GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 1153-1162. doi:10.1111/j.1365-2443.2005.00912.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Higashi, T.
Right arrow Articles by Tanaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Higashi, T.
Right arrow Articles by Tanaka, Y.

Constitutive tyrosine and serine phosphorylation of STAT4 in T-cells transformed with HTLV-I

Takehiro Higashi1, Junichi Tsukada1,*, Yasuhiro Yoshida2, Takamitsu Mizobe1, Fumihiko Mouri1, Yasuhiro Minami3, Hiroaki Morimoto1 and Yoshiya Tanaka1

1 The First Department of Internal Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan
2 Department of Immunology, School of Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan
3 Department of Genome Sciences, Faculty of Meducal Sciences, Graduate School of Medicine, Kobe University, Kobe, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
STAT4 is a critical mediator of IL-12-stimulated gene regulation in T-helper type 1 (Th1) cell. IL-12 activates the Janus family tyrosine kinases JAK2 and Tyk2, which in turn phosphorylate STAT4 on tyrosine 693. The p38 mitogen-activated protein kinase (MAPK) signaling pathway is also activated in response to IL-12, followed by phosphorylation of STAT4 on serine 721, which is required for STAT4 full transcriptional activity. In the present study, we demonstrated constitutive activation of STAT4 in HTLV-I-transformed T-cell lines MT-2, MT-4 and HUT102 by immunoprecipitation, Western blotting and electrophoretic mobility shift assay (EMSA). In HTLV-I-transformed T-cell lines, STAT4 was constitutively phosphorylated not only on tyrosine 693 but also on serine 721, and formed a heterodimer with STAT3. Constitutive phosphorylation of its upstream activators, JAK2, Tyk2 and p38 MAPK was also observed in the cells. EMSA and transient transfection studies further showed that the high-affinity sis-inducible element (hSIE) preferentially binds the STAT3/STAT4 heterodimer and is constitutively transactivated in MT-2 cells in the absence of exogenous cytokine stimulation. When STAT4 expression vector was cotransfected along with STAT3 expression vector into MT-2 cells, STAT4 significantly synergized with STAT3 to transactivate hSIE, showing the functional importance of heterodimer formation between STAT4 and STAT3.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Signal transducer and activator of transcription (STAT) proteins play important roles in regulating cellular response to a variety of cytokines. STATs are latent cytosolic transcriptional factors that are activated by tyrosine phosphorylation in response to cytokines. STATs can form homo- or heterodimers in which amino acid sequence containing a phosphotyrosine residue in one partner binds to the SH2 domain in the other, leading to nuclear translocation of STAT dimers and their participation in transcriptional regulation of various cytokine responsive genes (Darnell 1997; Ihle 2001; Leonard & O'Shea 1998).

Recent reports have emphasized the significance of STATs in oncogenesis and leukemogenesis (Bowman et al. 2000; Coffer et al. 2000; Levy & Gilliland 2000; Lin et al. 2000). Many oncoproteins can activate STATs. In contrast to the normal cellular response, which shows rapid and transient activation of STATs, aberrant activation of JAK/STAT signaling contributes to malignant transformation. The v-abl oncogene of the Abelson murine leukemia virus (A-MuLV) has been demonstrated to induce JAK/STAT signaling, involving JAK1 and JAK3 (Danial et al. 1995). Interestingly, it has been reported that constitutive expression of a dominant-active STAT3 induces neoplastic transformation (Bromberg et al. 1999), and that STATs are constitutively activated in various human hematological malignancies. STAT1 and STAT5 are activated in BCR-ABL-positive leukemias (Carlesso et al. 1996; Frank & Varticovski 1996; Shuai et al. 1996) and STAT1, STAT3 and STAT5 are constitutively activated in acute leukemia blasts (Gouilleux-Gruart et al. 1996; Spiekermann et al. 2001; Weber-Nordt et al. 1996; Xia et al. 1998).

Adult T cell leukemia (ATL), which is caused by the human T-cell leukemia virus type I (HTLV-I) infection, is a mature CD4+ T cell malignancy with a marked expansion of leukemic cells during the acute phase. Transformation of T-cells by HTLV-I is associated with constitutive activation of the JAK-STAT pathway (Migone et al. 1995; Xu et al. 1995). Leukemia cells obtained from ATL patients also showed constitutive activation of STATs (Takemoto et al. 1997; Tsukada et al. 2000). Takemoto et al. (1997) observed constitutive activation of STAT1, STAT3 and STAT5 in leukemic cells of ATL patients, and demonstrated the association of leukemic cell proliferation with constitutive JAK/STAT activity.

STAT4 is a crucial mediator of interleukin (IL)-12-stimulated gene regulation (Bacon et al. 1995b; Jacobson et al. 1995). In fact, the development of type-1 helper T (Th1) cells and production of interferon (IFN)-{gamma} in response to IL-12 are disrupted in STAT4-deficient mice (Kaplan et al. 1996; Thierfelder et al. 1996). STAT4 is phosphorylated on tyrosine 693 by JAK2 and Tyk2 (Bacon et al. 1995a; Cho et al. 1996). Moreover, IL-12 activates the p38/MKK6 signaling pathway that in turn phosphorylates STAT4 on serine 721 (Visconti et al. 2000). Activation of p38 and its upstream activator MKK6 is an important step for IL-12-induced STAT4 transcriptional activity (Visconti et al. 2000; Zhang & Kaplan 2000). In fact, previous studies indicated that IFN-{gamma} production is blocked by a p38 inhibitor (Rincon et al. 1998; Zhang & Kaplan 2000). Furthermore, transgenic mice expressing a dominant-negative p38 showed impaired Th1 differentiation (Rincon et al. 1998). Importantly, phosphorylation of STAT4 on serine 721 through the MKK6/p38 pathway is critical for IL-12-induced IFN-{gamma} production, but not for IL-12-induced cell proliferation (Morinobu et al. 2002).

In the present study, we show that STAT4 in HTLV-I transformed T-cell lines MT-2, MT-4 and HUT-102 is activated constitutively as assessed by Western blot, immunoprecipitation and electrophoretic mobility shift assay (EMSA) using a radiolabeled high-affinity sis-inducible element (hSIE). In HTLV-I-transformed T-cells, STAT4 was constitutively phosphorylated on serine 721 as well as on tyrosine 693, and generated a heterodimer with STAT3. Moreover, STAT4 synergized with STAT3 to transactivate hSIE.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Constitutive tyrosine- and serine-phosphorylation of STAT4 in HTLV-I-transformed cells

Unlike STAT1, the expression of STAT4 is observed in limited types of tissues such as testis, spleen, lung, bone marrow, thymus and muscle (Yamamoto et al. 1994; Zhong et al. 1994). Several T cell lines including EL4 and DA2 have been reported to contain no STAT4 transcripts (Yamamoto et al. 1994). However, as shown in Fig. 1, tyrosine-phosphorylated STAT4 was detected in HTLV-I-transformed cell lines MT-2, MT-4 and HUT102 (lanes 1–3). The amount of tyrosine-phosphorylated STAT4 proteins in MT-4 appeared to be greater than those of the other two cell lines. In addition, Western blotting with an Ab to STAT4 phosphorylated on serine 721 (anti-p-ser STAT4 Ab) showed that in HTLV-I-transformed cell lines, STAT4 protein was constitutively phosphorylated not only on tyrosine but also on serine 721 (lanes 4–6).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1  Constitutive tyrosine- and serine-phosphorylation of STAT4 in HTLV-I-transformed T-cell lines. Lysates of MT-2, MT-4 and HUT102 cells were immunoprecipitated with 4G10 (lanes 1–3) or anti-STAT4 Ab (lanes 4–6) and blotted with anti-STAT4 Ab (lanes 1–3) or anti-p-ser STAT4 Ab (lanes 4–6).

 
Constitutive activation of JAK family kinases, JAK2 and Tyk2, and of a MAPK family kinase p38 in HTLV-I-transformed cells

In the present study, we further investigated the possible contribution of JAK2, Tyk2 and p38 to serine- and tyrosine-phosphorylation of STAT4 in HTLV-I-transformed cell lines. As shown in Fig. 2A, immunoprecipitation of cell extracts with 4G10, followed by Western blotting with Abs against JAK2 and Tyk2 showed constitutive activation of JAK2 and Tyk2, respectively. Moreover, Western blotting with anti-p38 Ab and a specific Ab to p38 phosphorylated on threonine 180 and tyrosine 182 (anti-p-p38 Ab) demonstrated constitutive activation of p38 in HTLV-I-transformed cell lines (Fig. 2B, lanes 6–8). In contrast, peripheral blood mononuclear cells showed no phosphorylated p38 in comparison to the weak, but significant expression of p-38 (Fig. 2B, lanes 1 and 5).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2  Activation of JAK2, Tyk2 and p38 in HTLV-I-transformed T-cell lines. (A) Lysates were prepared from MT-2, MT-4 and HUT102 cells, and then resolved by SDS-PAGE, probed with anti-JAK2 Ab or anti Tyk2 Ab (lanes 1–6). In lanes 7–12, lysates were immunoprecipitated with 4G10 and blotted with anti-JAK2 Ab or anti-Tyk2 Ab. (B) Lysates (MT-2, MT-4, HUT102 and peripheral blood MNC) were resolved by SDS-PAGE, blotted with anti-p38 Ab or anti-p-p38 Ab.

 
STAT4 forms a heterodimer with STAT3 in HTLV-I-transformed cells

As shown in Fig. 3A (lanes 1–3), in addition to STAT4 we observed constitutive tyrosine-phosphorylation of STAT3 in HTLV-I-transformed cells. In this respect, a recent study showed that IL-12 induced heterodimer formation of STAT3 with STAT4 (Jacobson et al. 1995). To examine whether or not STAT4 dimerizes with STAT3 in HTLV-I-transformed cells, cell lysates from MT-2, MT-4 and HUT102 were immunoprecipitated with anti-STAT3 Ab and immunoblotted with either anti-STAT4 Ab or anti-p-ser STAT4 Ab. Anti-STAT3 immunoprecipitates contained STAT4 phosphorylated on serine residue (Fig. 3A, lanes 7–9). Immunoprecipitation study with anti-STAT4 Ab also showed association of tyrosine-phosphorylated STAT3 with STAT4 (Fig. 3B, lanes 1–6). In order to confirm the specificities of anti-STAT3 and anti-STAT4 Abs, respectively, we compared the migration patterns of STAT4 and STAT3 by using a longer sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). As shown in Fig. 3C, STAT3 migrated with a slightly slower mobility compared to STAT4. Moreover, Western blotting with anti-STAT4 Ab and 293T cells showed that STAT4 protein was observed only after the introduction of Rc/CMV-STAT4 into the cells (Fig. 3D, lanes 2 and 3). The introduction of Rc/CMV-STAT3 into 293T cells made preexisting STAT3 expression even more significant (Fig. 3D, lanes 5 and 6).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3  Heterodimer formation of STAT4 with STAT3. Lysates were prepared from MT-2, MT-4 and HUT102 cells. (A) Lysates immunoprecipitated with anti-STAT3 Ab were resolved by SDS-PAGE, blotted with anti-p-tyr STAT3 Ab (lanes 1–3), anti-STAT4 Ab (lanes 4–6), or anti-p-ser STAT4 Ab (lanes 7–9). (B) Lysates immunoprecipitated with anti-STAT4 Ab were resolved by SDS-PAGE, blotted with anti-STAT3 Ab (lanes 1–3) Ab or anti-p-tyr STAT3 Ab (lanes 4–6). (C) MT-2 cell lysate was resolved by a longer SDS-PAGE, and then blotted with anti-STAT3 Ab or anti-STAT4 Ab. (D) Either Rc/CMV-STAT4 or Rc/CMV-STAT3 was introduced into 293T cells. 24 h after transfection, cells were harvested, and cell lysates were resolved by SDS-PAGE, blotted with anti-STAT4 Ab (lanes 2 and 3), anti-STAT3 Ab (lanes 5 and 6). As control, lysates obtained from peripheral blood MNC were used (lanes 1 and 4).

 
We further analyzed the DNA binding activities of STAT4 and STAT3 in MT-2 by using EMSA. MT-2 nuclear extract was analyzed by using a radiolabeled hSIE probe. As shown in Fig. 4A, hSIE/MT-2 nuclear extract complex was competed for by both wild-type STAT3 and STAT4 consensus oligonucleotides (arrow; lanes 2 and 4), but not by mutated STAT3 and STAT4 oligonucleotides (arrow; lanes 3 and 5). Furthermore, Abs to STAT3, STAT4, p-tyr STAT3, p-ser STAT4 and p-tyr Abs abrogated the complex (Fig. 4B, arrow). In contrast, anti-STAT6 Ab failed to affect the complex. These results showed that the hSIE/MT-2 nuclear protein complex contains both STAT3 and STAT4, suggesting that activated STAT4 and STAT3 form a heterodimer that recognizes hSIE. When nuclear extract of IL-6-stimulated Jurkat cells was used, instead of MT-2 nuclear extract, as a control study, three distinct STAT/hSIE complexes were generated, consistent with previous studies showing formation of STAT1 homodimer, STAT1/STAT3 heterodimer and STAT3 homodimer (Fig. 4C, lanes 2–3) (Sadowski et al. 1993). Complexes A and B, but not C, were abrogated by anti-STAT3 Ab.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4  Constitutive DNA binding activity of STAT3 and STAT4 in HTLV-I-transformed T-cells. hSIE was used as a radiolabeled probe. In experiments A and B, nuclear extracts were prepared from MT-2 cells. (A) Unlabeled competitor oligonucleotides described in Experimetal procedures were used at an approximate 50-fold molar excess over radiolabeled hSIE probe. (B) Specific Abs to p-tyr, STAT3, p-tyr STAT3, STAT4 and p-ser STAT4 used in this study were described in Experimetal procedures. (C) Jurkat nuclear extracts were used instead of MT-2 nuclear extract. Jurkat cells were treated with 10 ng/mL of IL-6 for 30 min or left untreated. (D) Lysates of MT-2 and untreated Jurkat T-cells were immunoprecipitated with anti-STAT4 Ab and blotted with anti-STAT4 Ab.

 
On the other hand, although expression of STAT4 protein was observed in Jurkat T-cells as well as in MT-2 (Fig. 4D), no significant complex formation of Jurkat protein with hSIE was observed in EMSA using nuclear extract obtained from untreated Jurkat T-cells (Fig. 4C, lane 1). These results revealed that STAT4 was not constitutively phosphorylated in Jurkat T-cells.

Transcriptional regulation of hSIE in HTLV-I-transformed cells

To determine the functional importance of STAT4 in HTLV-I transformed cell lines, pGLmfoshSIE was transiently transfected into MT-2 cells. A single copy of the hSIE was inserted into the pGL2 Basic vector along with the minimal murine c-fos promoter (pGLmfoshSIE). The presence of a single copy of hSIE resulted in an approximately twofold increase in activity, compared with that of pGLmfos control vector (Fig. 5A). Furthermore, a STAT4 expression vector, Rc/CMV-STAT4 and/or a STAT3 expression vector Rc/CMV-STAT3, were cotransfected along with pGLmfoshSIE into MT-2 (Fig. 5B). The transcriptional activities for hSIE were enhanced following cotransfection of Rc/CMV-STAT4 or of Rc/CMV-STAT3 in a dose dependent manner. Interestingly, introduction of both Rc/CMV-STAT3 and Rc/CMV-STAT4 along with pGLmfoshSIE into MT-2 resulted in synergistic transcriptional activation of hSIE by STAT3 and STAT4.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5  Synergistic activation of hSIE by STAT3 and STAT4 in MT-2 cells. (A) Either pGLmfoshSIE (2 µg) or pGLmfos (2 µg) was transfected into MT-2 cells. After transfection, cells were left untreated. (B) Rc/CMV-STAT3 (0.5–1 µg) and/or Rc/CMV-STAT4 (0.5–1 µg) was transfected along with 1 µg of pGLmfoshSIE into MT-2 cells. After transfection, cells were left untreated. The total amount of transfected DNA was kept constant (3 µg) by the addition of control vector. Data are mean ± SD of triplicate samples. The luciferase assays were carried out as described in Experimetal procedures. Data were normalized by internal control Renilla luciferase activity.

 
Constitutive expression of c-fos protein in HTLV-I-transformed cells

As shown in Figs 4 and 5, STAT3/4 heterodimer is a sequence-specific activator which recognizes SIE. In this regard, since the c-fos promoter possesses the SIE (Sadowski et al. 1993), we further examined c-fos protein expression in HTLV-I-transformed cells by using Western blotting. c-fos protein was constitutively expressed in HTLV-I-transformed cells (Fig. 6).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 6  Constitutive expression of c-fos in MT-2, MT-4 and HUT102 cells. Lysates (MT-2, MT-4, HUT102) were resolved by SDS-PAGE, and blotted with anti-c-fos.

 
HTLV-I-transformed cells constitutively express IFN-{gamma}

STAT4 is an important factor for IL-12-induced IFN-{gamma} production. In the present study, using the RT-PCR technique, we examined the expression level of IFN-{gamma} mRNA in HTLV-I-transformed cells. As shown in Fig. 7A, IFN-{gamma} expression was detected in all cells examined.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 7  Constitutive expression of IFN-{gamma} in MT-2, MT-4 and HUT102 cells, but not in untreated peripheral blood mononuclear cells. (A) one microgram of total RNA was used in these experiments. (B) Lysates (MT-2, MT-4, HUT102 and untreated MNC) were resolved by SDS-PAGE, blotted with anti-IFN-{gamma} Ab. anti-IFN-{gamma} Ab used in this study were described in Experimetal procedures.

 
Moreover, IFN-{gamma} protein production in HTLV-I-transformed cells was examined by using Western blotting with an Ab specific to IFN-{gamma} protein. As a result, IFN-{gamma} protein was detected in all HTLV-I-transformed cells examined (Fig. 7B, lanes 2-4). In contrast, no significant expression of IFN-{gamma} protein was observed in untreated MNC (Fig. 7B, lane 1).

STAT4 is activated by IFN-{alpha} as well as IL-12 (Cho et al. 1996). However, examination of IL-12 and IFN-{alpha} protein production in HTLV-I-transformed cells by ELISA failed to show any apparent production of these two proteins (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
In the present study, we demonstrated that STAT4 is constitutively phosphorylated not only on tyrosine 693 but also on serine 721 in HTLV-I-transformed cells, MT-2, MT-4 and HUT102. Members of STAT family were first identified as transcriptional mediators that were activated in response to IFN stimulation (Levy et al. 1989; Schindler et al. 1992; Shuai et al. 1992), and they play crucial roles in regulating physiological cellular responses to cytokines. On the other hand, inappropriate activation of the JAK/STAT signaling has been demonstrated to contribute to oncogenesis and leukemogenesis (Bowman et al. 2000; Coffer et al. 2000; Levy & Gilliland 2000; Lin et al. 2000). A constitutively active form of STAT3 can transform cells (Bromberg et al. 1999). Constitutive activation of JAKs and STATs has been observed in murine pre-B lymphocytes transformed with the A-MuLV (Danial et al. 1995), human B cells transformed with Epstein-Barr virus (Gouilleux-Gruart et al. 1996) and murine erythroleukemia induced by spleen focus-forming virus (Ohashi et al. 1995). Primary acute leukemia cells also show constitutive activation of STATs (Gouilleux-Gruart et al. 1996; Spiekermann et al. 2001; Weber-Nordt et al. 1996; Xia et al. 1998). Moreover, constitutive STAT3 activation in acute myeloid leukemia blasts has been reported to be associated with short disease-free survival, showing a prognostic significance for STAT3 (Benekli et al. 2002). Interestingly, Migone et al. (1995) demonstrated that activation of JAK1, JAK3, STAT3 and STAT5 correlated with the transition from an IL-2-dependent to an IL-2-independent phase in HTLV-I-transformed cells. Spontaneous phosphorylation of JAK2 and JAK3 has also been observed in T-cells transformed with HTLV-I, MT-2 and MT-4 (Xu et al. 1995). In addition, neoplastic growth of primary ATL leukemic cells has been reported to be associated with constitutive activation of JAK/STAT proteins (Takemoto et al. 1997). Thus, constitutive and inappropriate activation of STAT proteins may play an important role in the pathogenesis of ATL.

The relevance of phosphorylation of serine 721 in STAT4 has been recently reported. Serine phosphorylation of STAT4 is dispensable for nuclear translocation or DNA binding of STAT4, but is indispensable for its maximal transcriptional activity (Visconti et al. 2000). In contrast, phosphorylation of a conserved C-terminal tyrosine residue of STAT proteins is necessary for their cytokine-induced dimerization and DNA binding (Becker et al. 1998; Chen et al. 1998). In this regard, it should be noted that serine 721 phosphorylation of STAT4 is required for IL-12-induced IFN-{gamma} production and IL-12-mediated Th1 development, but not for IL-12-induced cell proliferation (Morinobu et al. 2002). Furthermore, they have shown that serine phosphorylation of STAT4 is partially dependent on precedent tyrosine phosphorylation of STAT4, whereas tyrosine phosphorylation of STAT4 can be seen even in the absence of serine phosphorylation. In the present study, we showed that both serine 721 and tyrosine 693 in STAT4 were constitutively phosphorylated in HTLV-I-transformed T-cells. In contrast to our data, it has been shown that in leukemic cells from chronic lymphocytic luekemia patients, STAT1 and STAT3 are constitutively phosphorylated on serine 727, but not on tyrosine residue (Frank et al. 1997). In the other leukemias such as AML and ALL, serine phosphorylation of the STATs was occasionally seen (Frank et al. 1997; Hayakawa et al. 1998). Thus, STATs may have selective effects on gene expression of leukemia cells in a manner dependent upon serine phosphorylation.

It has been well demonstrated that STAT1 can form a heterodimer with STAT2 (Ghislain & Fish 1996) or STAT3 (Sadowski et al. 1993). In the present study, when whole cell extracts of HTLV-I-transformed cells were immunoprecipitated with either anti-STAT3 or anti-STAT4, coprecipitation of STAT4 with STAT3 was observed vice versa, indicating heterodimer formation between the two proteins. Similar results were obtained in EMSA, which showed that an hSIE/MT-2 nuclear protein complex contained both STAT3 and STAT4. With this respect, it is of importance to note that STAT4 and STAT3 have been reported to form a heterodimer in response to IL-12 (Jacobson et al. 1995). Consistent with our results, they further demonstrated that hSIE preferentially binds to STAT3/STAT4 heterodimer, but not to homodimers of each STAT. In our current study, transfection studies using expression vectors for STAT3 and STAT4 revealed that the two proteins transactivate hSIE synergistically.

STAT4, which is activated through stimulation by IL-12, plays an important role in Th1 cell differentiation and IFN-{gamma} production. However, HTLV-I-transformed cells examined in the present study expressed neither IL-12 nor IFN-{alpha}. Although the functional significance of constitutive STAT4 activation remains unclear, we observed spontaneous IFN-{gamma} production in HTLV-I-transformed cells. The fact that the JAK/STAT signaling pathway is one of the attractive targets for leukemia therapies further argues the importance of constitutive STAT4 activation in HTLV-I-transformed cells.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cells and plasmids

HTLV-I-infected T-cell lines MT-2, MT-4 and HUT-102, Jurkat T cell, and human endothelial kidney 293T cells were used in the present study. The HTLV-I-infected T-cell lines were cultured in RPMI-1640 medium and the human endothelial kidney 293T cells were cultured in DMEM suppulemented with 10% fetal calf serum, 0.5% of penicillin and streptomycin in a humidified incubator under 5% CO2 at 37 °C. In some experiments, peripheral blood mononuclear cells (MNC) obtained from healthy volunteers were used. A single copy of hSIE (AGCTTGTGCATTTCCCGTAAATCTTGTCG) was inserted into pGL2mfos, a pGL2 Basic vector (Promega, Madison, WI) with the minimal (–56 to +109) murine c-fos promoter (pGLmfoshSIE). Expression vectors for STAT4 (Rc/CMV-STAT4) and STAT3 (Rc/CMV-STAT3) (Zhong et al. 1994) were kindly provided by Dr J.E. Darnell (Laboratory of Molecular Cell Biology, The Rockefeller University, New York, NY, USA).

Antibodies and oligonucleotides

Anti-STAT4 antibody (Ab), anti-STAT3 Ab, antiphospho-serine 721 STAT4 Ab (p-ser STAT4), antiphospho-tyrosine 705 STAT3 Ab (p-tyr STAT3), anti-JAK2 Ab, anti-Tyk2 Ab, anti-p-tyr Ab, anti-IFN-{gamma} Ab and anti-c-fos Ab were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA). Anti-p38 Ab and anti-p-p38 (Thr180/Tyr182) Ab were purchased from Cell Signaling Technology (Beverly, MA, USA). The agarose conjugate of anti-p-tyr Ab 4G10 were purchased from Upstate Biotechnology (Lake Placid, NY, USA). The nucleotide sequences of oligonucleotides used in this study were as follows: wild-type STAT3 (wt-STAT3), 5'-GATCCTTCTGGGAATTCCTAGATG-3' and mutated STAT3 (m-STAT3), 5'-GATCCTTCTGGGCCGTCCTAGATG-3', and wt-STAT4, 5'-GAGCCTGATTTCCCCGAAATGATGAGCTAG-3' and m-STAT4, 5'-GAGCCTGATTTCTTTGAAATGATGAGCTAG-3' (Santa Cruz Biotechnology Inc.).

Immunoprecipitation and Western blotting

Cells were washed twice in cold phosphate-buffered saline (PBS), and lysed in buffer (1 mM MgCl2 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES, pH 7.9], 10 mM KCl, 0.1% Triton X-100, 1 mM dithiothreitol [DTT], 20% glycerol, and 0.5 mM phenylmethylsulfonyl fluoride [PMSF]) containing 0.2 µg of antipain, aprotinin, chymostatin, leupeptin, pepstatin A, 1 mmol/L of ZnCl2 and sodium orthovanadate and 10 mmol/L NaF on ice for 15 min. Immunoprecipitation was performed according to the instructions provided by the manufacturer. Immunoprecipitates were resolved on 6–16% polyacrylamide gel and were transferred onto nitrocellulose membranes. The blots were incubated with the appropriate Abs and detected with the immunostar kit (Wako Chemicals, Osaka, Japan), according to the protocol provided.

Nuclear extracts and electrophoretic mobility shift assay

hSIE was used as a 32P-labeled probe in this study. Nuclear extracts of HTLV-I-transformed cells were prepared as described previously (Shirakawa et al. 1993). EMSA was also performed as described previously with some modifications (Kominato et al. 1995). Total reaction volume was 18 µL, which included 4 µg nuclear extract, 1 µg poly (dI-dC), and 0.2 ng of 32P end-labeled hSIE probe. The binding buffer was 10 mM Tris-HCl [pH 7.5], 1 mM ethylenediaminetetraacetic acid [EDTA], 1 mM 2-mercaptoethanol, 4% glycerol, and 40 mM NaCl. Protein-DNA complexes were resolved on 4% TBE polyacrylamide gels using 0.5 x TBE (45 mmol/L Tris-borate and 1 mmol/L EDTA) as the running buffer. Unlabeled competitors were used in a 50-fold molecular excess over the radiolabeled probe. In EMSA experiments using Abs, nuclear extracts were incubated with the appropriate Abs at room temparature for 30 min.

Reverse transcription-polymerase chain reaction

Total RNAs of HTLV-I-transformed cells were extracted by Isogen RNA extraction kit (Nippon Gene, Tokyo). Total RNA 1 µg was used along with a reverse transcriptase RNA PCR kit; Access RT-PCR System (Promega) according to the instructions provided by the supplier. An aliquot of the PCR mixture was subjected to electrophoresis in 2% agarose gel. Primers of human IFN-{gamma} (5'-ATGAAATATACAAGTTATATCTTGGCTTT-3' and 5'-GATGCTCTTCGACCTCGAAACAGCAT-3') were purchased from Toyobo (Osaka, Japan). ß-actin PCR primers were synthesized as follows: sense, 5'-TCATGAAGTGTGACGTTGACATCCGT-3', and antisense 5'-CCTAGAAGCATTTGCGGTGCAAGATG-3'.

Enzyme-linked immunosorbent assay

HTLV-I-transformed cells were cultured at a density of 1 x 107 cells per 10 mL for 24 h and concentrations of IFN-{alpha} and IL-12 in the supernatants were measured by using ELISA. Cell extracts were prepared from incubation of 1 x 108 cells in 1 mL of cell lysis buffer used in Western blotting.

Transfections and luciferase assays

Transfection of plasmids into MT-2 cells was carried out by using a transfection kit; Transfast (Promega) using the protocol recommended by the manufacturer. Cells were lysed with Passive Lysis Buffer (Promega). The cell lysates were used for a dual-luciferase reporter assay system (Promega). Samples were normalized to Renilla luciferase activity as an internal control for transfection efficiency.


    Acknowledgements
 
This work was supported in part by Research Grants-In-Aid for Scientific Research by the Ministry of Health, Labor and Welfare of Japan, the Ministry of Education, Culture, Sports, Science and Technology of Japan and University of Occupational and Environmental Health, Japan.


    Footnotes
 
Communicated by: Eisuke Nishida

* Correspondence: E-mail: jtsukada{at}med.uoeh-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bacon, C.M., McVicar, D.W., Ortaldo, J.R., Rees, R.C., O'Shea, J.J. & Johnston, J.A. (1995a) Interleukin 12 (IL-12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL-2 and IL-12. J. Exp. Med. 181, 399–404.[Abstract/Free Full Text]

Bacon, C.M., Petricoin, E.F. 3rd, Ortaldo, J.R., et al. (1995b) Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92, 7307–7311.[Abstract/Free Full Text]

Becker, S., Groner, B. & Muller, C.W. (1998) Three-dimensional structure of the Stat3ß homodimer bound to DNA. Nature 394, 145–151.[CrossRef][Medline]

Benekli, M., Xia, Z., Donohue, K.A., et al. (2002) Constitutive activity of signal transducer and activator of transcription 3 protein in acute myeloid leukemia blasts is associated with short disease-free survival. Blood 99, 252–257.[Abstract/Free Full Text]

Bowman, T., Garcia, R., Turkson, J. & Jove, R. (2000) STATs in oncogenesis. Oncogene 19, 2474–2488.[CrossRef][Medline]

Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., et al. (1999) Stat3 as an oncogene. Cell 98, 295–303.[CrossRef][Medline]

Carlesso, N., Frank, D.A. & Griffin, J.D. (1996) Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med. 183, 811–820.[Abstract/Free Full Text]

Chen, X., Vinkemeier, U., Zhao, Y., Jeruzalmi, D., Darnell, J.E. Jr & Kuriyan, J. (1998) Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 93, 827–839.[CrossRef][Medline]

Cho, S.S., Bacon, C.M., Sudarshan, C., et al. (1996) Activation of STAT4 by IL-12 and IFN-{alpha}: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157, 4781–4789.[Abstract]

Coffer, P.J., Koenderman, L. & de Groot, R.P. (2000) The role of STATs in myeloid differentiation and leukemia. Oncogene 19, 2511–2522.[CrossRef][Medline]

Danial, N.N., Pernis, A. & Rothman, P.B. (1995) Jak-STAT signaling induced by the v-abl oncogene. Science 269, 1875–1877.[Abstract/Free Full Text]

Darnell, J.E. Jr (1997) STATs and gene regulation. Science 277, 1630–1635.[Abstract/Free Full Text]

Frank, D.A., Mahajan, S. & Ritz, J. (1997) B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J. Clin. Invest. 100, 3140–3148.[Medline]

Frank, D.A. & Varticovski, L. (1996) BCR/abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia 10, 1724–1730.[Medline]

Ghislain, J.J. & Fish, E.N. (1996) Application of genomic DNA affinity chromatography identifies multiple interferon-{alpha}-regulated Stat2 complexes. J. Biol. Chem. 271, 12408–12413.[Abstract/Free Full Text]

Gouilleux-Gruart, V., Gouilleux, F., Desaint, C., et al. (1996) STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87, 1692–1697.[Abstract/Free Full Text]

Hayakawa, F., Towatari, M., Iida, H., et al. (1998) Differential constitutive activation between STAT-related proteins and MAP kinase in primary acute myelogenous leukaemia. Br. J. Haematol. 101, 521–528.[CrossRef][Medline]

Ihle, J.N. (2001) The Stat family in cytokine signaling. Curr. Opin. Cell Biol. 13, 211–217.[CrossRef][Medline]

Jacobson, N.G., Szabo, S.J., Weber-Nordt, R.M., et al. (1995) Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181, 1755–1762.[Abstract/Free Full Text]

Kaplan, M.H., Sun, Y.L., Hoey, T. & Grusby, M.J. (1996) Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382, 174–177.[CrossRef][Medline]

Kominato, Y., Galson, D., Waterman, W.R., Webb, A.C. & Auron, P.E. (1995) Monocyte expression of the human prointerleukin 1 ß gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1. Mol. Cell. Biol. 15, 59–68.[Abstract]

Leonard, W.J. & O'Shea, J.J. (1998) Jaks and STATs: biological implications. Annu. Rev. Immunol. 16, 293–322.[CrossRef][Medline]

Levy, D.E. & Gilliland, D.G. (2000) Divergent roles of STAT1 and STAT5 in malignancy as revealed by gene disruptions in mice. Oncogene 19, 2505–2510.[CrossRef][Medline]

Levy, D.E., Kessler, D.S., Pine, R. & Darnell, J.E. Jr (1989) Cytoplasmic activation of ISGF3, the positive regulator of interferon-{alpha}-stimulated transcription, reconstituted in vitro. Genes Dev. 3, 1362–1371.[Abstract/Free Full Text]

Lin, T.S., Mahajan, S. & Frank, D.A. (2000) STAT signaling in the pathogenesis and treatment of leukemias. Oncogene 19, 2496–2504.[CrossRef][Medline]

Migone, T.S., Lin, J.X., Cereseto, A., et al. (1995) Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science 269, 79–81.[Abstract/Free Full Text]

Morinobu, A., Gadina, M., Strober, W., et al. (2002) STAT4 serine phosphorylation is critical for IL-12-induced IFN-{gamma} production but not for cell proliferation. Proc. Natl. Acad. Sci. USA 99, 12281–12286.[Abstract/Free Full Text]

Ohashi, T., Masuda, M. & Ruscetti, S.K. (1995) Induction of sequence-specific DNA-binding factors by erythropoietin and the spleen focus-forming virus. Blood 85, 1454–1462.[Abstract/Free Full Text]

Rincon, M., Enslen, H., Raingeaud, J., et al. (1998) Interferon-gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17, 2817–2829.[CrossRef][Medline]

Sadowski, H.B., Shuai, K., Darnell, J.E. Jr & Gilman, M.Z. (1993) A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science 261, 1739–1744.[Abstract/Free Full Text]

Schindler, C., Shuai, K., Prezioso, V.R. & Darnell, J.E. Jr (1992) Interferon-dependent tyrosine phosphorylation of a latent cytoplasmic transcription factor. Science 257, 809–813.[Abstract/Free Full Text]

Shirakawa, F., Saito, K., Bonagura, C.A., et al. (1993) The human prointerleukin 1 ß gene requires DNA sequences both proximal and distal to the transcription start site for tissue-specific induction. Mol. Cell. Biol. 13, 1332–1344.[Abstract/Free Full Text]

Shuai, K., Halpern, J., ten Hoeve, J., Rao, X. & Sawyers, C.L. (1996) Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene 13, 247–254.[Medline]

Shuai, K., Schindler, C., Prezioso, V.R. & Darnell, J.E. Jr (1992) Activation of transcription by IFN-{gamma}: tyrosine phosphorylation of a 91-kD DNA binding protein. Science 258, 1808–1812.[Abstract/Free Full Text]

Spiekermann, K., Biethahn, S., Wilde, S., Hiddemann, W. & Alves, F. (2001) Constitutive activation of STAT transcription factors in acute myelogenous leukemia. Eur. J. Haematol. 67, 63–71.[Medline]

Takemoto, S., Mulloy, J.C., Cereseto, A., et al. (1997) Proliferation of adult T cell leukemia/lymphoma cells is associated with the constitutive activation of JAK/STAT proteins. Proc. Natl. Acad. Sci. USA 94, 13897–13902.[Abstract/Free Full Text]

Thierfelder, W.E., van Deursen, J.M., Yamamoto, K., et al. (1996) Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382, 171–174.[CrossRef][Medline]

Tsukada, J., Toda, Y., Misago, M., Tanaka, Y., Auron, P.E. & Eto, S. (2000) Constitutive activation of LIL-Stat in adult T-cell leukemia cells. Blood 95, 2715–2718.[Abstract/Free Full Text]

Visconti, R., Gadina, M., Chiariello, M., et al. (2000) Importance of the MKK6/p38 pathway for interleukin-12-induced STAT4 serine phosphorylation and transcriptional activity. Blood 96, 1844–1852.[Abstract/Free Full Text]

Weber-Nordt, R.M., Egen, C., Wehinger, J., et al. (1996) Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines. Blood 88, 809–816.[Abstract/Free Full Text]

Xia, Z., Baer, M.R., Block, A.W., Baumann, H. & Wetzler, M. (1998) Expression of signal transducers and activators of transcription proteins in acute myeloid leukemia blasts. Cancer Res. 58, 3173–3180.[Abstract/Free Full Text]

Xu, X., Kang, S.H., Heidenreich, O., Okerholm, M., O'Shea, J.J. & Nerenberg, M.I. (1995) Constitutive activation of different Jak tyrosine kinases in human T cell leukemia virus type 1 (HTLV-1) tax protein or virus-transformed cells. J. Clin. Invest. 96, 1548–1555.

Yamamoto, K., Quelle, F.W., Thierfelder, W.E., et al. (1994) Stat4, a novel gamma interferon activation site-binding protein expressed in early myeloid differentiation. Mol. Cell. Biol. 14, 4342–4349.[Abstract/Free Full Text]

Zhang, S. & Kaplan, M.H. (2000) The p38 mitogen-activated protein kinase is required for IL-12-induced IFN-{gamma} expression. J. Immunol. 165, 1374–1380.[Abstract/Free Full Text]

Zhong, Z., Wen, Z. & Darnell, J.E. Jr (1994) Stat3 and Stat4: members of the family of signal transducers and activators of transcription. Proc. Natl. Acad. Sci. USA 91, 4806–4810.[Abstract/Free Full Text]

Received: 6 June 2005
Accepted: 16 September 2005





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Higashi, T.
Right arrow Articles by Tanaka, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Higashi, T.
Right arrow Articles by Tanaka, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS