|
|
||||||||
1 The First Department of Internal Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan
2 Department of Immunology, School of Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan
3 Department of Genome Sciences, Faculty of Meducal Sciences, Graduate School of Medicine, Kobe University, Kobe, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recent reports have emphasized the significance of STATs in oncogenesis and leukemogenesis (Bowman et al. 2000; Coffer et al. 2000; Levy & Gilliland 2000; Lin et al. 2000). Many oncoproteins can activate STATs. In contrast to the normal cellular response, which shows rapid and transient activation of STATs, aberrant activation of JAK/STAT signaling contributes to malignant transformation. The v-abl oncogene of the Abelson murine leukemia virus (A-MuLV) has been demonstrated to induce JAK/STAT signaling, involving JAK1 and JAK3 (Danial et al. 1995). Interestingly, it has been reported that constitutive expression of a dominant-active STAT3 induces neoplastic transformation (Bromberg et al. 1999), and that STATs are constitutively activated in various human hematological malignancies. STAT1 and STAT5 are activated in BCR-ABL-positive leukemias (Carlesso et al. 1996; Frank & Varticovski 1996; Shuai et al. 1996) and STAT1, STAT3 and STAT5 are constitutively activated in acute leukemia blasts (Gouilleux-Gruart et al. 1996; Spiekermann et al. 2001; Weber-Nordt et al. 1996; Xia et al. 1998).
Adult T cell leukemia (ATL), which is caused by the human T-cell leukemia virus type I (HTLV-I) infection, is a mature CD4+ T cell malignancy with a marked expansion of leukemic cells during the acute phase. Transformation of T-cells by HTLV-I is associated with constitutive activation of the JAK-STAT pathway (Migone et al. 1995; Xu et al. 1995). Leukemia cells obtained from ATL patients also showed constitutive activation of STATs (Takemoto et al. 1997; Tsukada et al. 2000). Takemoto et al. (1997) observed constitutive activation of STAT1, STAT3 and STAT5 in leukemic cells of ATL patients, and demonstrated the association of leukemic cell proliferation with constitutive JAK/STAT activity.
STAT4 is a crucial mediator of interleukin (IL)-12-stimulated gene regulation (Bacon et al. 1995b; Jacobson et al. 1995). In fact, the development of type-1 helper T (Th1) cells and production of interferon (IFN)-
in response to IL-12 are disrupted in STAT4-deficient mice (Kaplan et al. 1996; Thierfelder et al. 1996). STAT4 is phosphorylated on tyrosine 693 by JAK2 and Tyk2 (Bacon et al. 1995a; Cho et al. 1996). Moreover, IL-12 activates the p38/MKK6 signaling pathway that in turn phosphorylates STAT4 on serine 721 (Visconti et al. 2000). Activation of p38 and its upstream activator MKK6 is an important step for IL-12-induced STAT4 transcriptional activity (Visconti et al. 2000; Zhang & Kaplan 2000). In fact, previous studies indicated that IFN-
production is blocked by a p38 inhibitor (Rincon et al. 1998; Zhang & Kaplan 2000). Furthermore, transgenic mice expressing a dominant-negative p38 showed impaired Th1 differentiation (Rincon et al. 1998). Importantly, phosphorylation of STAT4 on serine 721 through the MKK6/p38 pathway is critical for IL-12-induced IFN-
production, but not for IL-12-induced cell proliferation (Morinobu et al. 2002).
In the present study, we show that STAT4 in HTLV-I transformed T-cell lines MT-2, MT-4 and HUT-102 is activated constitutively as assessed by Western blot, immunoprecipitation and electrophoretic mobility shift assay (EMSA) using a radiolabeled high-affinity sis-inducible element (hSIE). In HTLV-I-transformed T-cells, STAT4 was constitutively phosphorylated on serine 721 as well as on tyrosine 693, and generated a heterodimer with STAT3. Moreover, STAT4 synergized with STAT3 to transactivate hSIE.
| Results |
|---|
|
|
|---|
Unlike STAT1, the expression of STAT4 is observed in limited types of tissues such as testis, spleen, lung, bone marrow, thymus and muscle (Yamamoto et al. 1994; Zhong et al. 1994). Several T cell lines including EL4 and DA2 have been reported to contain no STAT4 transcripts (Yamamoto et al. 1994). However, as shown in Fig. 1, tyrosine-phosphorylated STAT4 was detected in HTLV-I-transformed cell lines MT-2, MT-4 and HUT102 (lanes 13). The amount of tyrosine-phosphorylated STAT4 proteins in MT-4 appeared to be greater than those of the other two cell lines. In addition, Western blotting with an Ab to STAT4 phosphorylated on serine 721 (anti-p-ser STAT4 Ab) showed that in HTLV-I-transformed cell lines, STAT4 protein was constitutively phosphorylated not only on tyrosine but also on serine 721 (lanes 46).
|
In the present study, we further investigated the possible contribution of JAK2, Tyk2 and p38 to serine- and tyrosine-phosphorylation of STAT4 in HTLV-I-transformed cell lines. As shown in Fig. 2A, immunoprecipitation of cell extracts with 4G10, followed by Western blotting with Abs against JAK2 and Tyk2 showed constitutive activation of JAK2 and Tyk2, respectively. Moreover, Western blotting with anti-p38 Ab and a specific Ab to p38 phosphorylated on threonine 180 and tyrosine 182 (anti-p-p38 Ab) demonstrated constitutive activation of p38 in HTLV-I-transformed cell lines (Fig. 2B, lanes 68). In contrast, peripheral blood mononuclear cells showed no phosphorylated p38 in comparison to the weak, but significant expression of p-38 (Fig. 2B, lanes 1 and 5).
|
As shown in Fig. 3A (lanes 13), in addition to STAT4 we observed constitutive tyrosine-phosphorylation of STAT3 in HTLV-I-transformed cells. In this respect, a recent study showed that IL-12 induced heterodimer formation of STAT3 with STAT4 (Jacobson et al. 1995). To examine whether or not STAT4 dimerizes with STAT3 in HTLV-I-transformed cells, cell lysates from MT-2, MT-4 and HUT102 were immunoprecipitated with anti-STAT3 Ab and immunoblotted with either anti-STAT4 Ab or anti-p-ser STAT4 Ab. Anti-STAT3 immunoprecipitates contained STAT4 phosphorylated on serine residue (Fig. 3A, lanes 79). Immunoprecipitation study with anti-STAT4 Ab also showed association of tyrosine-phosphorylated STAT3 with STAT4 (Fig. 3B, lanes 16). In order to confirm the specificities of anti-STAT3 and anti-STAT4 Abs, respectively, we compared the migration patterns of STAT4 and STAT3 by using a longer sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). As shown in Fig. 3C, STAT3 migrated with a slightly slower mobility compared to STAT4. Moreover, Western blotting with anti-STAT4 Ab and 293T cells showed that STAT4 protein was observed only after the introduction of Rc/CMV-STAT4 into the cells (Fig. 3D, lanes 2 and 3). The introduction of Rc/CMV-STAT3 into 293T cells made preexisting STAT3 expression even more significant (Fig. 3D, lanes 5 and 6).
|
|
Transcriptional regulation of hSIE in HTLV-I-transformed cells
To determine the functional importance of STAT4 in HTLV-I transformed cell lines, pGLmfoshSIE was transiently transfected into MT-2 cells. A single copy of the hSIE was inserted into the pGL2 Basic vector along with the minimal murine c-fos promoter (pGLmfoshSIE). The presence of a single copy of hSIE resulted in an approximately twofold increase in activity, compared with that of pGLmfos control vector (Fig. 5A). Furthermore, a STAT4 expression vector, Rc/CMV-STAT4 and/or a STAT3 expression vector Rc/CMV-STAT3, were cotransfected along with pGLmfoshSIE into MT-2 (Fig. 5B). The transcriptional activities for hSIE were enhanced following cotransfection of Rc/CMV-STAT4 or of Rc/CMV-STAT3 in a dose dependent manner. Interestingly, introduction of both Rc/CMV-STAT3 and Rc/CMV-STAT4 along with pGLmfoshSIE into MT-2 resulted in synergistic transcriptional activation of hSIE by STAT3 and STAT4.
|
As shown in Figs 4 and 5, STAT3/4 heterodimer is a sequence-specific activator which recognizes SIE. In this regard, since the c-fos promoter possesses the SIE (Sadowski et al. 1993), we further examined c-fos protein expression in HTLV-I-transformed cells by using Western blotting. c-fos protein was constitutively expressed in HTLV-I-transformed cells (Fig. 6).
|

STAT4 is an important factor for IL-12-induced IFN-
production. In the present study, using the RT-PCR technique, we examined the expression level of IFN-
mRNA in HTLV-I-transformed cells. As shown in Fig. 7A, IFN-
expression was detected in all cells examined.
|
protein production in HTLV-I-transformed cells was examined by using Western blotting with an Ab specific to IFN-
protein. As a result, IFN-
protein was detected in all HTLV-I-transformed cells examined (Fig. 7B, lanes 2-4). In contrast, no significant expression of IFN-
protein was observed in untreated MNC (Fig. 7B, lane 1).
STAT4 is activated by IFN-
as well as IL-12 (Cho et al. 1996). However, examination of IL-12 and IFN-
protein production in HTLV-I-transformed cells by ELISA failed to show any apparent production of these two proteins (data not shown).
| Discussion |
|---|
|
|
|---|
The relevance of phosphorylation of serine 721 in STAT4 has been recently reported. Serine phosphorylation of STAT4 is dispensable for nuclear translocation or DNA binding of STAT4, but is indispensable for its maximal transcriptional activity (Visconti et al. 2000). In contrast, phosphorylation of a conserved C-terminal tyrosine residue of STAT proteins is necessary for their cytokine-induced dimerization and DNA binding (Becker et al. 1998; Chen et al. 1998). In this regard, it should be noted that serine 721 phosphorylation of STAT4 is required for IL-12-induced IFN-
production and IL-12-mediated Th1 development, but not for IL-12-induced cell proliferation (Morinobu et al. 2002). Furthermore, they have shown that serine phosphorylation of STAT4 is partially dependent on precedent tyrosine phosphorylation of STAT4, whereas tyrosine phosphorylation of STAT4 can be seen even in the absence of serine phosphorylation. In the present study, we showed that both serine 721 and tyrosine 693 in STAT4 were constitutively phosphorylated in HTLV-I-transformed T-cells. In contrast to our data, it has been shown that in leukemic cells from chronic lymphocytic luekemia patients, STAT1 and STAT3 are constitutively phosphorylated on serine 727, but not on tyrosine residue (Frank et al. 1997). In the other leukemias such as AML and ALL, serine phosphorylation of the STATs was occasionally seen (Frank et al. 1997; Hayakawa et al. 1998). Thus, STATs may have selective effects on gene expression of leukemia cells in a manner dependent upon serine phosphorylation.
It has been well demonstrated that STAT1 can form a heterodimer with STAT2 (Ghislain & Fish 1996) or STAT3 (Sadowski et al. 1993). In the present study, when whole cell extracts of HTLV-I-transformed cells were immunoprecipitated with either anti-STAT3 or anti-STAT4, coprecipitation of STAT4 with STAT3 was observed vice versa, indicating heterodimer formation between the two proteins. Similar results were obtained in EMSA, which showed that an hSIE/MT-2 nuclear protein complex contained both STAT3 and STAT4. With this respect, it is of importance to note that STAT4 and STAT3 have been reported to form a heterodimer in response to IL-12 (Jacobson et al. 1995). Consistent with our results, they further demonstrated that hSIE preferentially binds to STAT3/STAT4 heterodimer, but not to homodimers of each STAT. In our current study, transfection studies using expression vectors for STAT3 and STAT4 revealed that the two proteins transactivate hSIE synergistically.
STAT4, which is activated through stimulation by IL-12, plays an important role in Th1 cell differentiation and IFN-
production. However, HTLV-I-transformed cells examined in the present study expressed neither IL-12 nor IFN-
. Although the functional significance of constitutive STAT4 activation remains unclear, we observed spontaneous IFN-
production in HTLV-I-transformed cells. The fact that the JAK/STAT signaling pathway is one of the attractive targets for leukemia therapies further argues the importance of constitutive STAT4 activation in HTLV-I-transformed cells.
| Experimental procedures |
|---|
|
|
|---|
HTLV-I-infected T-cell lines MT-2, MT-4 and HUT-102, Jurkat T cell, and human endothelial kidney 293T cells were used in the present study. The HTLV-I-infected T-cell lines were cultured in RPMI-1640 medium and the human endothelial kidney 293T cells were cultured in DMEM suppulemented with 10% fetal calf serum, 0.5% of penicillin and streptomycin in a humidified incubator under 5% CO2 at 37 °C. In some experiments, peripheral blood mononuclear cells (MNC) obtained from healthy volunteers were used. A single copy of hSIE (AGCTTGTGCATTTCCCGTAAATCTTGTCG) was inserted into pGL2mfos, a pGL2 Basic vector (Promega, Madison, WI) with the minimal (56 to +109) murine c-fos promoter (pGLmfoshSIE). Expression vectors for STAT4 (Rc/CMV-STAT4) and STAT3 (Rc/CMV-STAT3) (Zhong et al. 1994) were kindly provided by Dr J.E. Darnell (Laboratory of Molecular Cell Biology, The Rockefeller University, New York, NY, USA).
Antibodies and oligonucleotides
Anti-STAT4 antibody (Ab), anti-STAT3 Ab, antiphospho-serine 721 STAT4 Ab (p-ser STAT4), antiphospho-tyrosine 705 STAT3 Ab (p-tyr STAT3), anti-JAK2 Ab, anti-Tyk2 Ab, anti-p-tyr Ab, anti-IFN-
Ab and anti-c-fos Ab were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA). Anti-p38 Ab and anti-p-p38 (Thr180/Tyr182) Ab were purchased from Cell Signaling Technology (Beverly, MA, USA). The agarose conjugate of anti-p-tyr Ab 4G10 were purchased from Upstate Biotechnology (Lake Placid, NY, USA). The nucleotide sequences of oligonucleotides used in this study were as follows: wild-type STAT3 (wt-STAT3), 5'-GATCCTTCTGGGAATTCCTAGATG-3' and mutated STAT3 (m-STAT3), 5'-GATCCTTCTGGGCCGTCCTAGATG-3', and wt-STAT4, 5'-GAGCCTGATTTCCCCGAAATGATGAGCTAG-3' and m-STAT4, 5'-GAGCCTGATTTCTTTGAAATGATGAGCTAG-3' (Santa Cruz Biotechnology Inc.).
Immunoprecipitation and Western blotting
Cells were washed twice in cold phosphate-buffered saline (PBS), and lysed in buffer (1 mM MgCl2 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES, pH 7.9], 10 mM KCl, 0.1% Triton X-100, 1 mM dithiothreitol [DTT], 20% glycerol, and 0.5 mM phenylmethylsulfonyl fluoride [PMSF]) containing 0.2 µg of antipain, aprotinin, chymostatin, leupeptin, pepstatin A, 1 mmol/L of ZnCl2 and sodium orthovanadate and 10 mmol/L NaF on ice for 15 min. Immunoprecipitation was performed according to the instructions provided by the manufacturer. Immunoprecipitates were resolved on 616% polyacrylamide gel and were transferred onto nitrocellulose membranes. The blots were incubated with the appropriate Abs and detected with the immunostar kit (Wako Chemicals, Osaka, Japan), according to the protocol provided.
Nuclear extracts and electrophoretic mobility shift assay
hSIE was used as a 32P-labeled probe in this study. Nuclear extracts of HTLV-I-transformed cells were prepared as described previously (Shirakawa et al. 1993). EMSA was also performed as described previously with some modifications (Kominato et al. 1995). Total reaction volume was 18 µL, which included 4 µg nuclear extract, 1 µg poly (dI-dC), and 0.2 ng of 32P end-labeled hSIE probe. The binding buffer was 10 mM Tris-HCl [pH 7.5], 1 mM ethylenediaminetetraacetic acid [EDTA], 1 mM 2-mercaptoethanol, 4% glycerol, and 40 mM NaCl. Protein-DNA complexes were resolved on 4% TBE polyacrylamide gels using 0.5 x TBE (45 mmol/L Tris-borate and 1 mmol/L EDTA) as the running buffer. Unlabeled competitors were used in a 50-fold molecular excess over the radiolabeled probe. In EMSA experiments using Abs, nuclear extracts were incubated with the appropriate Abs at room temparature for 30 min.
Reverse transcription-polymerase chain reaction
Total RNAs of HTLV-I-transformed cells were extracted by Isogen RNA extraction kit (Nippon Gene, Tokyo). Total RNA 1 µg was used along with a reverse transcriptase RNA PCR kit; Access RT-PCR System (Promega) according to the instructions provided by the supplier. An aliquot of the PCR mixture was subjected to electrophoresis in 2% agarose gel. Primers of human IFN-
(5'-ATGAAATATACAAGTTATATCTTGGCTTT-3' and 5'-GATGCTCTTCGACCTCGAAACAGCAT-3') were purchased from Toyobo (Osaka, Japan). ß-actin PCR primers were synthesized as follows: sense, 5'-TCATGAAGTGTGACGTTGACATCCGT-3', and antisense 5'-CCTAGAAGCATTTGCGGTGCAAGATG-3'.
Enzyme-linked immunosorbent assay
HTLV-I-transformed cells were cultured at a density of 1 x 107 cells per 10 mL for 24 h and concentrations of IFN-
and IL-12 in the supernatants were measured by using ELISA. Cell extracts were prepared from incubation of 1 x 108 cells in 1 mL of cell lysis buffer used in Western blotting.
Transfections and luciferase assays
Transfection of plasmids into MT-2 cells was carried out by using a transfection kit; Transfast (Promega) using the protocol recommended by the manufacturer. Cells were lysed with Passive Lysis Buffer (Promega). The cell lysates were used for a dual-luciferase reporter assay system (Promega). Samples were normalized to Renilla luciferase activity as an internal control for transfection efficiency.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: jtsukada{at}med.uoeh-u.ac.jp
| References |
|---|
|
|
|---|
Bacon, C.M., Petricoin, E.F. 3rd, Ortaldo, J.R., et al. (1995b) Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA
92, 73077311.
Becker, S., Groner, B. & Muller, C.W. (1998) Three-dimensional structure of the Stat3ß homodimer bound to DNA. Nature 394, 145151.[CrossRef][Medline]
Benekli, M., Xia, Z., Donohue, K.A., et al. (2002) Constitutive activity of signal transducer and activator of transcription 3 protein in acute myeloid leukemia blasts is associated with short disease-free survival. Blood
99, 252257.
Bowman, T., Garcia, R., Turkson, J. & Jove, R. (2000) STATs in oncogenesis. Oncogene 19, 24742488.[CrossRef][Medline]
Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., et al. (1999) Stat3 as an oncogene. Cell 98, 295303.[CrossRef][Medline]
Carlesso, N., Frank, D.A. & Griffin, J.D. (1996) Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med.
183, 811820.
Chen, X., Vinkemeier, U., Zhao, Y., Jeruzalmi, D., Darnell, J.E. Jr & Kuriyan, J. (1998) Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 93, 827839.[CrossRef][Medline]
Cho, S.S., Bacon, C.M., Sudarshan, C., et al. (1996) Activation of STAT4 by IL-12 and IFN-
: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol.
157, 47814789.[Abstract]
Coffer, P.J., Koenderman, L. & de Groot, R.P. (2000) The role of STATs in myeloid differentiation and leukemia. Oncogene 19, 25112522.[CrossRef][Medline]
Danial, N.N., Pernis, A. & Rothman, P.B. (1995) Jak-STAT signaling induced by the v-abl oncogene. Science
269, 18751877.
Darnell, J.E.
Jr (1997) STATs and gene regulation. Science
277, 16301635.
Frank, D.A., Mahajan, S. & Ritz, J. (1997) B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J. Clin. Invest. 100, 31403148.[Medline]
Frank, D.A. & Varticovski, L. (1996) BCR/abl leads to the constitutive activation of Stat proteins, and shares an epitope with tyrosine phosphorylated Stats. Leukemia 10, 17241730.[Medline]
Ghislain, J.J. & Fish, E.N. (1996) Application of genomic DNA affinity chromatography identifies multiple interferon-
-regulated Stat2 complexes. J. Biol. Chem.
271, 1240812413.
Gouilleux-Gruart, V., Gouilleux, F., Desaint, C., et al. (1996) STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood
87, 16921697.
Hayakawa, F., Towatari, M., Iida, H., et al. (1998) Differential constitutive activation between STAT-related proteins and MAP kinase in primary acute myelogenous leukaemia. Br. J. Haematol. 101, 521528.[CrossRef][Medline]
Ihle, J.N. (2001) The Stat family in cytokine signaling. Curr. Opin. Cell Biol. 13, 211217.[CrossRef][Medline]
Jacobson, N.G., Szabo, S.J., Weber-Nordt, R.M., et al. (1995) Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med.
181, 17551762.
Kaplan, M.H., Sun, Y.L., Hoey, T. & Grusby, M.J. (1996) Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382, 174177.[CrossRef][Medline]
Kominato, Y., Galson, D., Waterman, W.R., Webb, A.C. & Auron, P.E. (1995) Monocyte expression of the human prointerleukin 1 ß gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1. Mol. Cell. Biol. 15, 5968.[Abstract]
Leonard, W.J. & O'Shea, J.J. (1998) Jaks and STATs: biological implications. Annu. Rev. Immunol. 16, 293322.[CrossRef][Medline]
Levy, D.E. & Gilliland, D.G. (2000) Divergent roles of STAT1 and STAT5 in malignancy as revealed by gene disruptions in mice. Oncogene 19, 25052510.[CrossRef][Medline]
Levy, D.E., Kessler, D.S., Pine, R. & Darnell, J.E.
Jr (1989) Cytoplasmic activation of ISGF3, the positive regulator of interferon-
-stimulated transcription, reconstituted in vitro. Genes Dev.
3, 13621371.
Lin, T.S., Mahajan, S. & Frank, D.A. (2000) STAT signaling in the pathogenesis and treatment of leukemias. Oncogene 19, 24962504.[CrossRef][Medline]
Migone, T.S., Lin, J.X., Cereseto, A., et al. (1995) Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science
269, 7981.
Morinobu, A., Gadina, M., Strober, W., et al. (2002) STAT4 serine phosphorylation is critical for IL-12-induced IFN-
production but not for cell proliferation. Proc. Natl. Acad. Sci. USA
99, 1228112286.
Ohashi, T., Masuda, M. & Ruscetti, S.K. (1995) Induction of sequence-specific DNA-binding factors by erythropoietin and the spleen focus-forming virus. Blood
85, 14541462.
Rincon, M., Enslen, H., Raingeaud, J., et al. (1998) Interferon-gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J. 17, 28172829.[CrossRef][Medline]
Sadowski, H.B., Shuai, K., Darnell, J.E.
Jr & Gilman, M.Z. (1993) A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science
261, 17391744.
Schindler, C., Shuai, K., Prezioso, V.R. & Darnell, J.E.
Jr (1992) Interferon-dependent tyrosine phosphorylation of a latent cytoplasmic transcription factor. Science
257, 809813.
Shirakawa, F., Saito, K., Bonagura, C.A., et al. (1993) The human prointerleukin 1 ß gene requires DNA sequences both proximal and distal to the transcription start site for tissue-specific induction. Mol. Cell. Biol.
13, 13321344.
Shuai, K., Halpern, J., ten Hoeve, J., Rao, X. & Sawyers, C.L. (1996) Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene 13, 247254.[Medline]
Shuai, K., Schindler, C., Prezioso, V.R. & Darnell, J.E.
Jr (1992) Activation of transcription by IFN-
: tyrosine phosphorylation of a 91-kD DNA binding protein. Science
258, 18081812.
Spiekermann, K., Biethahn, S., Wilde, S., Hiddemann, W. & Alves, F. (2001) Constitutive activation of STAT transcription factors in acute myelogenous leukemia. Eur. J. Haematol. 67, 6371.[Medline]
Takemoto, S., Mulloy, J.C., Cereseto, A., et al. (1997) Proliferation of adult T cell leukemia/lymphoma cells is associated with the constitutive activation of JAK/STAT proteins. Proc. Natl. Acad. Sci. USA
94, 1389713902.
Thierfelder, W.E., van Deursen, J.M., Yamamoto, K., et al. (1996) Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382, 171174.[CrossRef][Medline]
Tsukada, J., Toda, Y., Misago, M., Tanaka, Y., Auron, P.E. & Eto, S. (2000) Constitutive activation of LIL-Stat in adult T-cell leukemia cells. Blood
95, 27152718.
Visconti, R., Gadina, M., Chiariello, M., et al. (2000) Importance of the MKK6/p38 pathway for interleukin-12-induced STAT4 serine phosphorylation and transcriptional activity. Blood
96, 18441852.
Weber-Nordt, R.M., Egen, C., Wehinger, J., et al. (1996) Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines. Blood
88, 809816.
Xia, Z., Baer, M.R., Block, A.W., Baumann, H. & Wetzler, M. (1998) Expression of signal transducers and activators of transcription proteins in acute myeloid leukemia blasts. Cancer Res.
58, 31733180.
Xu, X., Kang, S.H., Heidenreich, O., Okerholm, M., O'Shea, J.J. & Nerenberg, M.I. (1995) Constitutive activation of different Jak tyrosine kinases in human T cell leukemia virus type 1 (HTLV-1) tax protein or virus-transformed cells. J. Clin. Invest. 96, 15481555.
Yamamoto, K., Quelle, F.W., Thierfelder, W.E., et al. (1994) Stat4, a novel gamma interferon activation site-binding protein expressed in early myeloid differentiation. Mol. Cell. Biol.
14, 43424349.
Zhang, S. & Kaplan, M.H. (2000) The p38 mitogen-activated protein kinase is required for IL-12-induced IFN-
expression. J. Immunol.
165, 13741380.
Zhong, Z., Wen, Z. & Darnell, J.E.
Jr (1994) Stat3 and Stat4: members of the family of signal transducers and activators of transcription. Proc. Natl. Acad. Sci. USA
91, 48064810.
Received: 6 June 2005
Accepted: 16 September 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |