GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 1051-1063. doi:10.1111/j.1365-2443.2005.00900.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagihara, K.
Right arrow Articles by Yoshizaki, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagihara, K.
Right arrow Articles by Yoshizaki, K.

Essential role of STAT3 in cytokine-driven NF-{kappa}B-mediated serum amyloid A gene expression

Keisuke Hagihara1, Teppei Nishikawa2, Yasuhiro Sugamata2, Jian Song2, Tomoyasu Isobe2, Tetsuya Taga3 and Kazuyuki Yoshizaki1,2,*

1 Molecular Medicine, Osaka University Graduate School of Medicine and 2 Department of Medical Science I, School of Health and Sport Sciences, Osaka University, 2-1 Yamada-Oka, Suita, Osaka 565-0871, Japan
3 Department of Cell Fate Modulation, Institute of Molecular Embryology and Genetics, Kumamoto University, 2-2-1 Honjo, Kumamoto 860-0811, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Serum amyloid A (SAA) is a sensitive marker of acute-phase responses and known as a precursor protein of amyloid fibril in amyloid A (AA) (secondary) amyloidosis. Since the serum SAA level is also closely related to activity of chronic inflammatory disease and coronary artery disease, it is important to clarify the exact induction mechanism of SAA from the clinical point of view. Here we provide evidence that STAT3 plays an essential role in cytokine-driven SAA expression, although the human SAA gene shows no typical STAT3 response element (RE) in its promoters. STAT3 and nuclear factor {kappa}B (NF-{kappa}B) p65 first form a complex following interleukin (IL)-1 and IL-6 (IL-1+6) stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the SAA gene promoter's NF-{kappa}B RE. Moreover, co-expression of p300 with STAT3 dramatically enhances the transcriptional activity of SAA. The formation of a complex with STAT3, NF-{kappa}B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation. Our findings are expected to aid the understanding of the inflammatory status of AA amyloidosis to aid development of a therapeutic strategy for this disease by means of normalization of serum SAA levels.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Serum amyloid A (SAA), one of the acute-phase proteins and mainly produced in the liver, is an apolipoprotein of high-density lipoprotein (Uhlar & Whitehead 1999). The human SAA family consists of SAA1, SAA2, and SAA4. The first two, also known as acute-phase SAAs, dramatically increase by as much as 1000 times during inflammation. Although SAA3 is a pseudogene, SAA4 is known as a constitutive SAA (C-SAA) (Uhlar & Whitehead 1999). SAA was recently reported to induce interleukin 8 secretion (He et al. 2003) and inhibit platelet aggregation (Urieli-Shoval et al. 2002). Moreover, the SAA level is closely related to the activity of chronic inflammatory (Gilmore et al. 2001) and coronary artery diseases (Johnson et al. 2004). It is well known that SAA functions pathologically as a precursor of amyloid A (AA) protein in AA (secondary) amyloidosis, which is a serious complication of chronic inflammatory diseases, such as rheumatoid arthritis (RA), juvenile inflammatory arthritis, and Castleman disease (Gillmore et al. 2001).

Since various pro-inflammatory cytokines, e.g., IL-1, tumor necrosis factor {alpha} (TNF{alpha}), and IL-6, are produced in RA patients (Feldmann et al. 1996), anticytokine therapy has been used for their treatment (Maini & Taylor 2000). We observed that IL-6 blocking therapy normalized serum SAA levels in a majority of RA patients although IL-1 and TNF{alpha} remained enhanced (Nishimoto et al. 2004). It has been reported that the induction of the SAA2 gene is regulated by nuclear factor {kappa}B (NF-{kappa}B) and CAAT enhancer-binding protein ß (C/EBPß) in response to stimulation by IL-1 together with IL-6 (IL-1+6) (Betts et al. 1993). However, this induction model does not fully explain our clinical results. We therefore examined our clinical results by using an SAA isoform real-time quantitative RT-PCR assay system for three hepatic cell lines. Only blocking of IL-6, but not of IL-1 or TNF{alpha}, completely inhibited the synergistic induction of SAA1 and SAA2 mRNA during triple stimulation with IL-6, IL-1, and TNF{alpha}, whereas JAK2 inhibitor-AG490, but not MEK1/2 inhibitor-U0126, reduced SAA1 gene expression in response to IL-1+6 stimulation (Hagihara et al. 2003). Our results are consistent with the findings for signal transducers and activators of transcription 3 (STAT3) in the liver of conditional mutant mice, thus suggesting that STAT3 plays an essential role in cytokine-driven SAA expression because SAA1 and SAA2 expression becomes nearly defective after IL-6 or LPS stimulation in spite of the normal expression of C/EBPß (Alonzi et al. 2001).

STAT3, which activates various cytokine-driven inflammatory genes, was cloned as a transcription factor that interacts with the acute-phase response element (APRE; -CCTTCCCGGAATTC) when IL-6 induces the acute-phase response in the liver during inflammation (Akira et al. 1994). STAT3 has been observed to specifically bind to a {gamma}-interferon activation sequence (GAS)-like sequence (- TTNNNGAA) (Seidel et al. 1995). For instance, the C-reactive protein (CRP) gene, which is a major acute-phase protein active in the response to IL-6, has a STAT3 response element (RE) (-TTCCCGAA) in its promoter (Zhang et al. 1996a). It should be noted, however, that no typical STAT3 RE seems to be present in the promoter region of SAA1 and SAA2 genes. To understand the effect of SAA on the pathogenesis of inflammatory diseases, such as coronary artery disease (Johnson et al. 2004) and AA amyloidosis (Gillmore et al. 2001), the exact involvement of STAT3 in the transcriptional mechanism of SAA must be clarified.

In this study, we provide evidence of a novel cis-acting mechanism of STAT3. We demonstrate that STAT3 forms a complex with NF-{kappa}B p65, but not with NF-{kappa}B p50 following IL-1+6 stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the SAA gene promoter's NF-{kappa}B RE. Moreover, co-expression of p300 with STAT3 dramatically enhanced the transcriptional activity of SAA in a dose-dependent manner. The formation of a complex with STAT3, NF-{kappa}B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
STAT3 is essential for synergistic induction of human SAA genes

We first examined the kinetics of cytokine stimulation by using the pGL3-SAA1 promoter–luciferase construct (–796/+24) (pGL3-SAA1), transfected into the HepG2 hepatoblastoma cell line. The time course study from 1 to 24 h showed that the transcriptional activity following IL-1 and IL-6 stimulation reached its maximum at 3 h (data not shown). On the basis of this and previously reported observations (Uhlar et al. 1997; Thorn & Whitehead 2002), we examined what role STAT3 plays in human SAA1 and SAA2 promoter activity. pEF-BOS dominant negative STAT3 Y705F (dn STAT3) or pEF-BOS wild-type STAT3 (wt STAT3) were co-transfected with both SAA promoter constructs. The co-expression of dn STAT3 completely inhibited transcriptional activity of both pGL3-SAA1 and pGL3-SAA2 (–816/+20) even after stimulation with IL-1+6. On the other hand, the co-expression of wt STAT3 augmented the transcriptional activity of both pGL3-SAA1 and pGL3-SAA2 three times more than that obtained with IL-6 and IL-1+6 stimulation (Fig. 1A). These results indicate that STAT3 plays an important role in the transcriptional augmentation of SAA1 and SAA2 genes. Since no typical STAT3 consensus sequence has been identified in human SAA1 and SAA2 promoters, it is necessary to determine how STAT3 is involved in the transcriptional activation of SAA genes. First, we investigated whether a still unknown STAT3 RE might be located in the promoter region of the SAA1 and SAA2 genes by using 5' deletion mutants of each of the promoters. We observed that the promoter activity of both SAA genes was partly reduced by deletion of C/EBPß RE and completely eliminated by deletion of NF-{kappa}B RE (Fig. 1B). These results were consistent with those reported by Betts et al. (1993), but also suggested that STAT3 might interact with the whole domain from C/EBPß RE to NF-{kappa}B RE.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1  Necessity of STAT3 for the transcriptional augmentation of human SAA1 and SAA2 genes via the C/EBPß RE and NF-{kappa}B RE-containing region. (A) STAT3 showed transcriptional augmentation in association with the SAA1 and SAA2 promoters. HepG2 cells were transfected with 0.5 µg of pGL3-SAA1 (–796/+24) or pGL3-SAA2 (–816/+20) alone, or cotransfected with 0.5 µg of pEF-BOS dn STAT3 (dn STAT3) or pEF-BOS wt STAT3 (wt STAT3), respectively. Cyokine stimulation was performed with IL-6 (10 ng/mL) and/or IL-1ß (0.1 ng/mL) for 3 h. The relative luciferase activity is expressed as means + SD of triplicate cultures and transfections. (B) Schematic model of the human SAA1 and SAA2 promoters, showing transcriptional activities of 5' deletion mutants after cytokine stimulation. SAA promoter activities were reduced by deletion of C/EBPß RE and completely eliminated by deletion of NF-{kappa}B RE.

 
STAT3 present on the human SAA gene promoter

Next, we performed an electromobility shift assay (EMSA) using the oligonucleotide that contains C/EBPß and NF-{kappa}B RE located between –196 and –73 in the human SAA1 promoter. Ray et al. (1995) previously used such a long oligonucleotide-rabbit SAA promoter and demonstrated the formation of heteromeric complexes of C/EBPß and NF-{kappa}B after LPS stimulation. On the basis of their results, we first performed a 2-h time course study of the effect of IL-6, IL-1ß, or IL-1+6 stimulation and detected two major nucleoprotein complexes after cytokine stimulation. The C1 complex was slightly induced by IL-6, but enhanced by IL-1 and more strongly so by IL-1+6. Formation of the C2 complex was enhanced after stimulation by any of the cytokines (Fig. 2A). These results indicated that the C1 complex was associated with the augmentation of transcriptional activation by IL-1+6. With a super shift assay using specific antibodies, we confirmed that the C1 complex was composed of at least NF-{kappa}B p65 and C/EBPß, and the C2 complex consisted of NF-{kappa}B p50. Moreover, we observed that anti-phospho-STAT3 Ser727 monoclonal antibody (6E4, Cell Signaling Technology, Beverly, MA) inhibited the formation of the C1 and C2 complexes (Fig. 2B). These results suggested that STAT3 was present in the C1 and C2 complexes. Unexpectedly, the anti-STAT3 (C20) antibody, which is commonly used for super shift assay of STAT3 (Zhang et al. 1996a), did not shift the C1 and C2 complexes. We hypothesized that anti-phospho-STAT3 Ser727 monoclonal antibody has a nonspecific effect on the super shift assay. To rule out this possibility, we performed a dose-dependent study of anti-phospho-STAT3 Ser727 monoclonal antibody, anti-STAT3 (C20) antibody, and IgG and found that only anti-phospho-STAT3 Ser727 monoclonal antibody showed a dose-dependent effect in the super shift assay (data not shown). The phospho-STAT3 Ser727 monoclonal antibody also inhibited the formation of the C1 and the C2 complexes induced by IL-1 (data not shown). The following experiments focused on the C1 complex, which was related to the synergistic induction of SAA.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 2  Action of STAT3 on the transcriptional activity of human SAA genes via the NF-{kappa}B RE-containing region after formation of a complex with NF-{kappa}B p65. (A) EMSA was performed with 10 µg of nuclear extracts from HepG2 cells using the SAA1 (–196/–73) oligonucleotide probe containing C/EBPß RE and NF-{kappa}B RE. The C1 complex was induced by IL-1 and clearly enhanced by IL-1+6. Cytokine stimulation was performed with IL-6 (10 ng/mL) and/or IL-1ß (0.1 ng/mL) from 15 to 120 min. (B) In the super shift assay, each of the specific antibodies against NF-{kappa}B p65, NF-{kappa}B p50, C/EBPß, and STAT3 was added to the reactions. IL-1+6 stimulation was performed for 60 min. Phospho-STAT3 Ser727 monoclonal antibody, but not anti-STAT3 (C20) antibody, inhibited the formation of the C1 complex. (C) A total of 0.5 µg of pEF-BOS wt STAT3 (wt STAT3) was co-transfected with 0.5 µg of pGL3-SAA1 (–796/+24), pGL3-SAA1{Delta}C/EBPß RE, pGL3-SAA1{Delta}NF-{kappa}B RE, pGL3-SAA1 NF-{kappa}B RE M1 (AGATCTATTTCC) or M2 (CAGGGACTTGTA). wt STAT3 could not augment the transcriptional activity of SAA1 without NF-{kappa}B RE or with the mutation of NF-{kappa}B RE. Relative luciferase activity is expressed as the means + SD of triplicate cultures and transfections. (D) EMSA was performed with 10 µg of nuclear extracts from HepG2 cells stimulated with IL-1+6 for 30 min. The wt SAA1 (–196/–73), SAA1 mt C/EBPß RE, or SAA1 mt NF-{kappa}B RE M2 oligonucleotide was used as a probe. C1 complex formation was eliminated by the mutation of NF-{kappa}B RE, but only partly reduced by the mutation of C/EBPß RE. (E) Nuclear extracts of HepG2 cells stimulated with IL-1+6 were immunoprecipitated with the anti-STAT3 (C-20) antibody. Western blots of immunoprecipitates with anti-NF-{kappa}B p65 and anti-STAT3 antibodies were performed as shown. Endogeneous STAT3 interacted with NF-{kappa}B p65 following IL-1+6 treatment.

 
STAT3 acts on transcriptional activity of human SAA genes via the NF-{kappa}B RE-containing region after complex formation with NF-{kappa}B p65

To examine the possibility that STAT3 might act on the transcriptional activity of SAA through the C/EBPß and NF-{kappa}B RE-containing region, an expression vector for wt STAT3 was co-transfected with a pGL3-SAA1, pGL3-SAA1 C/EBPß RE deleted mutant ({Delta}C/EBPß RE), and a pGL3-SAA1 NF-{kappa}B RE deleted mutant ({Delta}NF-{kappa}B RE). As shown in Fig. 2C, the co-expression of wt STAT3 augmented the transcriptional activity of pGL3-SAA1 and pGL3-SAA1{Delta}C/EBPß RE almost threefold. However, co-expression of wt STAT3 did not enhance the transcriptional activity of pGL3-SAA1{Delta}NF-{kappa}B RE. These results suggest that STAT3 is involved in the transcriptional activity of SAA, most likely through NF-{kappa}B RE. Competitive binding of STAT3 and NF-{kappa}B has been found in rat {gamma} fibrinogen (Zhang & Fuller 2000) and {alpha}2-macroglobulin gene promoters (Zhang & Fuller 1997; Bode et al. 2001). In the case of rat {gamma} fibrinogen, the CTGGGAATCCC sequence is responsible for transactivation by both STAT3 and NF-{kappa}B. In fact, Zhang and Fuller (2000) reported that TCC was necessary for NF-{kappa}B binding and that the CTGGGAA sequence was needed for STAT3 binding because of the loss of transcriptional activity in an AGATCTATCCC mutant. These findings led us to examine whether STAT3 binds to the CAGGGACTTTCCC sequence of NF-{kappa}B RE on the SAA1 promoter region. For this purpose, we created two mutated constructs, pGL3-SAA1 NF-{kappa}B RE M1 (AGATCTATTTCCC) and M2 (CAGGGACTTGTAC), which were mutated upstream and downstream of the NF-{kappa}B RE. We expected that STAT3 would bind to NF-{kappa}B RE M2, but not NF-{kappa}B RE M1. However, transfection with NF-{kappa}B RE M1, as well as M2, did not result in transcriptional activity even when wt STAT3 was co-expressed (Fig. 2C). These results suggest that STAT3 does not bind to NF-{kappa}B RE, which mediates the transcriptional activity of the human SAA1 gene.

To confirm the results from the luciferase assay using SAA1 mutated constructs, we performed EMSA using either mutated C/EBPß-wt NF-{kappa}B RE (SAA1 mt C/EBPß RE) or wt C/EBPß-mt NF-{kappa}B RE M2 probe (SAA1 mt NF-{kappa}B RE M2). Formation of the C1 complex by IL-1 or IL-1+6 was diminished using the SAA1 mt C/EBPß RE probe. In the case of the SAA1 mt NF-{kappa}B RE probe, a small complex consisting of C/EBPß remained (data not shown), but the C1 complex by IL-1 or IL-1+6 was completely eliminated (Fig. 2D). These results are consistent with those obtained with deletion mutants of the SAA promoter as shown in Figs 1B and 2C, and suggest that NF-{kappa}B RE is essential for the formation of the transcriptional complex containing STAT3 and for the augmentation of transcriptional activity.

We assumed that STAT3 forms a complex with NF-{kappa}B and contributes to the transcriptional augmentation of the human SAA gene. To examine our hypothesis, we performed immunoprecipitation-Western blot analysis (IP-Western) of STAT3 and NF-{kappa}B. Nuclear extracts of HepG2 cells were immunoprecipitated with anti-STAT3 (C20) antibody, and the immunoprecipitates were blotted against NF-{kappa}B p65 and p50. Figure 2E clearly shows that STAT3 is associated with NF-{kappa}B p65 following IL-1+6 treatment. However, no specific band of NF-{kappa}B p50 was detected when a specific antibody for the NF-{kappa}B p50 subunit was used (data not shown). A specific band of NF-{kappa}B p65 was weakly expressed by immunoprecipitates with anti-STAT3 (C20) antibody following stimulation with IL-1, but not IL-6 (data not shown). These findings are consistent with those reported by Betts et al. (1993) that over-expression of NF-{kappa}B p65, but not p50, enhanced the transcriptional activity of human SAA2 in a dose-dependent manner, and indicating that cross talk between STAT3 and NF-{kappa}B p65 contributes to the transcriptional augmentation of SAA by IL-1+6 stimulation.

STAT3 forms transcriptional complex with NF-{kappa}B p65 and p300 on SAA promoter region

The question remained as to how STAT3 contributes to the formation of the C1 complex comprising NF-{kappa}B, C/EBPß, and STAT3. The CREB-binding protein (CBP)/p300 family of transcriptional co-activators interacts with STAT1, 2, and 5 (Bhattacharya et al. 1996; Zhang et al. 1996b; Horvai et al. 1997), while STAT3 is reportedly associated with p300 (Nakashima et al. 1999; Paulson et al. 1999). This indicates the possibility that heteromeric complex formation of STAT3, NF-{kappa}B p65, and p300 is involved in the transcriptional activity of human SAA gene. We therefore used IP-Western to investigate whether endogenous STAT3 interacts with p300 in HepG2 cells following IL-1+6 treatment. A specific band corresponding to p300 was detected with the anti-p300 antibody from the nuclear extracts of HepG2 cells immunoprecipitated with the anti-STAT3 (C20) antibody (data not shown). These results indicated the possibility that the heteromeric complex containing STAT3 and p300 was involved in transcriptional activity of the human SAA gene. We therefore performed a luciferase assay using pGL3-SAA1 (–226/+24) co-transfected with p300 wt in pCMVß (wt p300) and wt STAT3, and found that co-expression of wt p300 alone did not augment the luciferase activity of pGL3-SAA1 (–226/+24), but that co-expression of wt p300 with wt STAT3 dramatically enhanced the luciferase activity in a dose-dependent manner (Fig. 3A). It has been reported that the STAT3 carboxyl terminus is capable of recruiting p300/CBP (Paulson et al. 1999) and that Ser727 in the C-terminal region of STAT3 is required for transactivation by association with p300 (Schuringa et al. 2001). We next used the pEF-BOS STAT3 S727A mutant (STAT3 S727A) to examine whether the phosphorylated STAT3 Ser727 is involved in the transcriptional activity of the human SAA gene. STAT3 S727A alone and co-expression of wt p300 with STAT3 S727A did not augment the luciferase activity of pGL3-SAA1 (–226/+24) to the same degree as that realized with wt STAT3 (Fig. 3B). These results suggest that STAT3 interacts with p300 in the transcriptional activity of the human SAA gene. To confirm that STAT3 forms a transcriptional complex with NF-{kappa}B p65 and p300 on the SAA promoter region, we performed a chromatin immunoprecipitation (ChIP) assay using chromatin isolated from HepG2 cells. STAT3 and p300 were evidently recruited to the SAA1 promoter region (–226/+24) in response to IL-6 or IL-1+6 and weakly recruited by IL-1. NF-{kappa}B p65 was recruited by IL-1 or IL-1+6 and slightly recruited by IL-6 (Fig. 3C). These results clearly demonstrate that STAT3 forms a transcriptional complex with NF-{kappa}B p65 and p300 on the SAA promoter region.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3  Formation of a transcriptional complex of STAT3 with NF-{kappa}B p65 and p300 on the SAA promoter region. (A) HepG2 cells were transfected with pGL3-SAA1 (–226/+24) (0.5 µg), 0.25 µg of p300 wt in pCMVß (wt p300), and/or 0.25–0.5 µg of pEF-BOS wt STAT3 (wt STAT3). IL-1+6 stimulation was performed for 3 h. Relative luciferase activity is expressed as the means + SD of triplicate cultures and transfections. (B) HepG2 cells were transfected with pGL3-SAA1 (–226/+24) (0.5 µg), wt p300 (0.25 µg), and/or 0.5 µg of pEF-BOS STAT3 S727A (STAT3 S727A) or 0.5 µg of wt STAT3. IL-1+6 stimulation was performed for 3 h. (C) ChIP assays demonstrate recruitment pattern of STAT3, NF-{kappa}B p65, and p300 on the SAA1 promoter (–226/+24) from HepG2 cells treated with IL-6 (10 ng/mL) and/or IL-1ß (0.1 ng/mL) for 30 min. Assays were performed by using anti-STAT3 (C20), anti-NF-{kappa}B p65, anti-p300, or anti-AcH3 antibody. Anti-AcH3 antibody was used as a positive control for this assay. Chromatin immunoprecipitates were analyzed for the SAA1 promoter (–226/+24) and ß-actin.

 
STAT3 interacts with 3' site of NF-{kappa}B RE on human SAA promoter via a newly discovered cis-acting mechanism

Since no typical STAT3 RE seems to be located in the promoter region of the human SAA gene, it is likely that STAT3 either binds to the promoter region of the SAA gene indirectly or obtains binding affinity for an unknown DNA sequence in a complex with NF-{kappa}B p65. To clarify whether STAT3 binds to the promoter region directly or indirectly, we performed DNA affinity chromatography using an SAA1 oligonucleotide (–196/–73) probe (wt SAA1 probe). Nuclear extracts from HepG2 cells were incubated with a biotinylated wt SAA1 probe. Proteins specifically interacting with DNA fragments were collected with the aid of streptavidin dynabeads with a magnet, and transcriptional factors were analyzed by Western blotting (Suzuki et al. 1993). GAS sequences and an NF-{kappa}B decoy were used as positive controls for STAT3 and NF-{kappa}B p65, respectively. As shown in Fig. 4A, STAT3 bound to the GAS sequence after IL-6 or IL-1+6 stimulation, and specific bands of NF-{kappa}B p65 were identified with the NF-{kappa}B decoy after IL-1 or IL-1+6 stimulation. This finding ascertained the specificity of the DNA affinity chromatography system. In the same assay, specific bands for NF-{kappa}B p65 and STAT3 were both pulled down by the wt SAA1 probe from the nuclear extracts of HepG2 cells after IL-1+6 stimulation, suggesting that STAT3 acts on the SAA promoter via a cis-acting mechanism. However, since STAT3 binds to the wt SAA1 probe after IL-6 stimulation even in the presence of small amounts of NF-{kappa}B p65, it is therefore reasonable to assume that STAT3 binds directly to the wt SAA1 probe. To explain these phenomena, a new cis-acting mechanism of STAT3 had to be postulated. We next used the SAA1 mt NF-{kappa}B RE M2 probe, which has no binding affinity to NF-{kappa}B p65, to examine the possibility that NF-{kappa}B p65 has an effect on the binding affinity of STAT3 to the SAA1 promoter region. As shown in Fig. 4B, neither NF-{kappa}B p65 nor STAT3 was detected by the probe, indicating that the interaction between STAT3 and NF-{kappa}B p65 is essential for the binding affinity of STAT3 to the wt SAA1 probe. Moreover, these results were consistent with the previous results obtained with the luciferase assay (Fig. 2C) or with EMSA (Fig. 2D). Consequently, it is reasonable to assume that the formation of the heteromeric complex of STAT3 and NF-{kappa}B p65 gives STAT3 binding affinity to the SAA1 promoter region. On the basis of our results and those obtained with rat {gamma} fibrinogen (Zhang & Fuller 2000), we focused our attention on the 3' site of NF-{kappa}B RE (CAGGGACTTTCCCCAGGGAC) as a candidate of STAT3 binding site, because sequences contiguous to NF-{kappa}B RE might have influenced the binding affinity of STAT3. Moreover, the CTGGGAA sequence is needed for STAT3 in the case of rat {gamma} fibrinogen (Zhang & Fuller 2000). On the assumption that mutation of this site could influence the binding affinity of STAT3, but not NF-{kappa}B p65, we created a SAA1 mt NF-{kappa}B RE M3 probe (CAGGGACTTTCCCAGATCTA). As expected, the specific bands of STAT3 from the nuclear extracts of HepG2 cells after IL-1+6 stimulation were markedly reduced by the SAA1 mt NF-{kappa}B RE M3 probe compared to the effect obtained with the wild-type SAA1 probe, although the specific bands of NF-{kappa}B p65 were observed almost as intact as with the wild type (Fig. 4C). The same results were obtained from the nuclear extract after IL-6 stimulation (data not shown). In fact, using pGL3-SAA1 (–226/+24) NF-{kappa}B RE M3 reduced the augmentation of STAT3 and p300 on the transcriptional activity of SAA as compared to when pGL3-SAA1 (–226/+24) was used (Fig. 4D). These results support our assumption that binding affinity of STAT3 for the human SAA promoter region is the result of the formation of a heteromeric complex comprising STAT3 and NF-{kappa}B p65. To verify this supposition, we performed a luciferase assay using the pCMV-I{kappa}B{alpha}M vector, which can block NF-{kappa}B signaling and eliminate the low-level activation of NF-{kappa}B produced from fetal bovine serum. We observed that pCMV-I{kappa}B{alpha}M eliminated the augmentation of wt STAT3 on pGL3-SAA1 (–796/+24) following IL-1+6 stimulation (Fig. 4E). The same results were obtained for IL-6 stimulation (data not shown), indicating that a small amount of NF-{kappa}B p65, activated by an in vitro culture containing fetal bovine serum, can form the heteromeric complex of STAT3 and NF-{kappa}B p65 after STAT3 has been activated by IL-6. This is thought to be the reason why STAT3 was detected in the nuclear extracts stimulated by IL-6.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 4  Interaction of STAT3 with a 3' site of NF-{kappa}B RE on the human SAA promoter by means of a newly discovered cis-acting mechanism. (A) The SAA1 (–196/–73) probe interacts with both STAT3 and NF-{kappa}B p65 from the nuclear extracts after IL-1+6 stimulation. DNA affinity chromatography was performed with 200 µg of the nuclear extracts from HepG2 cells after cytokine stimulation. The nuclear extracts were mixed with 1 µg of biotinylated DNA probe, and 50 µL of streptavidin dynabeads was added to and mixed with the samples and collected with a magnet. The trapped proteins were then analyzed by Western blotting. The GAS probe and the NF-{kappa}B decoy were used as the respective positive controls for STAT3 and NF-{kappa}B p65. (B) The SAA1 (–196/–73) mt NF-{kappa}B RE M2 probe loses its ability to interact with both STAT3 and NF-{kappa}B p65. (C) The SAA1 (–196/–73) mt NF-{kappa}B RE M3 probe maintains its binding affinity for NF-{kappa}B p65, but not STAT3. (D) HepG2 cells were transfected with 0.5 µg of pGL3-SAA1 (–226/+24) or pGL3-SAA1 (–226/+24) NF-{kappa}B RE M3 (0.5 µg), 0.5 µg of pEF-BOS wt STAT3 (wt STAT3), and/or 0.25 µg of p300 wt in pCMVß (wt p300). IL-1+6 stimulation was performed for 3 h. Relative luciferase activity is expressed as the means + SD of triplicate cultures and transfections. The augmentatory effects of STAT3 and p300 on the transcriptional activity of SAA were reduced with the mutation of NF-{kappa}B RE M3. (E) Luciferase assay used 0.5 µg of pGL3-SAA1 (–796/+24) co-transfected with 0.5 µg of pCMV-I{kappa}B{alpha}M (I{kappa}B{alpha}M) and/or 0.5 µg of wt STAT3. I{kappa}B{alpha}M eliminated the augmentatory effect of wt STAT3 on the transcriptional activity of SAA by IL-1+6 stimulation

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
SAA is a major acute-phase protein and a sensitive marker of acute-phase responses. The SAA level is closely related to the activity of chronic inflammatory diseases (Gillmore et al. 2001) and was recently found to be a predictor of coronary artery disease as well as a highly sensitive CRP (Johnson et al. 2004). Betts et al. (1993) reported that the synergistic induction of SAA2 is regulated by NF-{kappa}B and C/EBPß in the stimulation of IL-1+6. However, this induction model of SAA does not fully explain the clinical results of anti-IL-6 receptor antibody therapy for RA patients (Nishimoto et al. 2004) and the findings in the liver of STAT3 conditional mutant mice (Alonzi et al. 2001). Moreover, no typical consensus sequence of STAT3 has been observed in the promoter region of SAA genes. The aim of our study was to clarify the exact induction mechanism of SAA from the clinical point of view. We were able to demonstrate that STAT3 acts on the human SAA promoter via a newly discovered cis-acting mechanism, that is, the formation of a heteromeric complex containing STAT3, NF-{kappa}B p65, and p300 at a 3' site of the NF-{kappa}B RE. We also presented a schematic model to explain the synergistic induction of human SAA gene by IL-1+6 stimulation (Fig. 5). Next, we will discuss some of our experimental results to confirm the validity of this schematic model.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5  Working model for cytokine-driven transcriptional activity of human SAA gene. Cytokine stimulation caused the formation around NF-{kappa}B RE of a heteromeric complex with STAT3 and NF-{kappa}B p65. STAT3, which is assumed to interact with the 3' site of NF-{kappa}B RE, recruits the co-activator p300, which may then coordinate the interaction of NF-{kappa}B p65, STAT3, and C/EBPß, thus resulting in the augmentation of transcriptional activity of human SAA gene.

 
IL-6 enhanced the transcriptional activity of pGL3-SAA1 and pGL3-SAA2 (Fig. 1A), but induced the C1 complex only slightly (Fig. 2A). On the other hand, IL-1 augmented transcriptional activity of pGL3-SAA1 and pGL3-SAA2 only a little (Fig. 1A), but induced the C1 complex (Fig. 2A). Although these results seem to be contradictory, experimental results lead us to propose the following plausible explanations. The first is that the amount of NF-{kappa}B p65 in the nucleus determines the formation of the C1 complex, and the second is that phosphorylation of STAT3 is required for the full transcriptional activation of the SAA gene. This accounts for the fact that IL-1 markedly induces nuclear translocation of NF-{kappa}B p65, whereas STAT3 is only slightly phosphorylated by IL-1. On the other hand, a little nuclear translocation of NF-{kappa}B p65 is induced by fetal bovine serum in the treatment with IL-6, but IL-6 dramatically induces the phosphorylation of STAT3. Putting these findings together suggests that the synergistic expression of SAA in response to IL-1+6 is induced by the combination of nuclear translocation of NF-{kappa}B p65 and the phosphorylation of STAT3. Although the significance of the C2 complex remains unclear, the complex itself is composed of at least NF-{kappa}B p50. It is reported that the NF-{kappa}B p50 homodimer forms a complex with HDAC1, which can bind to DNA and repress transcription (Zhong et al. 2002). In fact, overexpression of NF-{kappa}B p50 did not enhance the transcriptional activity of human SAA2 (Betts et al. 1993). This indicates that further study is needed to clarify how NF-{kappa}B p50 contributes to the expression of the SAA gene.

We confirmed, by using the super shift assay, ChIP assay, and DNA affinity choromatography assay systems, that STAT3 contributes to the transcriptional activation of SAA via a cis-acting mechanism. We were also able to demonstrate that the phosphorylation of STAT3 Tyr705 and Ser727 is important for the transcriptional activation of SAA.

While it is known that the phosphorylation of STAT3 Tyr705 is required for the nuclear translocation of STAT3, the question remains how the phosphorylation of STAT3 Ser727 is involved in the induction of SAA genes. It has been proposed that the phosphorylation of STAT3 Ser727 is needed for the maximal activation of transcription, but not for the DNA-binding activity (Wen et al. 1995; Wen & Darnell 1997). In addition, it has been found that the STAT3 C-terminus is capable of recruiting CBP/p300 (Paulson et al. 1999) and the phosphorylation of STAT3 Ser727 is required for an association with p300 (Schuringa et al. 2001). Our results show that phosphorylated STAT3 Ser727 is needed for the full activation of the SAA gene for an association with p300. It is thus reasonable to postulate that the phosphorylated STAT3 Ser727 contributes to the formation of the transcriptional complex. However, the question remains whether antiphospho-STAT3 Ser727 monoclonal antibody inhibited the formation of the C1 complex in the super shift assay because, unlike STAT3 Y705F, STAT3 S727A did not eliminate the transactivation of SAA.

In the study reported here, we provide the first direct evidence that the interaction of STAT3 and NF-{kappa}B p65 contributes to the synergistic induction mechanism of the acute-phase response. The competitive binding of STAT3 and NF-{kappa}B has been cited as an inhibitory mechanism in the rat {gamma} fibrinogen (Zhang & Fuller 2000) and {alpha}2-macroglobulin gene promoters (Zhang & Fuller 1997; Bode et al. 2001). Furthermore, STAT3 reportedly forms a complex with NF-{kappa}B p65 in the GAS/{kappa}B sequence, which is derived from the rat {alpha}2-macroglobulin and contains the overlapping binding site of STAT3 and NF-{kappa}B. This suggests that asymmetric cross talk between STAT3 and NF-{kappa}B p65 can explain the inhibitory effect of IL-1 on IL-6 activity during the acute-phase response (Yoshida et al. 2004). The question has been raised why the interaction of STAT3 and NF-{kappa}B p65 leads to two opposite effects, synergistic and inhibitory. We assumed that these opposite roles may be determined by the adjacent sequence of NF-{kappa}B or STAT3 RE, which seems to be of little importance in the transcriptional activation. In fact, we were able to obtain, with the aid of a DNA affinity chromatography assay, direct evidence that STAT3 is present in the promoter of the SAA gene. In this assay, we found that the nonconsensus sequence at a 3' site of the NF-{kappa}B RE interacts with STAT3 when STAT3 forms a complex with NF-{kappa}B p65. The luciferase activity of pGL3-SAA1 (–226/+24) NF-{kappa}B RE M3 then co-transfected with wt STAT3 and wt p300 was reduced.

STAT3 has been reported to form a complex with the CRE-binding protein in the jun B gene (Kojima et al. 1996), or with c-Jun for the {alpha}2-macrogloblin APRE (Schaefer et al. 1995). Other findings suggest that STAT3 has an effect on CRE-like sites in the C/EBPß promoter (Niehof et al. 2001) or glucocorticoid RE (Zhang et al. 1997) without the presence of the classical GAS sequence. These reported findings together support the validity of our finding of a discovered cis-acting mechanism of STAT3.

However, a limitation of our study is that we were not able to show in detail how STAT3 binds to NF-{kappa}B p65, specifically whether STAT3 binds to NF-{kappa}B p65 directly or indirectly. The inhibitory effect of the mutation of NF-{kappa}B RE M3 is much smaller than that of NF-{kappa}B RE M1 and M2 in the transcriptional activation of SAA gene. This would lead to the assumption that STAT3 binds directly to NF-{kappa}B p65, which is inconsistent with the results of the DNA affinity chromatography assay. This means that another factor must contribute to the formation of the complex with STAT3 and NF-{kappa}B p65. In addition, we could not determine which domain of STAT3 is critical for the binding to NF-{kappa}B p65. The crystal structure of the heterodimer of NF-{kappa}B p65/P50 or the homodimer of STAT3 ß bound to DNA has been described elsewhere (Becker et al. 1998; Chen et al. 1998), but further study is needed to clarify the three-dimensional structure of the heteromeric complex containing STAT3 and NF-{kappa}B p65 bound to the SAA gene promoter.

Another important thing is that SAA is the precursor of amyloid A protein in AA amyloidosis. From the clinical point of view, two important findings should be mentioned in this connection. The first is that humanized anti-IL-6 receptor antibody therapy normalizes serum levels of SAA and improves the clinical symptoms of AA amyloidosis in some patients with Castleman disease (Nishimoto et al. 2000). Second, Gillmore et al. (2001) reported that normalization of the serum SAA level can lead to amyloid regression in patients with AA amyloidosis. Our findings in this context therefore constitute an aid for the development of a new therapeutic strategy for AA amyloidosis by using normalization of the serum SAA level.

In summary, we have been able to demonstrate that STAT3 plays an essential role in the synergistic induction of SAA by IL-1+6 stimulation. STAT3 forms a complex with NF-{kappa}B p65 following IL-1+6 stimulation, after which STAT3 interacts with nonconsensus sequences at a 3' site of the NF-{kappa}B RE of the SAA gene promoter. The formation of a complex with STAT3, NF-{kappa}B p65, and p300 is thus essential for the synergistic induction of the SAA gene by IL-1+6 stimulation. Our results further suggest that the SAA level is affected by the intensity of the interaction between STAT3 and NF-{kappa}B p65, a finding that is expected to aid understanding of inflammatory status. NF-{kappa}B is a key regulator of pro-inflammatory cytokines, matrix metalloproteinases, inducible nitric oxide synthase, cyclooxygenase 2, and other pro-inflammatory genes (Li & Verma 2002). The interaction between STAT3 and NF-{kappa}B p65 may thus contribute to the expression of these pro-inflammatory genes.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Reagents and cell culture

Recombinant human IL-6 was provided by Ajinomoto (Tokyo, Japan) and used at a final concentration of 10 ng/mL, whereas recombinant human IL-1ß was purchased from Biosource International (Camarillo, CA) and used at 0.1 ng/mL. HepG2 cells were obtained from Dainihon Pharmaceutical Co. (Tokyo, Japan) and grown in Dulbecco's Modified Eagle's Medium supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-Glutamine, and 50 U/mL penicillin–streptomycin.

Plasmids construction

The 796-bp upstream region of human SAA1 and 24 bp of exon1 were amplified by PCR with the MluI and XhoI restriction sites introduced at the 5' and 3' ends, respectively, 5' primer: 5'-TCGACGCGTTCTAGACTGAGGGTGAAGGA; 3' primer: 5'-CCGCTCGAGTGTAGCTGAGCTGCGGGTCC. The PCR product was then inserted into a pGL3-Basic vector (Promega, Madison, WI). 5' deletion mutants pGL3-SAA1 (–526/+24, –226/+24, –156/+24, –76/+24) were generated with the same method, as were the upstream sequences of human SAA2 (–816/+20) and 5' deletion mutants (–496/+20, –246/+20, –146/+20, –76/+20). C/EBPß RE (–188/–175) and NF-{kappa}B RE (–95/–85) of the pGL3-SAA1 (–796/+24) were deleted or mutated with the Quick Change Site-Directed Mutagenesis Kit (Stratagene, Birmingham, AL) according to the manufacturer's instructions. pEF-BOS wt STAT3 and pEF-BOS dn STAT3 Y705F were kindly provided by Dr Shizuo Akira (Research Institute for Microbial Diseases, Osaka University). pEF-BOS STAT3 S727A (STAT3 S727A) was mutated with the Quick Change Site-Directed Mutagenesis Kit. p300 wt in pCMVß was purchased from Upstate Biotechnology (Lake Placid, NY) and pCMV-I{kappa}B{alpha}M from Clontech (San Diego, CA).

Transfection and luciferase assay

HepG2 cells were seeded at 2 x 0.5 x 105 cells/well in 6-well plates, and after 24 h the cells were transfected with 1 µg of plasmid DNA by using Fugene 6 (Roche Molecular Biochemicals, Indianapolis, IN) and following the manufacturer's instructions. The cells were stimulated with various combinations of cytokines 48 h after transfection, lysed in passive lysate buffer and assayed with the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's specifications. Luciferase activity was normalized with the activity of renilla luciferase. Assays were conducted in triplicate, and the experiments were repeated at least three times.

Nuclear extracts and electromobility shift assays

Nuclear extracts were prepared from HepG2 cells as previously described (Youqi & Brasie 1997), after which the supernatant was subjected to dialysis with Akira et al.'s method (1994). Briefly, binding reactions used 10 µg of nuclear extracts in 10 mM Tris-Cl (pH 7.5), 1 mM EDTA, 4% glycerol, 5 mM dithiothreitol, 100 mM NaCl, 100 ng/µL bovine serum albumin, and 600 ng/µL poly (dI-dC), with the addition of 5 fmol of 5'-biotin end-labeled oligonucleotide, for a final volume of 20 µL. After incubation at 25 °C for 30 min, the complexes were detected with a LightShiftTM Chemiluminescent EMSA kit (Pierce Biotechnology, Rockford, IL). SAA1 oligonucleotides (–196/–73) were obtained with the PCR technique, and pGL3-SAA1 (–796/+24) was used as a template. The SAA1 (–196/–73) mt C/EBPß RE probe (mt C/EBPß-wt NF-{kappa}B RE) or SAA1 (–196/–73) mt NF-{kappa}B RE probe (wt C/EBPß-mt NF-{kappa}B RE) was created using the same method. For the super shift assay, antibodies against NF-{kappa}B p65, C/EBPß (Santa Cruz Biotechnology Inc, Santa Cruz, CA), STAT3 (Santa Cruz), and Phospho-STAT3 Ser727 (6E4, Cell Signaling Technology, Beverly, MA) were added to the reaction mixture prior to the addition of the 5'-biotin end-labeled oligonucleotides. The SAA1 (–196/–73) mt C/EBPß RE probe was mutated to 5'-AGGCTGCACACCTG-3' as previously described (Betts et al. 1993).

Immunoprecipitation and Western blot analysis

Nuclear extracts (200–300 µg) obtained 30 min after cytokine stimulation were mixed with antibodies overnight at 4 °C. Immunocomplexes were precipitated with Protein-A Sepharose beads (Amersham Pharmacia Biotech, Amersham, UK), and washed four times with lysis buffer. All precipitated proteins were resolved by 6–7.5% SDS-PAGE followed by Western blot analysis. We used the following antibodies: anti-STAT3 (C20) (Santa Cruz), anti-phospho-STAT3 Y705 (Cell Signaling Technology), anti-NF-{kappa}B p65 (Upstate Biotechnology), anti-NF-{kappa}B p50 (Santa Cruz), and anti-p300 antibody (Upstate Biotechnology).

DNA affinity chromatography

Nuclear extracts (200 µg) were mixed with the biotinylated oligonucleotide probe (1 µg) at 25 °C for 30 min under the same buffer conditions as for the EMSA. Fifty microliters of streptavidin-Dynabeads (Dynal, Great Neck, NY) were mixed in by rotation for 30 min (Suzuki et al. 1993). The Dynabeads were then collected with a magnet and washed three times with the buffer. The trapped proteins were analyzed by Western blotting in the same manner as previously described.

Oligonucleotide probes consisted of the GAS sequence: 5'-CATTTCCCGTAAATC-3' (Ward et al. 1999), the NF-{kappa}B decoy: 5'-CCTTGAAGGGATTTCCCTCC-3' (Tomita et al. 1999), the SAA1 (–196/–73) wt NF-{kappa}B RE probe: 5'-CAGGGACTTTCCCCAGGGAC-3', the SAA1 (–196/–73) mt NF-{kappa}B RE M1 probe: 5'-AGATCTATTTCCCCAGGGAC-3', the SAA1 (–196/–73) mt NF-{kappa}B RE M2 probe: 5'-CAGGGACTTGTACCAGGGAC-3', and the SAA1 (–196/–73) mt NF-{kappa}B RE M3 probe: 5'-CAGGGACTTTCCCAGATCTA-3'.

Chromatin immunoprecipitation (ChIP) assay

Chromatin IP was performed essentially as described elsewhere (Agata et al. 2001) with minor modifications. HepG2 cells were fixed in 1% formaldehyde for 10 min at room temperature. Cells were washed two times with FACS solution buffer (PBS, 2% FCS 0.05% NaN3) and sucrose density-purified nuclear pellets were obtained as previously described (Youqi & Brasie 1997). Nuclear pellets were resuspended in 0.8 mL of lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.0, protease inhibitor cocktail; Roche) and sonicated five times for 10 s. Immunoprecipitation was performed overnight at 4 °C with specific antibodies and a negative control without antibody was also processed. We used the following antibodies: anti-STAT3 (C20) (Santa Cruz), anti-NF-{kappa}B p65 (Santa Cruz), anti-p300 (Santa Cruz), and anti-acetylated histone H3 antibody (Upstate Biotechnology). Immunoprecipitates were recovered with 20 µL of 50% protein G-Sepharose/salmon sperm DNA for 3 h and washed with the buffer as described elsewhere (Agata et al. 2001). DNA was purified using classical procedures and 1 µL from a 20 µL DNA extraction was amplified for 25–30 cycles of 94 °C for 30 s, 55 °C (ß-actin 60 °C) for 60 s, 72 °C for 2 min. The primers used were –226/+24 of the SAA1 promoter 5'-TCCTGCCCTGACAGCTGCCA, 3'-TGTAGCTGAGCTGCGGGTCC and ß-actin 5'-TGCCTAGGTCACCCACTAATG 3'-GTGGCCCGTGATGAAGGCTA (Hough et al. 2005).


    Acknowledgements
 
We wish to thank Dr Toshio Hirano for his helpful discussion and comments on the manuscript and Dr Shizuo Akira for providing the plasmids. We also appreciate the skillful secretarial assistance by Mss A. Okajima and K. Umetani. This study was supported by the Ministry of Education, Culture, Sports, Science and Technology of Japan, the Ministry of Health, Labor and Welfare of Japan, and the Osaka Foundation for Promotion of Clinical Immunology.


    Footnotes
 
Communicated by: Shigeo Koyasu

* Correspondence: E-mail: kyoshizaki{at}hpc.cmc.osaka-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Agata, Y., Katakai, T., Ye, S.K., et al. (2001) Histone acetylation determines the developmentally regulated accessibility for T cell receptor gamma gene recombination. J. Exp. Med. 193, 873–880.[Abstract/Free Full Text]

Akira, S., Nishio, Y., Inoue, M., et al. (1994) Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell 77, 63–71.[CrossRef][Medline]

Alonzi, T., Maritano, D., Gorgoni, B., et al. (2001) Essential role of STAT3 in the control of acute-phase response as revealed by inducible gene activation in the liver. Mol. Cell. Biol. 21, 1621–1632.[Abstract/Free Full Text]

Becker, S., Groner, B. & Muller, C.W. (1998) Three-dimensional structure of the Stat3ß homodimer bound to DNA. Nature 394, 145–151.[CrossRef][Medline]

Betts, J.C., Cheshire, J.K., Akira, S., Kishimoto, T. & Woo, P. (1993) The role of NF-{kappa}B and NF-IL6 transactivating factors in the synergistic activation of human serum amyloid A gene expression by interleukin-1 and interleukin-6. J. Biol. Chem. 268, 25624–25631.[Abstract/Free Full Text]

Bhattacharya, S., Eckner, R., Grossman, S., et al. (1996) Cooperation of Stat2 and p300/CBP in signalling induced by interferon-{alpha}. Nature 383, 344–347.[CrossRef][Medline]

Bode, J.G., Fischer, R., Haussinger, D., et al. (2001) The inhibitory effect of IL-1ß on IL-6-induced {alpha}2-macroglobulin expression is due to activation of NF-{kappa}B. J. Immunol. 167, 1469–1481.[Abstract/Free Full Text]

Chen, F.E., Huang, D.B., Chen, Y.Q. & Ghosh, G. (1998) Crystal structure of p50/p65 heterodimer of transcription factor NF-{kappa}B bound to DNA. Nature 391, 410–413.[CrossRef][Medline]

Feldmann, M., Bennan, F.B. & Maini, R.N. (1996) Role of cytokines in rheumatoid arthritis. Annu. Rev. Immunol. 14, 397–440.[CrossRef][Medline]

Gillmore, J.D., Laurence, B.L., Persey, M.R., Pepys, M.B. & Hawkins, P.N. (2001) Amyloid load and clinical outcome in AA amyloidosis in relation to circulating concentration of serum amyloid A protein. Lancet 358, 24–29.[CrossRef][Medline]

Hagihara, K., Nishikawa, T., Isobe, T., et al. (2003) IL-6 plays a critical role in the synergistic induction of human serum amyloid A (SAA) gene when stimulated with proinflammatory cytokines as analyzed with an SAA isoform real-time quantitative RT-PCR assay system. Biochem. Biophys. Res. Commun. 314, 363–369.

He, R., Sang, H. & Ye, R.D. (2003) Serum amyloid A induces IL-8 secretion through a G protein-coupled receptor, FPRL1/LXA4R. Blood 101, 1572–1581.[Abstract/Free Full Text]

Horvai, A.E., Xu, L., Korzus, E., et al. (1997) Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc. Natl. Acad. Sci. USA 94, 1074–1079.[Abstract/Free Full Text]

Hough, C., Cuthbert, C.D., Notley, C., et al. (2005) Cell type-specific regulation of von Willebrand factor expression by the E4BP4 transcriptional repressor. Blood 105, 1531–1539.[Abstract/Free Full Text]

Johnson, B.D., Kip, K.E., Marroquin, O.C., et al. (2004) Serum amyloid A as a predictor of coronary artery disease and cardiovascular outcome in women. Circulation 109, 726–732.[Abstract/Free Full Text]

Kojima, H., Nakajima, K. & Hirano, T. (1996) IL-6-inducible complexes on an IL-6 response element of the junB promoter contain Stat3 and 36 kDa CRE-like site binding protein(s). Oncogene 12, 547–554.[Medline]

Li, Q. & Verma, I.M. (2002) NF-{kappa}B regulation in the immune system. Nat. Rev. Immunol. 2, 725–734.[CrossRef][Medline]

Maini, R.N. & Taylor, P.C. (2000) Anti-cytokine therapy for rheumatoid arthritis. Annu. Rev. Med. 51, 207–229.[CrossRef][Medline]

Nakashima, K., Yanagisawa, M., Arakawa, H., et al. (1999) Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 284, 479–482.[Abstract/Free Full Text]

Niehof, M., Streetz, K., Rakemann, T., et al. (2001) Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPß promoter suggests a new mechanism of transcriptional regulation by STAT3. J. Biol. Chem. 276, 9016–9027.[Abstract/Free Full Text]

Nishimoto, N., Sasai, M., Shima, Y., et al. (2000) Improvement in Castleman's disease by humanized anti-interleukin-6 receptor antibody therapy. Blood 99, 56–61.

Nishimoto, N., Yoshizaki, K., Miyasaka, N., et al. (2004) Treatment of rheumatoid arthritis with humanized anti-interleukin-6 receptor antibody: a multicenter, double-blind, placebo-controlled trial. Arthritis Rheum. 50, 1761–1769.[CrossRef][Medline]

Paulson, M., Pisharody, S., Pan, L., et al. (1999) Stat protein transactivation domains recruit p300/CBP through widely divergent sequences. J. Biol. Chem. 274, 25343–25349.[Abstract/Free Full Text]

Ray, A., Hannink, M. & Ray, B.K. (1995) Concerted participation of NF-{kappa}B and C/EBP heteromer in lipopolysaccharide induction of serum amyloid A gene expression in liver. J. Biol. Chem. 270, 7365–7374.[Abstract/Free Full Text]

Schaefer, T.S., Sanders, L.K. & Nathans, D. (1995) Cooperative transcriptional activity of Jun and Stat3 ß, a short form of Stat3. Proc. Natl. Acad. Sci. USA 92, 9097–9101.[Abstract/Free Full Text]

Schuringa, J.J., Schepers, H., Vellenga, E. & Kruijer, W. (2001) Ser727-dependent transcriptional activation by association of p300 with STAT3 upon IL-6 stimulation. FEBS Lett. 495, 71–76.[CrossRef][Medline]

Seidel, H.M., Milocco, L.H., Lamb, P., et al. (1995) Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc. Natl. Acad. Sci. USA 92, 3041–3045.[Abstract/Free Full Text]

Suzuki, T., Fujisawa, J.I., Toita, M. & Yoshida, M. (1993) The trans-activator tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proc. Natl. Acad. Sci. USA 90, 610–614.[Abstract/Free Full Text]

Thorn, C.F. & Whitehead, A.S. (2002) Differential glucocorticoid enhancement of the cytokine-driven transcriptional activation of the human acute phase serum amyloid A genes, SAA1 and SAA2. J. Immunol. 169, 399–406.[Abstract/Free Full Text]

Tomita, T., Takeuchi, E., Tomita, N., et al. (1999) Suppressed severity of collagen-induced arthritis by in vivo transfection of nuclear factor {kappa}B decoy oligodeoxynucleotides as a gene therapy. Arthritis Rheum. 42, 2532–2542.[CrossRef][Medline]

Uhlar, C.M. & Whitehead, A.S. (1999) Serum amyloid A, the major vertebrae acute-phase reactant. Eur. J. Biochem. 265, 501–523.[Medline]

Uhlar, C.M., Grehan, S., Steel, D.M., Steinkasserer, A. & Whitehead, A.S. (1997) Use of the acute phase serum amyloid A2 (SAA2) gene promoter in the analysis of pro- and anti-inflammatory mediators: differential kinetics of SAA2 promoter induction by IL-1 ß and TNF-{alpha} compared to IL-6. J. Immunol. Methods 203, 123–130.[CrossRef][Medline]

Urieli-Shoval, S., Shubinsky, G., Linke, R.P., et al. (2002) Adhesion of human platelets to serum amyloid A. Blood 95, 1224–1229.

Ward, A.C., Hermans, M.H., Smith, L., et al. (1999) Tyrosine-dependent and -independent mechanism of STAT3 activation by the human granulocyte colony-stimulating factor (G-CSF) receptor are differentially utilized depending on G-CSF concentration. Blood 93, 113–124.[Abstract/Free Full Text]

Wen, Z. & Darnell, J.E. Jr (1997) Mapping of Stat3 serine phosphorylation to a single residue (727) and evidence that serine phosphorylation has no influence on DNA binding of Stat1 and Stat3. Nucleic Acids Res. 25, 2062–2067.[Abstract/Free Full Text]

Wen, Z., Zhong, Z. & Darnell, J.E. Jr (1995) Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, 241–250.[CrossRef][Medline]

Yoshida, Y., Kumar, A., Koyama, Y., et al. (2004) Interleukin 1 activates STAT3/nuclear factor-{kappa}B cross-talk via a unique TRAF6- and p65-dependent mechanism. J. Biol. Chem. 279, 1768–1776.[Abstract/Free Full Text]

Youqi, H. & Brasie, A.R. (1997) Mechanism for biphasic rel A. NF-{kappa}B1 nuclear translocation in tumor necrosis factor {alpha}-stimulated hepatocytes. J. Biol. Chem. 272, 9825–9832.[Abstract/Free Full Text]

Zhang, Z. & Fuller, G.M. (1997) The competitive binding of STAT3 and NF-{kappa}B on an overlapping DNA binding site. Biochem. Biophys. Res. Commun. 237, 90–94.[CrossRef][Medline]

Zhang, Z. & Fuller, G.M. (2000) Interleukin 1ß inhibits interleukin 6-mediated rat {gamma} fibrinogen gene expression. Blood 96, 3466.[Abstract/Free Full Text]

Zhang, D., Sun, M., Samols, D. & Kushner, I. (1996a) STAT3 participates in transcriptional activation of the C-reactive protein gene by interleukin-6. J. Biol. Chem. 271, 9503–9509.[Abstract/Free Full Text]

Zhang, J.J., Vinkemeier, U., Gu, W., et al. (1996b) Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling. Proc. Natl. Acad. Sci. USA 93, 15092–15096.[Abstract/Free Full Text]

Zhang, Z., Jones, S., Hagood, J.S., Fuentes, N.L. & Fuller, G.M. (1997) STAT3 acts as a co-activator of glucocorticoid receptor signaling. J. Biol. Chem. 272, 30607–30610.[Abstract/Free Full Text]

Zhong, H., May, M.J., Jimi, E. & Ghoshi, S. (2002) The phosphorylation status of nuclear NF-{kappa}B determines its association with CBP/P300 or HDAC-1. Mol. Cell 9, 625–636.[CrossRef][Medline]

Received: 29 June 2005
Accepted: 1 August 2005




This article has been cited by other articles:


Home page
Ann Rheum DisHome page
S Nishida, K Hagihara, Y Shima, M Kawai, Y Kuwahara, J Arimitsu, T Hirano, M Narazaki, A Ogata, K Yoshizaki, et al.
Rapid improvement of AA amyloidosis with humanised anti-interleukin 6 receptor antibody treatment
Ann Rheum Dis, July 1, 2009; 68(7): 1235 - 1236.
[Full Text] [PDF]


Home page
Infect. Immun.Home page
L. J. Quinton, M. R. Jones, B. E. Robson, and J. P. Mizgerd
Mechanisms of the Hepatic Acute-Phase Response during Bacterial Pneumonia
Infect. Immun., June 1, 2009; 77(6): 2417 - 2426.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
B. Zhang, Y. Une, F. Ge, X. Fu, J. Qian, P. Zhang, J. Sawashita, K. Higuchi, and M. Mori
Characterization of the Cheetah Serum Amyloid A1 Gene: Critical Role and Functional Polymorphism of a Cis-Acting Element
J. Hered., March 28, 2008; (2008) esn015v1.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Nishikawa, K. Hagihara, S. Serada, T. Isobe, A. Matsumura, J. Song, T. Tanaka, I. Kawase, T. Naka, and K. Yoshizaki
Transcriptional Complex Formation of c-Fos, STAT3, and Hepatocyte NF-1{alpha} Is Essential for Cytokine-Driven C-Reactive Protein Gene Expression
J. Immunol., March 1, 2008; 180(5): 3492 - 3501.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Snyder, X.-Y. Huang, and J. J. Zhang
Identification of Novel Direct Stat3 Target Genes for Control of Growth and Differentiation
J. Biol. Chem., February 15, 2008; 283(7): 3791 - 3798.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hou, S. Ray, and A. R. Brasier
The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression
J. Biol. Chem., December 21, 2007; 282(51): 37091 - 37102.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Yang, X. Liao, M. K. Agarwal, L. Barnes, P. E. Auron, and G. R. Stark
Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NF{kappa}B
Genes & Dev., June 1, 2007; 21(11): 1396 - 1408.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Torisu, N. Sato, D. Yoshiga, T. Kobayashi, T. Yoshioka, H. Mori, M. Iida, and A. Yoshimura
The dual function of hepatic SOCS3 in insulin resistance in vivo.
Genes Cells, February 1, 2007; 12(2): 143 - 154.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagihara, K.
Right arrow Articles by Yoshizaki, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagihara, K.
Right arrow Articles by Yoshizaki, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS