|
|
||||||||
Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC 27710, USA
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Checkpoint proteins Rad9, Rad1 and Hus1 have been shown to share structural similarities to the proliferating cell nuclear antigen protein (PCNA) (Thelen et al. 1999). In fact, these three checkpoint proteins have been found to exist as a heterotrimeric checkpoint complex (the 9-1-1 complex) (Lindsey-Boltz et al. 2001; Volkmer & Karnitz 1999). In response to diverse DNA-damaging agents and replication inhibitors, Rad9 has been found to associate with chromatin, suggesting that it may be involved in the initial activation of the checkpoint upon genotoxic stress (Burtelow et al. 2000; Roos-Mattjus et al. 2002). On the other hand, it has been demonstrated that treatment of human cells with genotoxic agents could induce ATM/ATR-dependent phosphorylation of human Rad17, an event that is required for the propagation of genotoxic stress response signals, indicating Rad17 phosphorylation as a critical early event during checkpoint activation (Bao et al. 2001; Post et al. 2001; Wang et al. 2001). Rad17 shares structural homology with all five subunits of the replication factor C (RFC) (Griffiths et al. 1995), suggesting that a Rad17-containing complex may be involved in the recognition of damaged or incompletely replicated DNA. Similar to the functional mode of RFC/PCNA interaction during DNA replication, a 9-1-1 complex-mediated checkpoint clamp-loading model has been proposed to play a role in the recognition of damaged DNA or incompletely replicated DNA fork (Ellison & Stillman 2003; Post et al. 2003; Venclovas & Thelen 2000). Consistent with this postulation, the human Rad17 protein has been demonstrated to recruit the Rad9-containing protein complex on to chromatin in response to DNA damage (Zou et al. 2002). However, the precise role of Rad9 in the involvement of checkpoint activation at the mechanistic level remains poorly understood.
Previous studies indicated that Rad9 is modified by phosphorylation, both in the absence of exogenous stress and in response to various genotoxic stress (Chen et al. 2001; St Onge et al. 2001; Yoshida et al. 2002). The functional significance of Rad9 phosphorylation has recently been investigated by several groups (Roos-Mattjus et al. 2003; St Onge et al. 2003). While Rad9 was shown to mediate the G2/M checkpoint (Hirai & Wang 2002; St Onge et al. 2003), the potential cellular functions of Rad9 in other phases of the cell cycle, such as S-phase, remains to be determined. Here we report that the human Rad9 protein mediates S-phase checkpoint activation by regulating the phosphorylation of Rad17, Chk1, Chk2 and Smc1 in response to replication block and DNA damage. Furthermore, Rad9 is required for the foci formation of phosphorylated Chk1, but not ATR. We found that Rad9 knockdown not only resulted in radioresistant DNA synthesis but also reduced cell viability under replication stress, supporting the notion that Rad9 is a critical player in the activation of S-phase checkpoint. Moreover, cytogenetic studies showed that Rad9 participates in the maintenance of chromosomal stability and integrity.
| Results |
|---|
|
|
|---|
To study the function of Rad9 in checkpoint signaling, we investigated whether knockdown of Rad9 by RNA interference (RNAi) could affect checkpoint activation after applying replication block and DNA damage in Hela cells. Since the phosphorylation of Rad17 on S635 and S645 has been demonstrated as a critical early event during checkpoint activation in response to replication block and DNA damage (Bao et al. 2001), we first assessed whether Rad9 knockdown affects Rad17 phosphorylation. As shown in Fig. 1A, a series of transfection of Hela cells with a Rad9 RNAi construct reduced Rad9 protein level by 80%. Consistent with previous findings, treatment of cells with replication inhibitor hydroxyurea (HU), and DNA damaging reagents such as irradiation (IR) and ultraviolet (UV) induced Rad17 phosphorylation. However, Rad9 knockdown significantly suppressed the phosphorylation of Rad17 induced by HU and UV (density ratio of 2.0 : 1 and 4.1 : 1, respectively; Fig. 1B). In contrast, removal of Rad9 only slightly inhibited Rad17 phosphorylation induced by IR. These data demonstrated that Rad9 is required for Rad17 phosphorylation in response to HU and UV treatment, indicating that Rad9 is involved in checkpoint activation induced by replication block and UV damage.
|
Rad9 is also involved in mediating the phosphorylation of Smc1 in response to replication stress
It has previously been shown that the ATR-dependent phosphorylation of Smc1 (structure maintenance of chromosome 1) is involved in the checkpoint activation (Kim et al. 2002; Wang & Qin 2003). We thus tested if Rad9 is required for the replication block induced Smc1 phosphorylation. As shown in Fig. 2A, treatment of cells with aphidicolin (APH), a DNA polymerase inhibitor, resulted in Smc1 phosphorylation on Ser966. In comparison, Rad9 knockdown dramatically suppressed the APH-induced Smc1 phosphorylation. Similarly, the APH-induced Chk1 phosphorylation on Ser345 was also abolished in the Rad9 knockdown cells. In contrast, we found that Rad9 knockdown did not significantly affect the DNA alkylation agent MNNG-induced phosphorylation of Smc1 on Ser966 (Fig. 2B). These data suggest that Smc1 is also involved in the S-phase checkpoint activation in response to replication stress, and Rad9 is specifically required for the phosphorylation of Smc1 on Ser966 during checkpoint activation in S-phase in response to replication stress.
|
We have demonstrated that the Rad9 protein is required for the phosphorylation of Rad17, Chk1, Chk2 and Smc1 in response to replication stress and certain types of DNA damage. Since the phosphorylation of these proteins upon the presence of replication stress is mainly mediated by the ATR kinase (Abraham 2001; Zhao & Piwnica-Worms 2001), it was important to determine whether Rad9 knockdown affects the formation of nuclear foci by ATR and the phosphorylation substrates of ATR, such as pChk1, in response to replication stress and DNA damage. To address this question, we carried out immunofluorescent staining of ATR and pChk1 in the Rad9 knockdown cells before and after APH treatment or UV damage. As shown in Fig. 3A, little phosphorylated Chk1 staining was seen in untreated Hela cells, but UV or APH treatment clearly induced pChk1 to form distinct foci in the vector-transfected control cells. In contrast, the same UV or APH treatment failed to induce foci formation of pChk1 in the Rad9 knockdown cells, although an increase in the background level of phosphorylated Chk1 was observed (Fig. 3A). These data suggest that Rad9 is required for the foci formation of Chk1. However, removal of Rad9 by RNAi failed to prevent the formation of ATR foci in response to UV treatment in the Hela cells (Fig. 3B). We also examined the cells treated with APH, but were unable to detect distinct ATR foci formation induced by the APH treatment. Taken together, these results suggest that Rad9 acts downstream from the formation of ATR foci, an event likely associated with the activation of ATR. Rather, Rad9 is involved in the subsequent phosphorylation of ATR substrates, possibly through affecting the formation of complexes between ATR and its substrates.
|
Our results showed that Rad9 knockdown reduced the phosphorylation of Rad17, Chk1, Chk2 and Smc1 induced by replication stress, suggesting that Rad9 is required for S-phase checkpoint activation. In order to elucidate the cellular function of Rad9 in the S-phase in response to genotoxic stress, we examined whether Rad9 knockdown could trigger RDS in the Hela cells. As shown in Fig. 4A, the level of DNA synthesis was 61.8% that of unirradiated cells transfected with the vector control. In contrast, in Rad9 knockdown cells the level of DNA synthesis was 75.5% of that of unirradiated cells, indicating the presence of RDS. This difference (P < 0.05) between the two groups of cells suggests that knockdown of Rad9 resulted in a significant increase in the level of RDS. To assess the potential consequence of the display of the RDS phenotype, we next tested whether removal of Rad9 could reduce cell viability after treatment with replication blockers. As shown in Fig. 4B, the cell survival profile indicated that cell viability was significantly lower in Rad9 knockdown cells than that of the control cells at both HU doses tested (0.2 mM and 0.5 mM). In addition, we also examined the cell viability with treatment of APH, which inhibits DNA replication through a different mechanism. Significantly, Rad9 knockdown cells showed a nearly two-fold decrease in survival in comparison to that of cells transfected with the control vector in response to APH treatment (Fig. 4C). These results support our postulation that Rad9 is required for S-phase checkpoint activation to mediate cell survival in response to DNA replication block. This notion is consistent with recently published studies on chicken and mouse Rad9 knockout cells (Kobayashi et al. 2004; Loegering et al. 2004).
|
Since the process of DNA replication is closely associated with the preservation of chromosomal stability, the involvement of Rad9 in the S-phase checkpoint in response to replication stress suggests that Rad9 may participate in the maintenance of chromosomal stability. To address this possibility, we performed cytogenetic studies in Rad9 knockdown cells by examining the metaphase spreads two days after the last transfection of Rad9 RNAi or control constructs. In the cells transfected with the control construct, 24% cells showed chromosomal aberrations (Fig. 5A,D). In contrast, in Rad9 knockdown cells 62% of metaphase chromosomes displayed structural abnormalities (Fig. 5BD). Chromatid breakages and deletions were the most common chromosomal aberrations in the Rad9 knockdown cells. These results suggest that, like Rad17, Rad9 also plays an important role in maintaining chromosomal stability. It should be pointed out that although the parental Hela cells contain abnormal chromosomes, no chromosomal breaks were observed during the metaphase spread assay (Macville et al. 1999). Furthermore, Hela cells have been used as a model system to study fragile site expression and other types of chromosomal instability (Casper et al. 2002). In fact, the percentage of cells with chromosomal aberrations caused by Rad9 knockdown (62%) is comparable to that reported in Rad17 knockout cells (75%) (Wang et al. 2003). For the cells transfected with the control vector, we observed 24% cells exhibiting chromosomal breaks or deletions, which could be due to cellular toxicity caused by the series of transfection.
|
| Discussion |
|---|
|
|
|---|
ATR-dependent Chk1 phosphorylation has been shown to be an important event for the checkpoint activation in response to replication block (Abraham 2001; Jiang et al. 2003; Zhou & Elledge 2000). Recently, it was reported that Rad17 is also required for the ATR-dependent Chk1 phosphorylation (Wang et al. 2003). ATR and Rad17 complexes are presumably recruited independently to the sites of DNA damage, and the genotoxic stress-induced association between the two proteins leads to phosphorylation of Rad17 and other substrates by the ATR kinase (Bao et al. 2001). Here we found that Rad9 is not only required for Chk1 phosphorylation, but also required for Rad17 phosphorylation in response to replication block and other types of genotoxic stresses. Since Rad17 is involved in the very early steps of checkpoint activation in response to genotoxic stresses (Bao et al. 2001; Post et al. 2001), it is likely that Rad9 also participates in the initial phase of checkpoint activation process induced by replication block. Mechanistically, Rad9 may act to promote the stability of a large protein complex containing ATR and its substrates, including Rad17, to allow sustained phosphorylation of those proteins by the ATR kinase to propagate the checkpoint signal to elicit specific downstream cellular responses. In this model, the genotoxic stress-induced assembling of the large protein complex consisting of ATR, Rad17, hRad9, and likely other components including ATRIP, RPA, Rad1 and Hus1, is required for both the initiation and the continued propagation of the checkpoint signal by the phosphorylation of downstream targets, such as Chk1. The initial phosphorylation of Rad17 and the induced association of the Rad9-Rad1-Hus1 (9-1-1) complex and the phosphorylated Rad17 serve to stabilize the larger complex as a platform or scaffold for the subsequent recruitment of other substrates for the ATR kinase. This notion is supported by our previous demonstration that the phosphorylation of Rad17 was critical for its binding to 9-1-1 (Bao et al. 2001) and the recent evidence showing that the mouse Hus1 was also involved in the S-phase checkpoint pathways in response to genotoxic stress (Weiss et al. 2003). In this context, it is also possible that the participation of Rad9, or the 9-1-1 complex, in the assembly of the larger protein complex serves an additional role in selecting substrates for phosphorylation by the ATR kinase depending upon the molecular nature of the DNA damage or replication stress. This possibility is supported by the evidence that the ATR-dependent Smc1 phosphorylation induced by the DNA damage agent MNNG was not suppressed by Rad9 knockdown, but the same Smc1 phosphorylation event induced by replication blocker APH was abolished by removal of Rad9. Thus, it is likely that Rad9 or the 9-1-1 complex can recognize different types of genotoxic stress and recruit different substrates to the ATR kinase to activate distinct checkpoint signaling pathways and elicit specific cellular responses.
It has been shown that radioresistant DNA synthesis (RDS) in S phase is associated with defects of the ATM-dependent Chk2-mediated signaling pathway. Recently, it was reported that disruption of Chk1 function prevented IR-induced degradation of Cdc25A, and caused the exhibition of the RDS phenotype (Sorensen et al. 2003). We have found that Rad9 knockdown significantly suppressed phosphorylation of both Chk1 and Chk2 induced by replication block, but removal of Rad9 only slightly inhibited the Chk2 phosphorylation induced by IR. This phenomenon implies that functional defects of both Chk1- and Chk2-mediated checkpoint signaling triggered by removal of Rad9 may contribute to the development of the RDS phenotype observed in Rad9 knockdown cells. Consistent with some recent publications (Bao et al. 2004; Hopkins et al. 2004; Sorensen et al. 2004), this data further supports the notion that Rad9 plays a critical role in the S phase checkpoint in response to genotoxic stress.
A functional checkpoint in S phase is very important for the maintenance of chromosomal stability and integrity. It has been reported that cells lacking Rad17 exhibited acute chromosomal aberrations including chromosomal breakage, deletion and endoduplication (Wang et al. 2003). It was recently observed that RNAi knockdown of ATR in Hela cells dramatically increased chromosomal gaps and breaks upon treatment (Casper et al. 2002). Our results demonstrated that Rad9 knockdown dramatically increased the accumulation of chromosomal aberrations, indicating that Rad9 also plays a critical role in the maintenance of chromosomal stability. We have attempted numerous times to obtain clones that were stably transfected with the Rad9 RNAi construct without success, suggesting that Rad9 may be essential for sustaining cell survival, a phenotype similar to that of the conditional Rad17- or Hus1-null cells (Roos-Mattjus et al. 2003; Wang et al. 2003; Weiss et al. 2000). It is likely that ATR, Rad17, and Rad9 all participate in the control of DNA replication and monitoring the presence of DNA damage and replication errors during S phase, while removal of any one of these proteins could lead to increased spontaneous or replication stress-induced chromosomal lesions.
| Experimental procedures |
|---|
|
|
|---|
The phosphoserine-specific antibody of human Rad17 was generated by immunizing rabbits with keyhole-limpet hemocyanin-conjugated phosphopeptides spanning the Ser635 (CETWSLPLpSQNSASE) (Bao et al. 2001). Other phosphospecific antibodies (pS345 of Chk1, pT68 of Chk2) were purchased from Cell Signaling Technology (Beverly, MA). Smc1-pS966 (BL311) and Smc1 (BL308) antibodies were from Bethyl Laboratories (Montgomery, TX, USA). The rabbit polyclonal antibodies to hRad9, hRad17, mouse monoclonal antibodies to Chk1,
-tubulin, and the goat polyclonal antibody to ATR were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit polyclonal antibody to Chk2 was purchased from Upstate (Charlottesville, VA, USA).
Cell culture and RNAi transfection
Human cell line Hela was grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% foetal bovine serum (FBS). Where indicated, cells were irradiated with a 137Cs gamma ray source or exposed to an ultraviolet-C light source of wavelength 254 nm. Oligonucleotides containing RNAi sequence targeting hRad9 (AAGTCTTTCCTGTCTGTCTTC) was prepared, annealed, and cloned into the pSUPER vector (Brummelkamp et al. 2002). Hela cells were then transfected with the RNAi construct for three times 48 h apart using Fugene 6 (Roche). Cells were also transfected with the pSUPER vector as a control.
Immunoblotting
After treatment as previously described (Bao et al. 2001), cells were extracted with lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 1% Tween 20, 1 mM dithiothreitol (DTT), 20 mMß-glycerophosphate, and 50 nM microcystin-LR) and supplemented with protease inhibitors (20 µg/mL leupeptin, 10 µg/mL pepstatin A, and 10 µg/mL aprotinin). The cleared extracts were boiled in sodium dodecyl sulfate polyacrylamide-gel electrophoresis (SDS-PAGE) sample buffer, resolved by 10% SDS-PAGE, and transferred to polyvinylidene fluoride membrane. Immunoblotting was performed by standards methods and signal was detected by chemiluminescence (Pierce).
Immunofluorescent staining
Cells grown on cover slips were fixed with 3% paraformaldehyde solution for 15 min and then permeabilized with 0.2% Triton X-100 for 5 min. Slides were blocked in 5% normal rabbit serum (for ATR blotting) or 5% BSA (for pS345-Chk1 blotting) for 30 min, followed by incubation with primary antibodies for overnight at 4 °C. After extensive washing, samples were incubated with Fluorescein isothiocyanate- or rhodamine-conjugated secondary antibodies (Santa Cruz Biotechnology). Laser-scanning confocal microscopy was performed on a Zeiss LSM410 with kryptonargon and heliumneon lasers.
Radioresistant DNA synthesis
Cells were plated in 6-well dishes, and transfected with RNAi construct or control vectors. After labeling for 48 h in medium containing [methyl-14C] thymidine (10 nCi/mL; 55.4 mCi/mmol; NEN Life Science Products, Inc.), the cells were washed with PBS twice, irradiated, and incubated for 2 h as previously described in the medium containing [methyl-3H] thymidine (2.5 mCi/mL; 20 Ci/mmol; NEN Life Science Products, Inc.) (Ali et al. 2004; Weiss et al. 2003). The cells were then solubilized in 2% SDS and transferred to Whatman filters. Dried filters were washed with 5% trichloroacetic acid, fixed sequentially with 90% and then 95% methanol. Radioactivity was quantified with a liquid scintillation counter. The 14C radioactivity was used as an internal control, whereas the ratios of 3H counts per minute to 14C counts per minute were a measure of DNA synthesis.
Cell survival assays
Cells were plated on to 60-mm dishes, transfected with RNAi or control vector, followed by adding HU or APH at the indicated concentrations for 24 h. The medium was then removed and replaced with culture medium. Two days after the treatment, cells were harvested by trypsinization, incubated with Trypan Blue, and counted for viability as previously described (Weiss et al. 2003).
Cytogenetics
Cells were harvested using standard conditions of 2 h colcemid treatment (20 ng/mL), followed by an 18 min incubation in 75 mM KCl at 37 °C and multiple changes of solution containing methanol and acetic acid (3 : 1). Fixed cells were dropped on to slides, stained with Giemsa in 10 mM phosphate buffer (pH 6.8) and assayed.
| Acknowledgements |
|---|
| Footnotes |
|---|
*Correspondence: E-mail: wang0011{at}mc.duke.edu
| References |
|---|
|
|
|---|
Ali, A., Zhang, J., Bao, S., et al. (2004) Requirement of protein phosphatase 5 in DNA-damage-induced ATM activation. Genes Dev.
18, 249254.
Bao, S., Tibbetts, R.S., Brumbaugh, K.M., et al. (2001) ATR/ATM-mediated phosphorylation of human Rad17 is required for genotoxic stress responses. Nature 411, 969974.
Bao, S., Lu, T., Wang, X., et al. (2004) Disruption of the Rad9/Rad1/Hus1 (9-1-1) complex leads to checkpoint signaling and replication defects. Oncogene 7, 7.
Brummelkamp, T.R., Bernards, R. & Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science
296, 550553.
Burtelow, M.A., Kaufmann, S.H. & Karnitz, L.M. (2000) Retention of the human Rad9 checkpoint complex in extraction-resistant nuclear complexes after DNA damage. J. Biol. Chem.
275, 2634326348.
Casper, A.M., Nghiem, P., Arlt, M.F. & Glover, T.W. (2002) ATR regulates fragile site stability. Cell 111, 779789.[CrossRef][Medline]
Chen, M.J., Lin, Y.T., Lieberman, H.B., Chen, G. & Lee, E.Y. (2001) ATM-dependent phosphorylation of human Rad9 is required for ionizing radiation-induced checkpoint activation. J. Biol. Chem.
276, 1658016586.
Ellison, V. & Stillman, B. (2003) Biochemical characterization of DNA damage checkpoint complexes: Clamp loader and clamp complexes with specificity for 5' recessed DNA. PLoS Biol. 1, 17.
Griffiths, D.J., Barbet, N.C., McCready, S., Lehmann, A.R. & Carr, A.M. (1995) Fission yeast rad17: A homologue of budding yeast RAD24 that shares regions of sequence similarity with DNA polymerase accessory proteins. EMBO J. 14, 58125823.[Medline]
Hirai, I. & Wang, H.G. (2002) A role of the C-terminal region of human Rad9 (hRad9) in nuclear transport of the hRad9 checkpoint complex. J. Biol. Chem.
277, 2572225727.
Hopkins, K.M., Auerbach, W., Wang, X.Y., et al. (2004) Deletion of mouse rad9 causes abnormal cellular responses to DNA damage, genomic instability, and embryonic lethality. Mol. Cell. Biol.
24, 72357248.
Jiang, K., Pereira, E., Maxfield, M., Russell, B., Goudelock, D.M. & Sanchez, Y. (2003) Regulation of Chk1 includes chromatin association and 14-3-3 binding following phosphorylation on Ser-345. J. Biol. Chem.
278, 2520725217.
Kim, S.T., Xu, B. & Kastan, M.B. (2002) Involvement of the cohesin protein, Smc1, in Atm-dependent and independent responses to DNA damage. Genes Dev. 16, 560570.
Kobayashi, M., Hirano, A., Kumano, T., et al. (2004) Critical role for chicken Rad17 and Rad9 in the cellular response to DNA damage and stalled DNA replication. Genes Cells
9, 291303.
Lindsey-Boltz, L.A., Bermudez, V.P., Hurwitz, J. & Sancar, A. (2001) Purification and characterization of human DNA damage checkpoint Rad complexes. Proc. Natl. Acad. Sci. USA
98, 1123611241.
Loegering, D., Arlander, S.J., Hackbarth, J., et al. (2004) Rad9 protects cells from topoisomerase poison-induced cell death. J. Biol. Chem.
279, 1864118647.
Macville, M., Schrock, E., Padilla-Nash, H., et al. (1999) Comprehensive and definitive molecular cytogenetic characterization of HeLa cells by spectral karyotyping. Cancer Res.
59, 141150.
Post, S., Weng, Y.C., Cimprich, K., Chen, L.B., Xu, Y. & Lee, E.Y. (2001) Phosphorylation of serines 635 and 645 of human Rad17 is cell cycle regulated and is required for G(1)/S checkpoint activation in response to DNA damage. Proc. Natl. Acad. Sci. USA
98, 1310213107.
Post, S.M., Tomkinson, A.E. & Lee, E.Y. (2003) The human checkpoint Rad protein Rad17 is chromatin-associated throughout the cell cycle, localizes to DNA replication sites, and interacts with DNA polymerase epsilon. Nucleic Acids Res.
31, 55685575.
Roos-Mattjus, P., Vroman, B.T., Burtelow, M.A., Rauen, M., Eapen, A.K. & Karnitz, L.M. (2002) Genotoxin-induced Rad9-Hus1-Rad1 (9-1-1) chromatin association is an early checkpoint signaling event. J. Biol. Chem.
277, 4380943812.
Roos-Mattjus, P., Hopkins, K.M., Oestreich, A.J., et al. (2003) Phosphorylation of human Rad9 is required for genotoxin-activated checkpoint signaling. J. Biol. Chem.
278, 2442824437.
Sorensen, C.S., Syljuasen, R.G., Falck, J., et al. (2003) Chk1 regulates the S phase checkpoint by coupling the physiological turnover and ionizing radiation-induced accelerated proteolysis of Cdc25A. Cancer Cell 3, 247258.
Sorensen, C.S., Syljuasen, R.G., Lukas, J. & Bartek, J. (2004) ATR, Claspin and the Rad9-Rad1-Hus1 complex regulate Chk1 and Cdc25A in the absence of DNA damage. Cell Cycle 3, 7.[Medline]
St Onge, R.P., Besley, B.D., Park, M., Casselman, R. & Davey, S. (2001) DNA damage-dependent and -independent phosphorylation of the hRad9 checkpoint protein. J. Biol. Chem.
276, 4189841905.
St Onge, R.P., Besley, B.D., Pelley, J.L. & Davey, S. (2003) A role for the phosphorylation of hRad9 in checkpoint signaling. J. Biol. Chem.
278, 2662026628.
Thelen, M.P., Venclovas, C. & Fidelis, K. (1999) A sliding clamp model for the Rad1 family of cell cycle checkpoint proteins. Cell 96, 769770.[CrossRef][Medline]
Venclovas, C. & Thelen, M.P. (2000) Structure-based predictions of Rad1, Rad9, Hus1 and Rad17 participation in sliding clamp and clamp-loading complexes. Nucleic Acids Res.
28, 24812493.
Volkmer, E. & Karnitz, L.M. (1999) Human homologs of Schizosaccharomyces pombe rad1, hus1, and rad9 form a DNA damage-responsive protein complex. J. Biol. Chem. 274, 567570.
Wang, Y. & Qin, J. (2003) MSH2 and ATR form a signaling module and regulate two branches of the damage response to DNA methylation. Proc. Natl. Acad. Sci. USA
100, 1538715392. E-pub 3 December 2003.
Wang, X., Wang, L., Callister, M.D., Putnam, J.B., Mao, L. & Li, L. (2001) Human Rad17 is phosphorylated upon DNA damage and also overexpressed in primary non-small cell lung cancer tissues. Cancer Res.
61, 74177421.
Wang, X., Zou, L., Zheng, H., Wei, Q., Elledge, S.J. & Li, L. (2003) Genomic instability and endoreduplication triggered by RAD17 deletion. Genes Dev.
17, 965970.
Weiss, R.S., Enoch, T. & Leder, P. (2000) Inactivation of mouse Hus1 results in genomic instability and impaired responses to genotoxic stress. Genes Dev.
14, 18861898.
Weiss, R.S., Leder, P. & Vaziri, C. (2003) Critical role for mouse Hus1 in an S-phase DNA damage cell cycle checkpoint. Mol. Cell. Biol.
23, 791803.
Yoshida, K., Komatsu, K., Wang, H.G. & Kufe, D. (2002) c-Abl tyrosine kinase regulates the human Rad9 checkpoint protein in response to DNA damage. Mol. Cell. Biol.
22, 32923300.
Zhao, H. & Piwnica-Worms, H. (2001) ATR-mediated checkpoint pathways regulate phosphorylation and activation of human Chk1. Mol. Cell. Biol.
21, 41294139.
Zhou, B.B. & Elledge, S.J. (2000) The DNA damage response: Putting checkpoints in perspective. Nature 408, 433439.[CrossRef][Medline]
Zou, L., Cortez, D. & Elledge, S.J. (2002) Regulation of ATR substrate selection by Rad17-dependent loading of Rad9 complexes onto chromatin. Genes Dev.
16, 198208.
Received: 30 August 2004
Accepted: 21 December 2004
This article has been cited by other articles:
![]() |
Z. Hu, Y. Liu, C. Zhang, Y. Zhao, W. He, L. Han, L. Yang, K. M. Hopkins, X. Yang, H. B. Lieberman, et al. Targeted Deletion of Rad9 in Mouse Skin Keratinocytes Enhances Genotoxin-Induced Tumor Development Cancer Res., July 15, 2008; 68(14): 5552 - 5561. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Niida, Y. Katsuno, B. Banerjee, M. P. Hande, and M. Nakanishi Specific Role of Chk1 Phosphorylations in Cell Survival and Checkpoint Activation Mol. Cell. Biol., April 1, 2007; 27(7): 2572 - 2581. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zaugg, Y.-W. Su, P. T. Reilly, Y. Moolani, C. C. Cheung, R. Hakem, A. Hirao, Q. Liu, S. J. Elledge, and T. W. Mak Cross-talk between Chk1 and Chk2 in double-mutant thymocytes PNAS, March 6, 2007; 104(10): 3805 - 3810. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pandita, G. G. Sharma, A. Laszlo, K. M. Hopkins, S. Davey, M. Chakhparonian, A. Gupta, R. J. Wellinger, J. Zhang, S. N. Powell, et al. Mammalian rad9 plays a role in telomere stability, s- and g2-phase-specific cell survival, and homologous recombinational repair. Mol. Cell. Biol., March 1, 2006; 26(5): 1850 - 1864. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishii, T. Inageta, K. Mimori, T. Saito, H. Sasaki, M. Isobe, M. Mori, C. M. Croce, K. Huebner, K. Ozawa, et al. Frag1, a homolog of alternative replication factor C subunits, links replication stress surveillance with apoptosis PNAS, July 5, 2005; 102(27): 9655 - 9660. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |