GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 181-191. doi:10.1111/j.1365-2443.2005.00831.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibata, T.
Right arrow Articles by Shinagawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibata, T.
Right arrow Articles by Shinagawa, H.

Functional overlap between RecA and MgsA (RarA) in the rescue of stalled replication forks in Escherichia coli

Tatsuya Shibata1, Takashi Hishida1,*, Yoshino Kubota1, Yong-Woon Han3, Hiroshi Iwasaki4 and Hideo Shinagawa1,2

1 Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan
2 CREST, Japan Science and Technology Agency, Osaka 565-0871, Japan
3 The Tokyo Metropolitan Institute of Medical Science, Tokyo 113-8613, Japan
4 Graduate School of Integrated Science, Yokohama City University, Yokohama, 230-0045, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Escherichia coli RecA protein plays a role in DNA homologous recombination, recombination repair, and the rescue of stalled or collapsed replication forks. The mgsA (rarA) gene encodes a highly conserved DNA-dependent ATPase, whose yeast orthologue, MGS1, plays a role in maintaining genomic stability. In this study, we show a functional relationship between mgsA and recA during DNA replication. The mgsA recA double mutant grows more slowly and has lower viability than a recA single mutant, but they are equally sensitive to UV-induced DNA damage. Mutations in mgsA and recA cause lethality in DNA polymerase I deficient cells, and suppress the temperature-dependent growth defect of dnaE486 (Pol III {alpha}-catalytic subunit). Moreover, recAS25P, a novel recA allele identified in this work, does not complement the slow growth of {Delta}mgsA {Delta}recA cells or the lethality of polA12 {Delta}recA, but is proficient in DNA repair, homologous recombination, SOS mutagenesis and SOS induction. These results suggest that RecA and MgsA are functionally redundant in rescuing stalled replication forks, and that the DNA repair and homologous recombination functions of RecA are separated from its function to maintain progression of replication fork.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Although genomic replication is characteristically an efficient and high fidelity process, its progress can be impeded by DNA damage, DNA bound proteins, DNA secondary structure or topological constraints. The rescue of replication forks stalled on the DNA template is important for normal growth and survival and for maintaining the integrity of the genome. Recent studies in Escherichia coli revealed two pathways that can facilitate the rescue of blocked replication forks. One pathway involves translesion DNA synthesis (TLS) through the action of a special class of DNA polymerases (Pham et al. 2001a; Sutton & Walker 2001). This pathway is apparently mutagenic, and it is not an efficient mechanism to bypass DNA strand breaks. The alternative pathway for rescuing a stalled replication fork is dependent on DNA recombination, which has been documented in a series of recent reviews (Cox et al. 2000; Kowalczykowski 2000; Marians 2000; Michel et al. 2001; Cox 2002; Courcelle & Hanawalt 2003). Thus, the process of rescuing a stalled replication fork is thought to require protein factors that are involved in DNA replication, DNA recombination and DNA repair.

RecA protein plays a central role in DNA homologous recombination by promoting strand exchange between homologous sequences and is a coprotease involved in activating the SOS response. RecA also participates in a TLS complex (Tang et al. 2000; Pham et al. 2001b). The aforementioned RecA functions are required for rescuing stalled or collapsed replication forks. Fork rescue utilizes RecA-mediated DSB repair. Briefly, RecBCD initially processes broken ends into 3' single-stranded DNA (ssDNA) tails. These ssDNA tails then invade homologous duplex DNA (D-loop formation) in a RecA-mediated mechanism. This is then followed by DNA synthesis utilizing the 3' end to regenerate a replication fork structure (Kowalczykowski 2000; Lusetti & Cox 2002). RecA-mediated gap filling is also involved in the rescue of stalled replication forks. In this process, recF pathway proteins load RecA on to gapped DNA, the result of which is that RecA promotes the invasion of ssDNA into homologous dsDNA (Morimatsu & Kowalczykowski 2003; Courcelle et al. 2004). Defects in these processes lead to inappropriate cell cycle progression or fork collapse, and can promote genomic instability. These data implicate that these recombination-associated proteins have an essential role in the mechanism to rescue stalled replication forks.

In previous study, we have identified the E. coli novel gene, mgs1 (an orthologue of Saccharomyces cerevisiae MGS1), which encodes a highly conserved member of the AAA+ class family of ATPases (Hishida et al. 2001). To follow the rule of nomenclature of the E. coli genes and to show it is an orthologue of MGS1, we renamed this gene mgsA. MgsA protein possesses DNA-dependent ATPase and ssDNA annealing activities (Hishida et al. 2001; data not shown). The same gene was designated rarA (Barre et al. 2001). EYFP-RarA foci is co-localized with the SeqA protein that binds to newly replicated hemi-methylated DNA (Sherratt et al. 2004) and a rarA mutant showed increased crossing over in the XerCD-mediated recombination at the dif site, located in the replication terminus region (Sherratt et al. 2004). These results suggest that RarA (MgsA) is associated with the replisome and plays an important role in the coordinated reaction between DNA replication and chromosomal segregation. Saccharomyces cerevisiae MGS1 (maintenance of genome stability 1) is an orthologue of mgsA. Yeast Mgs1 protein possesses DNA-dependent ATPase and ssDNA annealing activities (Hishida et al. 2001). mgs1{Delta} strains show an elevated level of spontaneous DNA recombination (Hishida et al. 2001; Branzei et al. 2002). Moreover, mgs1{Delta} is lethal in combination with rad6 or rad18 mutation and synergistically enhances the growth defect of rad5, indicating a genetic interaction between MGS1 and the RAD6 postreplication repair (PRR) pathway (Hishida et al. 2002). The lethality of the mgs1 rad18 double mutant can be suppressed by a mutation in SRS2 or by over-expression of Rad52, suggesting that a deficiency in homologous recombination can contribute to the lethal phenotype of mgs1 rad18. Mutation in MGS1 also suppresses the temperature-dependent growth defect of the pol3–13 mutant (Pol{delta}{alpha}-catalytic subunit) (Hishida et al. 2002). These findings suggest that the Mgs1 protein plays a pivotal role in preventing genomic instability caused by replication fork arrest.

In this paper we describe the characterization of E. coli orthologue of S. cerevisiae MGS1, mgsA. mgsA mutations reduce the growth rate and viability of {Delta}recA mutants, but have no effect on recA-dependent sensitivity to UV. A novel recA mutant, recAS25P, was isolated which is unable to rescue slow growth of {Delta}mgsA{Delta}recA cells. Although recAS25P cells are proficient in DNA repair, DNA homologous recombination and induction of SOS, these cells are deficient in the DNA replication- or DNA topology-associated functions of RecA. A functional analysis of mgsA and recA is presented, which provides novel insights into the mechanisms associated with the rescue of stalled replication forks in E. coli.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Over-expression of mgsA inhibits growth of recA mutant

During the initial cloning of E. coli mgsA, we observed that full-length mgsA could not be expressed in recA1 cells, but was expressed efficiently in wild-type recA cells. This result was confirmed by expressing mgsA from the alaC arabinose-inducible promoter (pBAD vector) in wild-type and {Delta}recA strains (Guzman et al. 1995). Wild-type and {Delta}recA cells carrying plasmid-borne inducible mgsA (pMgsA) grew efficiently under transcriptionally repressive conditions (0.2% glucose), as did cells carrying the pBAD vector alone (Fig. 1A). In contrast, wild-type cells carrying inducible mgsA grew slowly in the presence of inducer (0.2% arabinose), while {Delta}recA cells did not grow at all in the presence of inducer (Fig. 1A). These data indicate that over-expression of mgsA has a deleterious effect on cells, especially in the absence of RecA protein.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1  Over-expression of mgsA inhibits growth of the recA mutant and enhances mutation to Lac+. (A) Wild-type and {Delta}recA mutant cells harboring empty vector (vector) or plasmids with an arabinose-inducible wild-type mgsA gene (pMgsA) were plated on LB plates containing glucose or arabinose. (B) CC101-CC111 strains containing a defined sequence alteration in the lacZ gene on F' plasmid were transformed with either pTWV229 (empty vector) or pTW1 (mgsA+). Cells were washed twice in sodium phosphate buffer (66 mM, pH 7.2). Samples were plated on minimal glucose and lactose agar plates at appropriate dilution to determine the total cell number and the number of Lac+ revertants, respectively. Values are the average of three experiments.

 
Over-expression of mgsA causes an increase in mutation frequency

Incubation of {Delta}recA cells harboring pMgsA in the presence of arabinose led to the accumulation of spontaneous fast-growing mutant colonies. In an effort to determine whether over-expression of mgsA causes an increase in mutation frequency, we measured the mutation frequency in a series of E. coli reporter strains (CC101-CC111) with or without mgsA over-expression. For this experiment, mgsA with its native promoter was cloned into pBR322 to ensure constitutive expression, and the resulting plasmid, pTW1, was transformed into each of the mutagenesis reporter strains. Mutagenesis was assessed in each reporter strain by measuring the reversion to Lac+ on ß-galactosidase indicator plates (Fig. 1B) (Cupples et al. 1990; Kim et al. 1997). The results showed a 520-fold increase in –1G frameshift mutations in a G6 mononucleotide run when mgsA was over-expressed (Fig. 1B). Additionally, several other types of mutations including GC to TA and GC to AT base substitutions increased significantly. Thus, increasing the mgsA gene dosage is associated with a significant increase in frameshift and base-substitution mutations without any exogenous DNA damage agents.

Functional relationships between MgsA and RecA

A genetic interaction between mgsA and recA was confirmed in the course of our experiments and observations. mgsA mutation does not cause a defect in cell growth or the repair of methylmethanesulfonate-(MMS) or UV-induced DNA damage (data not shown). On the other hand, the {Delta}mgsA{Delta}recA double mutant grew more slowly than the {Delta}recA mutant, and the viability was reduced from 20% in {Delta}recA to 2.9% in {Delta}mgsA{Delta}recA (Table 1). These defects were complemented by the presence of the wild-type mgsA or recA gene within the plasmid (data not shown). RecA is essential for both homologous recombination and the SOS response in E. coli. The SOS response was therefore characterized by combining {Delta}mgsA with lexA3, an SOS-non-inducible allele (Little & Harper 1979). It had no effect on the growth of {Delta}mgsA cells (Table 1). This indicates that the homologous recombination activity, but not coprotease activity, of RecA is required for the growth of the mgsA mutant. Strikingly, although the {Delta}mgsA mutation alters the rate of growth and viability of {Delta}recA cells, the mgsA recA double mutant was equally sensitive to UV just as the recA single mutant (Fig. 2A). This suggests that MgsA is required for growth, and probably for DNA replication, but not for the repair of UV-induced DNA damage in the recA mutant.


View this table:
[in this window]
[in a new window]
 
Table 1  Growth rate and viability in the mgsA recA double mutant
 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 2  UV sensitivity and viability of recA, mgsA and mgsA recA strains. (A) Cells grown overnight at 37 °C were irradiated with a germicidal lamp, and the number of surviving cells were measured. •wild-type; {blacksquare}mgsA; {circ}recA; {triangleup}mgsA recA. (B) Effect of osmolarity on growth of the mgsA recA double mutant. Cells were grown overnight in LB medium lacking salt. Cells were diluted and plated on to LB containing 1% NaCl ({blacksquare}) or without NaCl (). The viability was calculated at the indicated times as the number of viable cells (cfu) divided by the number of total cells.

 
In addition, we found that the viability of the mgsA recA double mutants was dependent on the osmolarity of the growth medium. Under standard growth conditions, {Delta}mgsA{Delta}recA cells have lower viability than {Delta}recA cells. In contrast, {Delta}mgsA{Delta}recA and {Delta}recA cells have similar viability when grown in low osmolarity medium lacking NaCl (Fig. 2B). This may reflect osmolarity-dependent changes in DNA topology that have a greater impact on viability in mgsA recA rather than in mgsA or recA cells (see Discussion). It may also reflect the lower rates of growth in low salt medium since previous studies have shown that reducing the growth rate can abolish replication fork problems (Sandler et al. 1996).

Isolation of a recA mutant synergistic in growth defect with mgsA mutation

We propose here that the low viability and slow growth of {Delta}mgsA{Delta}recA cells may reflect a cellular defect in replication, but not a defect in DNA repair. This idea was tested by generating a library of recA mutants, and screening the library for DNA repair-proficient recA mutants that do not complement the growth defect of the {Delta}mgsA{Delta}recA mutant. Three candidate mutants were isolated after screening 2000 clones. Each of these clones carries a mutation that causes a serine to proline substitution at residue 25 (recAS25P). Figure 3A shows that recAS25P does not complement the growth defect of {Delta}mgsA{Delta}recA cells, although wild-type recA does restore normal growth to these cells. Characterization of recAS25P indicated that it encodes a protein that promotes the repair of UV-induced DNA damage and complements the repair-deficiency of {Delta}recA cells (Fig. 3B). Thus, we deduce that recAS25P is not deficient in DNA repair, but is likely to be deficient in a DNA replication-associated function. The nature of this defect is addressed below.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3  Effect of recAS25P mutant on growth, DNA repair and SOS induction. (A) {Delta}mgsA{Delta}recA cells harboring empty vector, or plasmid containing wild-type recA (pRecA) or recAS25P (pRecAS25P) were grown at 37 °C. (B) RecAS25P is proficient in UV-induced damage repair. •wild-type/vector; {blacksquare}{Delta}recA/vector; {circ}{Delta}recA/pRecA; {blacktriangleup}{Delta}recA/pRecAS25P. (C) RecAS25P is proficient in SOS induction. LexA degradation was measured as described in the Experimental procedures. Cells were UV-irradiated (time 0) and aliquots were sampled at intervals. Protein from the equivalent numbers of cells was analyzed on 15% SDS PAGE, and RecA and LexA proteins were detected by immunoblotting with anti-RecA and anti-LexA antibodies, respectively.

 
RecAS25P is proficient in SOS induction, SOS mutagenesis and homologous recombination

RecA is a multifunctional protein that functions in DNA recombination, DNA repair, SOS response, SOS mutagenesis, chromosomal segregation and DNA replication (Kowalczykowski et al. 1994; Lusetti & Cox 2002). We examined the effect of recAS25P in relation to the aforementioned processes. In the wild-type strain, UV-induced DNA damage leads to proteolytic inactivation of LexA, the repressor of the SOS regulon, and induces the SOS response. Figure 3C shows that the level of RecAS25P protein was similar to that of the wild-type strain and that LexA is degraded within 10 min following the onset of UV irradiation in the wild-type and recAS25P cells, suggesting that RecAS25P is proficient in the UV-induced SOS response. Additionally, recAS25P is capable of inducing mutagenesis following UV treatment and is proficient in homologous recombination (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2  RecAS25P is proficient in homologous recombination and SOS mutagenesis
 
Effect of recAS25P in cells treated with the DNA gyrase inhibitor coumermycin

If low viability of the mgsA recA double mutant is related to DNA topological stress, it is possible that RecAS25P might also lack the DNA topology-associated function. Hence, we examined the effect of the recAS25P mutation on sensitivity to coumermycin, an inhibitor of the gyrase B subunit that inhibits its ATPase activity (Gellert et al. 1976; Maxwell 1993). In this study, {Delta}recA cells expressing wild-type recA or recAS25P were tested for relative survival on solid media containing coumermycin. Figure 4A shows that {Delta}recA cells are sensitive to coumermycin, and that this effect is complemented by expression of wild-type recA from a plasmid. However, sensitivity to coumermycin is not complemented by expression of recAS25P (Fig. 4A). This is not due to a dominant negative effect, since expression of recAS25P in wild-type E. coli did not result in sensitivity to coumermycin (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 4  Effect of recAS25P mutation on coumermycin sensitivity and polA12{Delta}recA. (A) Cells grown overnight at 37 °C were diluted and plated on to LB containing the indicated amount of coumermycin A1. Colony-forming units were counted after overnight incubation. (B) Cells grown at 26 °C were diluted and spotted on to LB plates containing 0.2% glucose or 0.2% arabinose. The plates were UV-irradiated and incubated overnight at 37 °C (upper column) or incubated at 26 °C or 37 °C for 24 h (lower column).

 
Effect of recAS25P on polA recA lethality

The polA gene encodes DNA polymerase I that possesses DNA polymerase, 5'- to 3'-exonuclease, and 3' to 5' exonuclease activities. A polA12 mutant represents a temperature sensitive allele, which is active at 30 °C but defective in polymerase I activity at 42 °C (Monk & Kinross 1972; Uyemura & Lehman 1976). Previous studies have shown that the polA12 recA double mutant is temperature sensitive for growth: the polA12 mutant is viable at 26 °C, 37 °C and 42 °C, whereas the polA12 recA double mutant is viable at 26 °C, but not at 37 °C (Fig. 4B) (Monk & Kinross 1972; Cao & Kogoma 1995; Ishioka et al. 1998). These facts indicate that the double mutant is deficient in coordinating DNA replication and DNA recombination at the restrictive temperature. Consequently, if RecAS25P is deficient in DNA replication-associated function, we predicted that RecAS25P would not complement the temperature-dependent lethality of the polA12{Delta}recA double mutant. In this experiment, complementing plasmids represented derivatives of pSC101, since polA12 mutants are unable to maintain ColE1-type plasmids (Tacon & Sherratt 1976). The complementing genes were expressed from the arabinose-inducible araC promoter. Wild-type recA plasmid complements the UV sensitivity in the {Delta}recA mutant and complements the temperature sensitivity of the polA12{Delta}recA mutant in the presence of arabinose (Fig. 4B). The recAS25P plasmid complements the UV sensitivity of the {Delta}recA mutant, but does not complement the temperature sensitivity of the polA12{Delta}recA mutant in the presence of arabinose (Fig. 4B).

Functional interactions between MgsA and DNA polymerases

Characterization of RecAS25P imply that MgsA shares with RecA an important role in promoting the rescue of stalled replication forks. To explore the possibility, MgsA was tested for genetic interactions with all DNA polymerases (PolI–PolV). The {Delta}mgsA mutation did not affect the UV sensitivity or the growth rate of {Delta}polB (PolII), {Delta}dinB (PolIV) or {Delta}umuC (PolV) mutants (data not shown). The polA1 mutant, which is deficient in the Klenow domain containing DNA polymerase and 3' to 5' exonuclease activities (Joyce et al. 1985; Nagata et al. 2002), is synthetic lethal with the {Delta}recA mutation. The polA1{Delta}mgsA double mutant exhibited severe temperature sensitivity for growth with a plating efficiency of only 0.4% at 42 °C compared to that at 30 °C (Table 3 and Fig. S1 at http://www.blackwellpublishing.com/products/journals/suppmat/GTC/GTC831/GTC831.htm).


View this table:
[in this window]
[in a new window]
 
Table 3  mgsA mutation makes polA1 mutant highly temperature-sensitive
 
dnaE486 represents a temperature sensitive allele of the DNA polymerase III {alpha}-catalytic subunit (Kelman & O'Donnell 1995; Vandewiele et al. 2002). This strain ceases to grow and becomes highly filamented after 2 h at semirestrictive temperature (38 °C), but retains colony-forming ability even after 6 h at 38 °C (Fig. 5A) (Wechsler & Gross 1971; Hishida et al. 2004). Figure 5A shows that both the recA and mgsA mutations suppress the growth inhibition of the dnaE486 strain at 38 °C. Morphological analysis shows that the filamentation observed in the dnaE486 mutant at 38 °C was significantly reduced in the dnaE486{Delta}mgsA and the dnaE486{Delta}recA mutants (Fig. 5B). The ability of the mgsA and recA mutations to suppress the filamentation in the dnaE486 mutant, however, was associated with formation of a high proportion of anucleate cells. Consistent with these results, the presence of wild-type RecA within a plasmid reverses the growth of the dnaE486{Delta}recA mutant at 38 °C, but RecAS25P does not (Table 4). These results suggest that RecA and MgsA play an overlapping role in preventing aberrant DNA replication.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 5  recA and mgsA mutations suppress the temperature-sensitivity of the dnaE486 strain. (A) Cells were incubated at 30 °C and then cultures were shifted to 38 °C. Cells were plated on to LB plates. Colony-forming units were counted after overnight incubation at 30 °C. •dnaE486; {blacksquare}dnaE486 recA; {circ}dnaE486 mgsA. (B) Morphological analysis of dnaE486, dnaE486 recA and dnaE486 mgsA mutant cells. Cells were grown to early log phase at 30 °C and then grown at 38 °C for 6 h. Cells were subsequently stained with DAPI. White arrows highlight some anucleate cells. Wild-type, {Delta}mgsA and {Delta}recA cells were the same at both 30 °C and 38 °C, and indistinguishable from dnaE486 cells at 30 °C.

 

View this table:
[in this window]
[in a new window]
 
Table 4  The recAS25P mutation does not complement the synthetic growth phenotype of the dnaE486{Delta}recA mutant at 38 °C
 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
This study presents an analysis of the role of MgsA and RecA during DNA replication. mgsA deficient cells grow normally and are proficient in the repair of MMS- and UV-induced DNA damage. This study indicates a probable role for MgsA in preventing genomic instability and rescuing stalled replication forks. mgsA interacts genetically with recA. mgsArecA cells grow more slowly and have lower viability than recA cells, although mgsA-deficiency does not increase the UV sensitivity of recA cells. Moreover, the SOS non-inducible allele lexA3 does not change the rate of growth of mgsA cells, making it unlikely that mgsA deficiency interferes with a DNA repair function required during SOS. These results suggest that RecA is required for a replication-coupled reaction in mgsA-deficient cells and that wild-type MgsA likely participates in a related or overlapping function in E. coli.

Characterization of RecAS25P

This study has identified a novel recessive recA allele, recAS25P, that does not complement the slow growth phenotype of {Delta}mgsA{Delta}recA cells, but does complement the UV sensitivity of {Delta}recA and {Delta}mgsA{Delta}recA cells (Fig. 3; data not shown). recAS25P is allele-specific. recAS25A mutation (serine 25 substituted by alanine) does not affect any RecA activities examined in this study (data not shown). Exactly what function of RecA is required in mgsA-deficient cells? RecAS25P is proficient in DNA repair, recombination, SOS mutagenesis and SOS induction (Fig. 3 and Table 2). However, the recAS25P mutant is deficient in tolerance to coumermycin-induced growth inhibition. It is thought that DNA gyrase removes positive supercoils ahead of the fork, therefore allowing DNA replication to continue (Levine et al. 1998; Postow et al. 2001). One explanation for these results is that coumermycin-induced inhibition of DNA gyrase causes accumulation of topological stress in replicating chromosomes leading to replication fork arrest, and that RecAS25P is specifically deficient in the ability to rescue such stalled replication forks. Alternatively, inhibition of gyrase might lead to replication fork breakdown, and RecAS25P is deficient in processing the double-stranded DNA end generated by this breakdown. Moreover, recAS25P is deficient in complementation of the synthetic growth phenotype of the dnaE486{Delta}recA mutant or polA12{Delta}recA strains, consistent with the replication-associated function defect of RecAS25P. Thus, the property of the RecAS25P protein leads us to consider a function of RecA in replication distinct from its role in genetic recombination and recombination repair. Courcelle et al. (2003) presented evidence that RecA stabilizes damaged replication forks until the block to replication has been removed or bypassed. RecAS25P might be disabled in the putative stabilization of damaged replication forks. Biochemical and structural studies of RecAS25P will provide important clues to understanding the complex interplay between DNA replication and DNA recombination functions, especially at stalled replication forks.

Overlapping function of RecA and MgsA in DNA replication

Previous studies have shown that recA is synthetically lethal with polA1 (PolI) and partially suppresses the temperature sensitivity of dnaE486 (PolIII) at the semipermissive temperature of 38 °C (Monk & Kinross 1972; Grompone et al. 2002; Hishida et al. 2004). Similarly, the mgsA mutation generates temperature sensitivity for growth at 42 °C in polA1 cells and also suppresses the temperature sensitivity and filamentation phenotype of dnaE486 (PolIII) at 38 °C (Table 3 and Fig. 5). The ability of the mgsA or recA mutation to suppress the filamentation in the dnaE486 mutant was associated with the appearance of a high proportion of anucleate cells (Fig. 5B). One possible explanation for these results is that dnaE486 cells deficient in recA or mgsA fail to properly arrest replication and allow aberrant DNA replication to take place at 38 °C, but that resumption of this situation results in the production of a high proportion of anucleate cells. Thus, RecA and MgsA may contribute to the faithful recovery of stalled replication forks and thereby the prevention of genomic instability caused by aberrant DNA replication. Additionally, RecA and MgsA may play an overlapping role in chromosomal segregation. According to the current model of bacterial chromosome replication and segregation, replication fork progression is concurrent with chromosomal segregation, and the coordinated reaction between them are fundamental to the segregation process (Glaser et al. 1997; Webb et al. 1997; Li et al. 2002; Lau et al. 2003). Therefore, the recA and mgsA mutations allow replication fork progression in dnaE486 cells at 38 °C, but the suppression of the replication arrest in the mutants may affect the chromosomal segregation process, leading to the production of a high proportion of anucleate cells. This is consistent with a report that MgsA protein co-localizes with the replisome and affects chromosome segregation (Lau et al. 2003).

Another clue to the overlapping function between RecA and MgsA comes from the observation that the viability of the mgsA recA double mutant is significantly influenced by the salt concentration in the growth medium (Fig. 2B). Low osmolarity culture media enhances the viability of {Delta}mgsA{Delta}recA cells relative to {Delta}recA cells. It has previously been shown that media of low osmolarity also allow topA mutants to grow in the absence of compensatory mutations in gyrA or gyrB (Dorman et al. 1989), and that low osmolarity culture media favors relaxation of DNA topological stress. These data are consistent with the observation that recAS25P cells are hypersensitive to DNA gyrase inhibitor. It is therefore likely that MgsA may play a role in preventing, or assisting in the recovery from, fatal replication arrest caused by DNA obstacles such as DNA topological stress, which is redundant with the function of RecA protein.

Conserved function of MgsA and its homolog Mgs1 at stalled replication forks

The E. coli mgsA gene encodes a highly conserved member of the AAA+ class family of ATPases. S. cerevisiae MGS1 is an orthologue of mgsA that possesses DNA-dependent ATPase and ssDNA annealing activities (Hishida et al. 2001). Consistent with these results, purified E. coli MgsA protein possesses DNA-dependent ATPase activity and promotes the annealing of complementary DNA strands in a manner similar to S. cerevisiae Mgs1 protein (data not shown). Thus, the property of MgsA/Mgs1 protein is highly conserved in prokaryotes and eukaryotes and may explain the functional redundancy between MgsA and RecA. Further investigation will be needed to understand the in vivo role of the DNA-dependent ATPase and annealing activities of these proteins.

In yeast S. cerevisiae, the mgs1 mutant is synthetically lethal with rad6 or rad18, but not with rad52 or rad51 (Hishida et al. 2002). Rad6 and Rad18 are involved in the DNA PRR pathway and encode ubiquitin-conjugating and ubiquitin-ligase enzymes, respectively (Barbour & Xiao 2003). Recent studies show that PCNA is ubiquitinated at lysine164, a reaction that is dependent on the RAD6 pathway (i.e., Rad6, Rad18, Rad5, Mms2, and Ubc13) (Hoege et al. 2002). Poly or mono-ubiquitination of PCNA is linked to the error-free (template-switching) or error-prone (TLS) modes of PRR, respectively (Stelter & Ulrich 2003). Rad5 ubiquitin-ligase, which is required for poly ubiquitination of PCNA, has been assigned to the error-free subpathway of PRR. The mgs1{Delta}rad5{Delta} double mutant shows severe growth defect and a synergistic increase in ade2-1 and trp1-1 reversion frequency (Hishida et al. 2002). These results suggest that Mgs1 is functionally redundant with RAD5-dependent error-free PRR. It was postulated that the error-free and error-prone modes of the RAD6 PRR pathway are analogous to RecA-dependent PRR in E. coli (i.e., fork reversal and template switching, SOS induction and translesion synthesis by UmuDC), although the ubiquitin modification system is unique to eukaryotes (Broomfield et al. 2001). Thus, RecA possesses dual functions at stalled replication forks, recombination repair and PRR. These may correspond to the eukaryotic RAD52 recombination and RAD6 PRR pathways, respectively. MgsA and RecA may play redundant roles in the prokaryotic error-free PRR (fork reversal and template switching) pathway.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
General methods

Standard methods for E. coli genetics and recombinant DNA techniques were as described by Miller (1992) and Sambrook et al. (1989). Cells were grown in LB containing 1% NaCl or lacking salt. Ampicillin (50 µg/mL), tetracycline (10 µg/mL), chloramphenicol (15 mg/mL) and kanamycin (20 µg/mL) were used as needed. Coumermycin A solution (Sigma) at 10 mg/mL in DMSO was added as needed. SOS mutagenesis and conjugation experiments for determining mutation and recombination frequencies were performed at 37 °C as previously described (Lloyd et al. 1988; Vandewiele et al. 2002). Cell morphology was monitored under a fluorescence microscope as previously described (Hishida et al. 2004).

Strains

Bacterial strains used in this study are listed in Supplementary Table S1. (Please see http://www.blackwellpublishing.com/products/journals/suppmat/GTC/GTC831/GTC831.htm) {Delta}mgsA::cat was constructed by replacing the HincII-AccI fragment of mgsA with the chloramphenicol (cat) or kanamycin (kan) resistance genes. The mutant allele was introduced into a recD strain (D301) as described (Russell et al. 1989). The gene disruption was confirmed by PCR using appropriate primers. The isogenic derivatives of AB1157 or W3110 strains were constructed by transduction with P1 phage.

Plasmids

E. coli mgsA maps at 20.2 min on the chromosome (clone 215 of Kohara lambda library). A 5.7 kb PstI fragment containing full length mgsA was cloned into pUC19 and designated p215P. A 2.5 kb HindIII fragment of p215P containing mgsA was subcloned into pUC19 and designated pHR1. The 2.5 kb HindIII-PstI fragment of p215P containing mgsA was subcloned into pTWV229 vector (Takara) and designated pTW1. A PCR primer (5'-AGTAGAGGCACCCATATGAGCAATCTGTCG-3') was used to incorporate an NdeI site at the ATG initiation codon of mgsA in pHR1. The histidine-tagged mgsA gene was constructed by ligating the NdeI-BamHI fragments of mgsA gene into pET15-b (Novagen), giving pEHR3. pTF100 was constructed by replacing the NcoI site of pBAD24 (Guzman et al. 1995) with an NdeI site by PCR mutagenesis. The ClaI–HindIII fragments containing the arabinose-inducible promoter of pTF100 were cloned into the ClaI–HindIII site of pBAD28 (Guzman et al. 1995), producing pTF200. Arabinose-inducible mgsA was constructed by ligating the NdeI-SphI fragment of pEHR3 into pTF200, producing pTF201. pSCH18 is a pSC101 derivative (Iwasaki et al. 1989). The ClaI-HindIII fragment containing arabinose-inducible mgsA from pTF201 was blunt-ended and ligated into the SmaI site of pSCH18, producing pMgsA. The fragment containing recA gene amplified from genomic DNA by PCR was digested with NdeI and BamHI and cloned into pT7-7, giving pRecA. Arabinose-inducible recA was constructed by replacing the mgsA gene of pMgsA with the recA gene (pTF300). The structure of recombinant plasmids was confirmed by DNA sequencing.

Isolation of recA mutant

PCR-mediated random mutagenesis was carried out on pRecA plasmid using forward and reverse oligonucleotides; recAF (GGCATGACAGGAGTACATATGGCTATCGACGA) and recAR (AAGGGCCGCAGATGGGATCCTTGTGTATCA) containing NdeI and BamHI sites, respectively. Mutagenized NdeI-BamHI fragments were cloned into pT7-7. The resultant recA mutant library was transformed into an mgsA recA strain. Slow growing transformants were isolated (85 clones) and screened for resistance to UV (3 clones). Mutations in the selected clones were identified by sequencing on an ABI 373I DNA sequencer. The NdeI-BamHI fragments containing a proline substitution of residue Ser25 (recAS25P) were recloned into pT7-7 vector, giving pRecAS25P.

Lac+ reversion assay

Lac+ reversion assays in MgsA-overproducing strains were as previously described (Cupples et al. 1990; Kim et al. 1997). The CC strains containing a set of lacZ mutations on F' plasmid were transformed with either pTWV229 (empty vector) or pTW1 (mgsA+). Overnight cultures were washed twice in sodium phosphate buffer (66 mM, pH 7.2). Samples were plated on minimal glucose and lactose agar plates at appropriate dilution to determine the total cell number and the number of Lac+ revertants, respectively. The plates were incubated at 37 °C for 3 days. The numbers reported are the averages of at least three independent determinations.

Sensitivity to UV light and Coumermycin A1

Sensitivity to UV damage was measured as previously described (Hishida et al. 1996). To measure sensitivity to Coumermycin A1, cells were grown to log phase in LB and washed twice in M9 salts. Cells were plated on LB medium containing the indicated concentration of Coumermycin A1 and incubated at 37 °C.

SOS induction

SOS induction was assessed by measuring degradation of LexA as previously described (Yasuda et al. 1998). Log phase cultures were treated with chloramphenicol (100 µg/mL) to inhibit re-synthesis of LexA and incubated for 10 min at 37 °C. Then, the cells were UV-irradiated (time 0) and aliquots were taken at intervals. Samples were analyzed by 15% SDS PAGE, and RecA and LexA proteins were detected by immunoblotting with anti-RecA and anti-LexA antibodies.


    Supplemental material
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
The following supplementary material is available at http://www.blackwellpublishing.com/products/journals/suppmat/GTC/GTC831/GTC831.htm.

Figure S1 polA1 mgsA double mutant is temperature sensitive for growth. Cells grown at 30 °C were diluted and spotted on to LB plates. The plates were incubated overnight at 30 °C or 42 °C.

Table S1 E. coli strains used in this study.


    Acknowledgements
 
We thank H. Ohmori and T. Nohmi for strains. This work was supported by Grants-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    Footnotes
 
Communicated by: Fumio Hanaoka

* Correspondence: E-mail: hishida{at}biken.osaka-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Supplemental material
 References
 
Barbour, L. & Xiao, W. (2003) Regulation of alternative replication bypass pathways at stalled replication forks and its effects on genome stability: A yeast model. Mutat. Res. 532, 137–155.[Medline]

Bachmann, B.J. (1972) Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol. Rev. 36, 525–557.[Free Full Text]

Barre, F.X., Soballe, B., Michel, B., Aroyo, M., Robertson, M. & Sherratt, D. (2001) Circles: The replication-recombination-chromosome segregation connection. Proc. Natl. Acad. Sci. USA 98, 8189–8195.[Abstract/Free Full Text]

Branzei, D., Seki, M., Onoda, F., Yagi, H., Kawabe, Y. & Enomoto, T. (2002) Characterization of the slow-growth phenotype of S. cerevisiae Whip/Mgs1 Sgs1 double deletion mutants. DNA Repair (Amst) 1, 671–682.[Medline]

Broomfield, S., Hryciw, T. & Xiao, W. (2001) DNA postreplication repair and mutagenesis in Saccharomyces cerevisiae. Mutat. Res. 486, 167–184.[Medline]

Cao, Y. & Kogoma, T. (1995) The mechanism of recA polA lethality: Suppression by RecA-independent recombination repair activated by the lexA (Def) mutation in Escherichia coli. Genetics 139, 1483–1494.[Abstract]

Courcelle, J. & Hanawalt, P.C. (2003) RecA-dependent recovery of arrested DNA replication forks. Annu. Rev. Genet. 37, 611–646.[CrossRef][Medline]

Courcelle, J., Donaldson, J.R., Chow, K.H. & Courcelle, C.T. (2003) DNA damage-induced replication fork regression and processing in Escherichia coli. Science 299, 1064–1067.[Abstract/Free Full Text]

Courcelle, J., Belle, J.J. & Courcelle, C.T. (2004) When replication travels on damaged templates: Bumps and blocks in the road. Res. Microbiol. 155, 231–237.[Medline]

Cox, M.M. (2002) The nonmutagenic repair of broken replication forks via recombination. Mutat. Res. 510, 107–120.[Medline]

Cox, M.M., Goodman, M.F., Kreuzer, K.N., Sherratt, D.J., Sandler, S.J. & Marians, K.J. (2000) The importance of repairing stalled replication forks. Nature 404, 37–41.[CrossRef][Medline]

Cupples, C.G., Cabrera, M., Cruz, C. & Miller, J.H. (1990) A set of lacZ mutations in Escherichia coli that allow rapid detection of specific frameshift mutations. Genetics 125, 275–280.[Abstract]

Dorman, C.J., Lynch, A.S., Bhriain, N.N. & Higgins, C.F. (1989) DNA supercoiling in Escherichia coli: topA mutations can be suppressed by DNA amplifications involving the tolC locus. Mol. Microbiol. 3, 531–540.[CrossRef][Medline]

Gellert, M., O'Dea, M.H., Itoh, T. & Tomizawa, J. (1976) Novobiocin and coumermycin inhibit DNA supercoiling catalyzed by DNA gyrase. Proc. Natl. Acad. Sci. USA 73, 4474–4478.[Abstract/Free Full Text]

Glaser, P., Sharpe, M.E., Raether, B., Perego, M., Ohlsen, K. & Errington, J. (1997) Dynamic, mitotic-like behavior of a bacterial protein required for accurate chromosome partitioning. Genes Dev. 11, 1160–1168.[Abstract/Free Full Text]

Grompone, G., Seigneur, M., Ehrlich, S.D. & Michel, B. (2002) Replication fork reversal in DNA polymerase III mutants of Escherichia coli: A role for the beta clamp. Mol. Microbiol. 44, 1331–1339.[CrossRef][Medline]

Guzman, L.M., Belin, D., Carson, M.J. & Beckwith, J.S. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130.[Abstract/Free Full Text]

Hishida, T., Iwasaki, H., Ishioka, K. & Shinagawa, H. (1996) Molecular analysis of the Pseudomonas aeruginosa genes, ruvA, ruvB and ruvC, involved in processing of homologous recombination intermediates. Gene 182, 63–70.[CrossRef][Medline]

Hishida, T., Iwasaki, H., Ohno, T., Morishita, T. & Shinagawa, H. (2001) A yeast gene, MGS1, encoding a DNA-dependent AAA+ ATPase is required to maintain genome stability. Proc. Natl. Acad. Sci. USA 98, 8283–8289.[Abstract/Free Full Text]

Hishida, T., Ohno, T., Iwasaki, H. & Shinagawa, H. (2002) Saccharomyces cerevisiae MGS1 is essential in strains deficient in the RAD6-dependent DNA damage tolerance pathway. EMBO J. 21, 2019–2029.[CrossRef][Medline]

Hishida, T., Han, Y.W., Shibata, T., et al. (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 18, 1886–1897.[Abstract/Free Full Text]

Hoege, C., Pfander, B., Moldovan, G.L., Pyrowolakis, G. & Jentsch, S. (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419, 135–141.[CrossRef][Medline]

Ishioka, K., Fukuoh, A., Iwasaki, H., Nakata, A. & Shinagawa, H. (1998) Abortive recombination in Escherichia coli ruv mutants blocks chromosome partitioning. Genes Cells 3, 209–220.[Abstract]

Iwasaki, H., Shiba, T., Nakata, A. & Shinagawa, H. (1989) Involvement in DNA repair of the ruvA gene of Escherichia coli. Mol. Gen. Genet. 219, 328–331.[CrossRef][Medline]

Joyce, C.M., Fujii, D.M., Laks, H.S., Hughes, C.M. & Grindley, N.D. (1985) Genetic mapping and DNA sequence analysis of mutations in the polA gene of Escherichia coli. J. Mol. Biol. 186, 283–293.[CrossRef][Medline]

Kelman, Z. & O'Donnell, M. (1995) DNA polymerase III holoenzyme: Structure and function of a chromosomal replicating machine. Annu. Rev. Biochem. 64, 171–200.[CrossRef][Medline]

Kim, S.R., Maenhaut-Michel, G., Yamada, M., et al. (1997) Multiple pathways for SOS-induced mutagenesis in Escherichia coli: An overexpression of dinB/dinP results in strongly enhancing mutagenesis in the absence of any exogenous treatment to damage DNA. Proc. Natl. Acad. Sci. USA 94, 13792–13797.[Abstract/Free Full Text]

Kowalczykowski, S.C. (2000) Initiation of genetic recombination and recombination-dependent replication. Trends Biochem. Sci. 25, 156–165.[CrossRef][Medline]

Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder, S.D. & Rehrauer, W.M. (1994) Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 58, 401–465.[Abstract/Free Full Text]

Lau, I.F., Filipe, S.R., Soballe, B., Okstad, O.A., Barre, F.X. & Sherratt, D.J. (2003) Spatial and temporal organization of replicating Escherichia coli chromosomes. Mol Microbiol. 49, 731–743.[CrossRef][Medline]

Levine, C., Hiasa, H. & Marians, K.J. (1998) DNA gyrase and topoisomerase IV: Biochemical activities, physiological roles during chromosome replication, and drug sensitivities. Biochim. Biophys. Acta 1400, 29–43.[Medline]

Li, Y., Sergueev, K. & Austin, S. (2002) The segregation of the Escherichia coli origin and terminus of replication. Mol. Microbiol. 46, 985–996.[CrossRef][Medline]

Little, J.W. & Harper, J.E. (1979) Identification of the lexA gene product of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 76, 6147–6151.[Abstract/Free Full Text]

Lloyd, R.G., Porton, M.C. & Buckman, C. (1988) Effect of recF, recJ, recN, recO and ruv mutations on ultraviolet survival and genetic recombination in a recD strain of Escherichia coli K12. Mol. Gen. Genet. 212, 317–324.[CrossRef][Medline]

Lusetti, S.L. & Cox, M.M. (2002) The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu. Rev. Biochem. 71, 71–100.[CrossRef][Medline]

Marians, K.J. (2000) Replication and recombination intersect. Curr. Opin. Genet. Dev. 10, 151–156.[CrossRef][Medline]

Maxwell, A. (1993) The interaction between coumarin drugs and DNA gyrase. Mol. Microbiol. 9, 681–686.[Medline]

Michel, B., Flores, M.J., Viguera, E., Grompone, G., Seigneur, M. & Bidnenko, V. (2001) Rescue of arrested replication forks by homologous recombination. Proc. Natl. Acad. Sci. USA 98, 8181–8188.[Abstract/Free Full Text]

Miller, J.H. (1992) A short course in bacterial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Monk, M. & Kinross, J. (1972) Conditional lethality of recA and recB derivatives of a strain of Escherichia coli K-12 with a temperature-sensitive deoxyribonucleic acid polymerase I. J. Bacteriol. 109, 971–978.[Abstract/Free Full Text]

Morimatsu, K. & Kowalczykowski, S.C. (2003) RecFOR proteins load RecA protein onto gapped DNA to accelerate DNA strand exchange: A universal step of recombinational repair. Mol. Cell 11, 1337–1347.[CrossRef][Medline]

Nagata, Y., Mashimo, K., Kawata, M. & Yamamoto, K. (2002) The roles of Klenow processing and flap processing activities of DNA polymerase I in chromosome instability in Escherichia coli K12 strains. Genetics 160, 13–23.[Abstract/Free Full Text]

Pham, P., Rangarajan, S., Woodgate, R. & Goodman, M.F. (2001a) Roles of DNA polymerases V and II in SOS-induced error-prone and error-free repair in Escherichia coli. Proc. Natl. Acad. Sci. USA 98, 8350–8354.[Abstract/Free Full Text]

Pham, P., Bertram, J.G., O'Donnell, M., Woodgate, R. & Goodman, M.F. (2001b) A model for SOS-lesion-targeted mutations in Escherichia coli. Nature 409, 366–370.[CrossRef][Medline]

Postow, L., Crisona, N.J., Peter, B.J., Hardy, C.D. & Cozzarelli, N.R. (2001) Topological challenges to DNA replication: Conformations at the fork. Proc. Natl. Acad. Sci. USA 98, 8219–8226.[Abstract/Free Full Text]

Russell, C.B., Thaler, D.S. & Dahlquist, F.W. (1989) Chromosomal transformation of Escherichia coli recD strains with linearized plasmids. J. Bacteriol. 171, 2609–2613.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sandler, S.J., Samra, H.S. & Clark, A.J. (1996) Differential suppression of priA2, kan phenotypes in Escherichia coli K-12 by mutations in priA, lexA, and dnaC. Genetics 143, 5–13.[Abstract]

Sherratt, D.J., Soballe, B., Barre, F.X., et al. (2004) Recombination and chromosome segregation. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359, 61–69.[CrossRef][Medline]

Stelter, P. & Ulrich, H.D. (2003) Control of spontaneous and damage-induced mutagenesis by SUMO and ubiquitin conjugation. Nature 425, 188–191.[CrossRef][Medline]

Sutton, M.D. & Walker, G.C. (2001) Managing DNA polymerases: Coordinating DNA replication, DNA repair, and DNA recombination. Proc. Natl. Acad. Sci. USA 98, 8342–8349.[Abstract/Free Full Text]

Tacon, W. & Sherratt, D. (1976) ColE plasmid replication in DNA polymerase I-deficient strains of Escherichia coli. Mol. Gen. Genet. 147, 331–335.[CrossRef][Medline]

Tang, M., Pham, P., Shen, X., et al. (2000) Roles of E. coli DNA polymerases IV and V in lesion-targeted and untargeted SOS mutagenesis. Nature 404, 1014–1018.[CrossRef][Medline]

Uyemura, D. & Lehman, I.R. (1976) Biochemical characterization of mutant forms of DNA polymerase I from Escherichia coli. I. The polA12 mutation. J. Biol. Chem. 251, 4078–4084.[Abstract/Free Full Text]

Vandewiele, D., FernandeZ. de Henestrosa, A.R., Timms, A.R., Bridges, B.A. & Woodgate, R. (2002) Sequence analysis and phenotypes of five temperature sensitive mutator alleles of dnaE, encoding modified alpha-catalytic subunits of Escherichia coli DNA polymerase III holoenzyme. Mutat. Res. 499, 85–95.[Medline]

Webb, C.D., Teleman, A., Gordon, S., et al. (1997) Bipolar localization of the replication origin regions of chromosomes in vegetative and sporulating cells of B. subtilis. Cell 88, 667–674.[CrossRef][Medline]

Wechsler, J.A. & Gross, J.D. (1971) Escherichia coli mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genet. 113, 273–284.[CrossRef][Medline]

Yasuda, T., Morimatsu, K., Horii, T., Nagata, T. & Ohmori, H. (1998) Inhibition of Escherichia coli RecA coprotease activities by DinI. EMBO J. 17, 3207–3216.[CrossRef][Medline]

Received: 19 October 2004
Accepted: 5 December 2004




This article has been cited by other articles:


Home page
J. Bacteriol.Home page
K. Fujimitsu, M. Su'etsugu, Y. Yamaguchi, K. Mazda, N. Fu, H. Kawakami, and T. Katayama
Modes of Overinitiation, dnaA Gene Expression, and Inhibition of Cell Division in a Novel Cold-Sensitive hda Mutant of Escherichia coli
J. Bacteriol., August 1, 2008; 190(15): 5368 - 5381.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Nagashima, Y. Kubota, T. Shibata, C. Sakaguchi, H. Shinagawa, and T. Hishida
Degradation of Escherichia coli RecN Aggregates by ClpXP Protease and Its Implications for DNA Damage Tolerance
J. Biol. Chem., October 13, 2006; 281(41): 30941 - 30946.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
C. M. Roux, N. J. Booth, B. H. Bellaire, J. M. Gee, R. M. Roop II, M. E. Kovach, R. M. Tsolis, P. H. Elzer, and D. G. Ennis
RecA and RadA Proteins of Brucella abortus Do Not Perform Overlapping Protective DNA Repair Functions following Oxidative Burst.
J. Bacteriol., July 1, 2006; 188(14): 5187 - 5195.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibata, T.
Right arrow Articles by Shinagawa, H.