., Pisharody, S., Pan, L., et al. (1999) Stat protein transactivation domains recruit p300/CBP through widely divergent sequences. J. Biol. Chem.
274, 25343–25349.
Ray, A., Hannink, M. & Ray, B.K. (1995) Concerted participation of NF-B and C/EBP heteromer in lipopolysaccharide induction of serum amyloid A gene expression in liver. J. Biol. Chem.
270, 7365–7374.
Schaefer, T.S., Sanders, L.K. & Nathans, D. (1995) Cooperative transcriptional activity of Jun and Stat3 ß, a short form of Stat3. Proc. Natl. Acad. Sci. USA
92, 9097–9101.
Schuringa, J.J., Schepers, H., Vellenga, E. & Kruijer, W. (2001) Ser727-dependent transcriptional activation by association of p300 with STAT3 upon IL-6 stimulation. FEBS Lett. 495, 71–76.[CrossRef][Medline]
Seidel, H.M., Milocco, L.H., Lamb, P., et al. (1995) Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc. Natl. Acad. Sci. USA
92, 3041–3045.
Suzuki, T., Fujisawa, J.I., Toita, M. & Yoshida, M. (1993) The trans-activator tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proc. Natl. Acad. Sci. USA
90, 610–614.
Thorn, C.F. & Whitehead, A.S. (2002) Differential glucocorticoid enhancement of the cytokine-driven transcriptional activation of the human acute phase serum amyloid A genes, SAA1 and SAA2. J. Immunol.
169, 399–406.
Tomita, T., Takeuchi, E., Tomita, N., et al. (1999) Suppressed severity of collagen-induced arthritis by in vivo transfection of nuclear factor B decoy oligodeoxynucleotides as a gene therapy. Arthritis Rheum.
42, 2532–2542.[CrossRef][Medline]
Uhlar, C.M. & Whitehead, A.S. (1999) Serum amyloid A, the major vertebrae acute-phase reactant. Eur. J. Biochem. 265, 501–523.[Medline]
Uhlar, C.M., Grehan, S., Steel, D.M., Steinkasserer, A. & Whitehead, A.S. (1997) Use of the acute phase serum amyloid A2 (SAA2) gene promoter in the analysis of pro- and anti-inflammatory mediators: differential kinetics of SAA2 promoter induction by IL-1 ß and TNF- compared to IL-6. J. Immunol. Methods
203, 123–130.[CrossRef][Medline]
Urieli-Shoval, S., Shubinsky, G., Linke, R.P., et al. (2002) Adhesion of human platelets to serum amyloid A. Blood 95, 1224–1229.
Ward, A.C., Hermans, M.H., Smith, L., et al. (1999) Tyrosine-dependent and -independent mechanism of STAT3 activation by the human granulocyte colony-stimulating factor (G-CSF) receptor are differentially utilized depending on G-CSF concentration. Blood
93, 113–124.
Wen, Z. & Darnell, J.E. Jr (1997) Mapping of Stat3 serine phosphorylation to a single residue (727) and evidence that serine phosphorylation has no influence on DNA binding of Stat1 and Stat3. Nucleic Acids Res.
25, 2062–2067.
Wen, Z., Zhong, Z. & Darnell, J.E. Jr (1995) Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, 241–250.[CrossRef][Medline]
Yoshida, Y., Kumar, A., Koyama, Y., et al. (2004) Interleukin 1 activates STAT3/nuclear factor-B cross-talk via a unique TRAF6- and p65-dependent mechanism. J. Biol. Chem.
279, 1768–1776.
Youqi, H. & Brasie, A.R. (1997) Mechanism for biphasic rel A. NF-B1 nuclear translocation in tumor necrosis factor -stimulated hepatocytes. J. Biol. Chem.
272, 9825–9832.
Zhang, Z. & Fuller, G.M. (1997) The competitive binding of STAT3 and NF-B on an overlapping DNA binding site. Biochem. Biophys. Res. Commun.
237, 90–94.[CrossRef][Medline]
Zhang, Z. & Fuller, G.M. (2000) Interleukin 1ß inhibits interleukin 6-mediated rat fibrinogen gene expression. Blood
96, 3466.
Zhang, D., Sun, M., Samols, D. & Kushner, I. (1996a) STAT3 participates in transcriptional activation of the C-reactive protein gene by interleukin-6. J. Biol. Chem.
271, 9503–9509.
Zhang, J.J., Vinkemeier, U., Gu, W., et al. (1996b) Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling. Proc. Natl. Acad. Sci. USA
93, 15092–15096.
Zhang, Z., Jones, S., Hagood, J.S., Fuentes, N.L. & Fuller, G.M. (1997) STAT3 acts as a co-activator of glucocorticoid receptor signaling. J. Biol. Chem.
272, 30607–30610.
Zhong, H., May, M.J., Jimi, E. & Ghoshi, S. (2002) The phosphorylation status of nuclear NF-B determines its association with CBP/P300 or HDAC-1. Mol. Cell
9, 625–636.[CrossRef][Medline]
Received: 29 June 2005
Accepted: 1 August 2005
This article has been cited by other articles:
|
|
 |
|
  B. Zhang, Y. Une, F. Ge, X. Fu, J. Qian, P. Zhang, J. Sawashita, K. Higuchi, and M. Mori Characterization of the Cheetah Serum Amyloid A1 Gene: Critical Role and Functional Polymorphism of a Cis-Acting Element J. Hered., March 28, 2008; (2008) esn015v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nishikawa, K. Hagihara, S. Serada, T. Isobe, A. Matsumura, J. Song, T. Tanaka, I. Kawase, T. Naka, and K. Yoshizaki Transcriptional Complex Formation of c-Fos, STAT3, and Hepatocyte NF-1{alpha} Is Essential for Cytokine-Driven C-Reactive Protein Gene Expression J. Immunol., March 1, 2008; 180(5): 3492 - 3501. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Snyder, X.-Y. Huang, and J. J. Zhang Identification of Novel Direct Stat3 Target Genes for Control of Growth and Differentiation J. Biol. Chem., February 15, 2008; 283(7): 3791 - 3798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hou, S. Ray, and A. R. Brasier The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression J. Biol. Chem., December 21, 2007; 282(51): 37091 - 37102. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Yang, X. Liao, M. K. Agarwal, L. Barnes, P. E. Auron, and G. R. Stark Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NF{kappa}B Genes & Dev., June 1, 2007; 21(11): 1396 - 1408. [Abstract] [Full Text] [PDF]
|
|
|
|
