HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yasunaga, T. Articles by Nishida, E. Search for Related Content PubMed PubMed Citation Articles by Yasunaga, T. Articles by Nishida, E.

Department of Cell and Developmental Biology, Graduate School of Biostudies, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan

	Abstract

Top Abstract Introduction Results Discussion Experimental procedures References

 
It has been suggested that ILK (integrin-linked kinase) participates in integrin- and growth factor-mediated signaling pathways and also functions as a scaffold protein at cell–extracellular matrix (ECM) adhesion sites. As the recently reported ILK knockout mice were found to die at the peri-implantation stage, the stage specific to mammals, little is known about the function of ILK in early developmental processes common to every vertebrate. To address this, we isolated a Xenopus ortholog of ILK (XeILK) and characterized its role in early Xenopus embryogenesis. XeILK was expressed constitutively and ubiquitously throughout the early embryogenesis. Depletion of XeILK with morpholino oligonucleotides (XeILK MO) caused severe defects in blastopore closure and axis elongation without affecting the mesodermal specification. Furthermore, XeILK MO was found to interfere with cell–cell and cell–ECM adhesions in dorsal marginal zone explants and to result in a significant loss of cell–ECM adhesions in activin-treated dissociated animal cap cells. These results thus indicate that XeILK plays an essential role in morphogenetic movements during gastrulation.

	Introduction

Top Abstract Introduction Results Discussion Experimental procedures References

 
Integrin-mediated cell adhesion to ECM plays important roles for cell survival, cell proliferation, gene expression and embryonic development (Hynes 2002). Integrin-linked kinase (ILK) was identified in a yeast two-hybrid screen as an integrin ß₁-cytoplasmic domain binding protein (Hannigan et al. 1996). ILK comprises an N-terminal ankyrin repeats domain, a C-terminal serine/threonine kinase domain and a pleckstrin homology (PH)-like domain that partially overlaps with the N-terminal region of the kinase domain (Hannigan et al. 1996). It has been suggested that ILK mediates protein–protein interactions, and a number of proteins that interact with ILK have been identified (Wu & Dedhar 2001). Genetic analyses in Drosophila and C. elegans have shown that null mutations of ILK cause defects in muscle attachment (Zervas et al. 2001; Mackinnon et al. 2002), and these results may represent the property of ILK as an adaptor protein. In cultured cell studies, It has been suggested that ILK-mediated signaling is involved in cell survival, cell cycle progression, ECM modification and cell differentiation (Wu & Dedhar 2001; Huang et al. 2000).

Most recently, it has been reported that ILK knockout mice die at the peri-implantation stage because they fail to polarize their epiblast and to cavitate (Sakai et al. 2003). As implantation is a process specific to mammals, little is known about the function of ILK in early developmental processes common to every vertebrate. However, this embryonic lethality of mouse at the peri-implantation stage makes it difficult to study the role of ILK in the developmental processes, such as gastrulation and mesoderm induction, in mammals. Thus, we used Xenopus as a model system to identify the function of ILK in early developmental processes. We isolated a Xenopus ortholog of ILK (XeILK) and performed loss-of-function analyses by using anti-XeILK morpholino oligonucleotides (XeILK MO). Injection of XeILK MO caused severe defects in gastrulation movements. We further demonstrate that XeILK MO perturbed the cell–cell and cell–ECM adhesions in animal cap explants and dorsal marginal zone explants. These results demonstrate that XeILK is an important component of cell adhesions and thus regulates morphogenetic movements during gastrulation in Xenopus.

	Results

Top Abstract Introduction Results Discussion Experimental procedures References

 
Cloning and expression of XeILK

We performed the molecular cloning of a Xenopus ortholog of integrin-linked kinase (XeILK). The deduced amino acid sequence of XeILK is 88%, 59% and 56% identical to human, Drosophila and C. elegans ILK, respectively (Fig. 1A). All three domains in ILK, an N-terminal ankyrin repeats (ANKr) domain, a C-terminal serine/threonine-kinase like domain and a pleckstrin homology-like domain that partially overlaps with the N-terminal region of the kinase domain, are conserved in XeILK (Fig. 1B).

View larger version (70K): [in this window] [in a new window]   Figure 1  Cloning and expression of Xenopus ILK. (A) Alignment of the deduced amino acid sequence of Xenopus ILK with the human, Drosophila and C. elegans ILK proteins. Identical residues are boxed. (B) The schematic structure of XeILK. ILK comprises an N-terminal ankyrin repeat (ANKr) domain (blue), a C-terminal kinase domain (yellow and green) and a pleckstrin homology (PH)-like domain (red and yellow) that partially overlaps with the N-terminal region of the kinase domain. Percent identity of the three domains in ILK between Xenopus and other species are shown below. (C) XeILK mRNA is present during early embryogenesis. Total RNA isolated from indicated stages was subjected to RT-PCR. Xenopus embryonic ornithine decarboxylase (XeODC) is a loading control. Xbra was also examined. No signal was detected in the absence of reverse transcriptase (– RT). (D) Whole-mount in situ hybridization analysis of XeILK at the indicated stages. XeILK sense RNA probe was used as a negative control. (E) XeILK is expressed ubiquitously in the three germ layers at stage 11. Ten embryos (stage 11) were dissected into dorsal mesoderm (DM), ventral mesoderm (VM), endoderm (Endo), and ectoderm (Ecto) regions as shown. Each was processed for RT-PCR. The dorsal mesoderm marker Chordin, the endoderm marker Xsox17, the ventral mesoderm marker Xwnt8, and the pan-mesodermal marker Xbra were also analyzed. (F) XeILK is expressed ubiquitously at stage 24. Five embryos (stage 24) were dissected into head, dorsal, and ventral regions as shown. Each was processed for RT-PCR. The forebrain marker Otx2 and the somitic muscle marker muscle actin were also analyzed.

Role of XeILK in early embryogenesis

To see the function of XeILK during early embryogenesis, we performed loss-of-function analysis. Translation of XeILK mRNA was blocked by a specific anti-XeILK morpholino oligonucleotide (XeILK MO) directed against the 25 bases, which comprises the AUG translational start site and the 22 bases 3' to that site. To confirm the specificity and efficacy of XeILK MO, we performed immunoblotting using a C-terminally myc-tagged XeILK (XeILK-myc). XeILK MO specifically targeted XeILK-myc but did not reduce the protein level of a mutant XeILK-myc, in which mutations were introduced in the XeILK MO target sequence (mut. XeILK-myc) (Fig. 2A). To further confirm the specificity of XeILK MO, we tested the effects of the following control MOs: a five-base mismatched MO (5-mis MO) and an inverted anti-sense MO (inv. MO). A standard control MO (control MO) was also tested to control for the general MO toxicity. These control MOs did not affect the protein level of XeILK-myc or that of mut. XeILK-myc, confirming the specificity of XeILK MO. Injection of XeILK MO into the dorsal marginal zones (DMZ) of the four-cell stage embryos caused severe developmental defects during gastrulation. The XeILK MO-treated embryos showed a marked delay in blastopore lip formation and blastopore closure; they began to proceed when control embryos were in gastrula and neurula stages (Fig. 2B, top and middle panels). Moreover, these processes were abnormal in the XeILK-deficient embryos, and cells were often detached from the embryo and dropped off through the blastopore lip. Then the detached cells accumulated under the vitelline membrane (Fig. 2B, bottom panel). At the tailbud stage, anterior structure defects or dorsal open phenotype were apparent (Fig. 2Cb; Table 1). These defects were reflected in severe defects in the tadpole stage (Fig. 2Db). To confirm that the defects observed in the XeILK MO-injected embryos are specifically caused by XeILK MO, we tested the effect of 5-mis MO or inv. MO. In the 5-mis MO-injected embryos, blastopore closure occurred normally, but blastopore lip formation was often delayed (Fig. 2B, right embryo). At the tailbud and the tadpole stages, about half the embryos developed normally, although anterior structure defects were apparent (Fig. 2Cc upper and Fig. 2Dc, lower; Table 1). The inv. MO-injected embryos developed normally (Fig. 2B,Cd,Dd; Table 1). These data suggest a specific role of XeILK in early embryogenesis, at least in blastopore closure. To further confirm that the XeILK MO-induced phenotypes were due to the insufficient XeILK gene product, we performed a rescue experiment. The effects of XeILK MO could be rescued, although only partially, by co-injecting mut. XeILK, which is not a target for the anti-sense MO. A delay in blastopore lip formation was partially rescued (Fig. 2B, top panel, arrowheads) and blastopore closure occurred almost normally (Fig. 2B, middle and bottom panels). Also the defects observed at the tailbud and the tadpole stages became much milder than those in the XeILK MO-treated embryos (Fig. 2Ce,De; Table 1). Compared with the dorsal injection of XeILK MO, ventral injection resulted in much milder defects during gastrula stages (data not shown). To assess whether XeILK MO-induced phenotypes were due to the cell fate change, we performed an RT-PCR analysis. XeILK-MO injection did not affect the expression of mesodermal markers such as Xbra, Goosecoid and XWnt8 (Fig. 2E). These data indicate that XeILK is required for morphogenetic movements during early embryogenesis but not for cell fate specification.

View larger version (67K): [in this window] [in a new window]   Figure 2  XeILK is required for morphogenesis, but not for mesoderm specification. (A) Anti-XeILK morpholino oligonucleotide (XeILK MO, 25 ng) specifically blocked the translation of injected XeILK-myc mRNA (1.5 ng). XeILK MO did not block the translation of mutated XeILK-myc mRNA (mut. XeILK-myc, 1.5 ng), in which mutations were introduced in the XeILK MO target sequence. A standard control MO (control MO, 25 ng), a five-base mismatched MO (5-mis MO, 25 ng) and an invert of the anti-sense MO (inv. MO, 25 ng) had no effects on the protein level of XeILK-myc or that of mut. XeILK-myc. MAPK is a loading control. (B–D) Injection of XeILK MO caused severe morphogenetic defects during early embryogenesis and partially rescued by co-injecting XeILK mRNA. MOs (25 ng) were injected as indicated into the two dorsal blastomeres of the four-cell stage embryos. For rescue of XeILK depletion, mut. XeILK mRNA (0.5 ng) was co-injected with XeILK MO. (B) During gastrula stages, the XeILK MO-injected embryos showed delay in blastopore lip formation and in blastopore closure. Phenotypes are observed at stage 10.5 (top panels, vegetal view), stage 12 (middle panels, vegetal view) and stage 14 (bottom panels, dorsal view; control MO, 5-mis MO, inv. MO and XeILK MO +XeILK mRNA, vegetal view; XeILK MO). Arrowheads indicate the pigment accumulation, a site for future blastopore lip formation. At (C) the tailbud and (D) the tadpole stages, the XeILK MO-injected embryos showed anterior structure defects or dorsal open phenotypes. (C) (a) The control MO-injected embryos. (b) The XeILK MO-injected embryos. Head defects (lower) or dorsal open phenotype (upper) were apparent. (c) The 5-mis MO-injected embryos. (d) The inv. MO-injected embryos. (e) The XeILK MO plus XeILK mRNA-injected embryos. Co-injection of XeILK mRNA partially rescued the defects caused by XeILK MO. (D) (a) The control MO-injected embryos. (b) The XeILK MO-injected embryos. Head defects (upper) or dorsal open phenotype (lower) were apparent. (c) The 5-mis MO-injected embryos. (d) The inv. MO-injected embryos. (e) The XeILK MO plus XeILK mRNA-injected embryos. Co-injection of XeILK mRNA partially rescued the defects caused by XeILK MO. In (C) and (D), all the embryos are oriented with anterior to the right. (C,a,b(lower),c–e) and (D,a,b(lower),c–e) Lateral view. (C,b(upper)) and (D,b(upper)) Dorsal view. (E) Injection of XeILK MO did not affect the expression of mesodermal markers. MOs (25 ng) were injected as indicated into the two dorsal blastomeres at the four-cell stage. The total RNA isolated from stage 11 embryos were processed for RT-PCR.

To further analyze the effect of XeILK MO, we observed XeILK-deficient embryos in more detail during and after gastrulation. To confirm the specificity of XeILK MO, we also tested the effect of 5-mis MO or inv. MO. We used rhodamine-dextran to trace the cells, which received the morpholino oligonucleotides (MO). Control embryos, in which control MO and rhodamine-dextran were co-injected into the DMZ of the four-cell stage embryos, formed a crescent-shaped blastopore lip dorsally by stage 10.25 (Fig. 3, arrowheads). The formed blastopore lip extended laterally and then ventrally from stage 10.5 to stage 10.75 (Fig. 3, arrowheads), and finally formed a circular blastopore by stage 11 (Fig. 3, stage11). The formed blastopore then gradually closed; the diameter of blastopore gradually decreased (Fig. 3, arrows). In the XeILK-deficient embryos, blastopore lip formation was delayed, and only a pigment concentration (Fig. 3, arrowhead), a site for future blastopore lip formation, was observed by stage 10.25. The blastopore lip began to form by stage 10.5 (Fig. 3, arrowheads). Interestingly, in about half of the embryos, formation of the blastopore lip was inhibited in the rhodamine fluorescence-positive region; the edges of the formed blastopore lip proceeded toward the opposite direction of rhodamine fluorescence-positive region (Fig. 3, stage 10.5 and stage 10.75, arrowheads). As these defects are often observed in the 5-mis MO-treated embryos, but not in the inv. MO-treated embryos (Fig. 3, stages 10.25–10.75), they might be exaggerated by the nonspecific effects of MOs. Finally, the blastopore lip extended to the dorsal side, and an apparently normal blastopore was formed in the XeILK deficient embryos (Fig. 3, stage 11, upper panel). Blastopore closure was also delayed in the XeILK deficient embryos (Fig. 3, arrows). By the morphogenetic movement of the involuting marginal zone (IMZ), the control MO injected region, as revealed by rhodamine fluorescence, gradually narrowed and elongated in the anteroposterior direction (Fig. 3, stage 11, lower panel and stages 11.5–14) (Keller et al. 2003). In XeILK-deficient embryos, however, this axis elongation movement was defective; the rhodamine fluorescence-positive region remained broad (Fig. 3, stage 11, lower panel and stages 11.5–14). Although axis elongation movement was weakly defective in the 5-mis MO-treated embryos compared to the control MO-treated embryos, blastopore closure and axis elongation movement occurred almost normally in the 5-mis MO- or inv. MO-treated embryos (Fig. 3, stages 11–14). These observations indicate that XeILK is specifically required for morphogenetic movements during gastrulation such as blastopore closure and axis elongation.

View larger version (101K): [in this window] [in a new window]   Figure 3  Involvement of XeILK in proper blastopore lip formation, blastopore closure and axis elongation. MOs (25 ng) were injected as indicated into the two dorsal blastomeres of the four-cell stage embryos. Rhodamine-dextran was co-injected with MOs as a lineage tracer. Embryos were observed at indicated stages. Fluorescence view of left panel is shown in right panel. The XeILK MO-injected embryos showed defects in proper blastopore lip formation (arrowheads), blastopore closure (arrows) and anteroposterior axis elongation. (stages 10.25–10.75 and stage 11, upper panels) Vegetal view with dorsal to the top (stage 11, lower panels and stages 11.5–14). Dorsal view with anterior to the top. Arrowheads indicate the edges of the blastopore lip. Arrows indicate the diameter of the blastopore.

We performed an animal cap assay in which convergent extension movements are induced by treating animal cap explants with activin. Rhodamine-dextran was co-injected with MOs as a lineage tracer. In animal cap explants from control MO-injected embryos, addition of activin caused elongation (Fig. 4A,a,f) (Symes & Smith 1987). Unexpectedly, in animal cap explants from XeILK MO-injected embryos, rather than the inhibition of activin-induced elongation, detachment of XeILK-deficient cells from the animal cap explants was observed irrespective of activin addition (Fig. 4A,b,g). This phenotype is reminiscent of the detachment and dropping off of the cells from the embryo injected with XeILK MO into the DMZ (Fig. 2B, bottom), and suggests that XeILK regulates cell–cell and/or cell–extracellular matrix (ECM) adhesion. This function of XeILK seemed cell autonomous, and could not affect the convergent extension movements of the rest of the tissue (Fig. 4Ag). To confirm the specificity of the defects observed in the XeILK MO-treated animal caps, we tested the effect of 5-mis MO or inv. MO. Although weak defects in cell–cell and/or cell–ECM adhesion were observed in the 5-mis MO-injected animal caps (Fig. 4A,c,d, arrows), the 5-mis MO- and inv. MO-injected animal caps were almost normal (Fig. 4A,c,d,h,i), confirming that the defect in cell–cell and/or cell–ECM adhesion was specifically caused by XeILK MO. To further confirm that the XeILK MO-induced defects were due to the insufficient XeILK gene product, we performed a rescue experiment. The effects of XeILK MO could be rescued, although only partially, by co-injecting mut. XeILK, which is not a target for the anti-sense MO; the rhodamine fluorescence-positive cells remained attached to the animal caps (Fig. 4A,e,j; arrowheads). Activin-induced expression of mesodermal markers such as Xbra and Chordin was not affected by the injection of XeILK MO (Fig. 4B).

View larger version (64K): [in this window] [in a new window]   Figure 4  XeILK regulates cell–cell and cell–extracellular matrix adhesions. (A) Cell–cell and/or cell–extracellular matrix adhesions were disrupted in the XeILK deficient cells and partially rescued by co-injecting XeILK mRNA. MOs (25 ng) were injected as indicated into the animal pole region at the four-cell stage. For rescue of XeILK depletion, mut. XeILK mRNA (0.5 ng) was co-injected with XeILK MO. Rhodamine-dextran was co-injected as a lineage tracer. Animal cap explants were excised at stage 8.5 and cultured with or without 10 ng/mL recombinant activin until stage 19. Arrows indicate weak defects in the 5-mis MO-treated animal caps. Arrowheads indicate the rescued animal caps. (B) Activin-induced mesodermal differentiation was not affected by the injection of XeILK MO. Embryos were injected as indicated (25 ng) into the animal pole region at the four-cell stage. Animal cap explants were excised at stage 8.5, cultured with or without 10 ng/mL recombinant activin until stage 10.5 for RT-PCR analysis of Xbra and Chordin expression. (C) Cell–cell and cell–extracellular matrix adhesions were disrupted in the XeILK-deficient dorsal marginal zone (DMZ) explants and partially rescued by co-injecting XeILK mRNA. MOs (25 ng) were injected as indicated into the two dorsal blastomeres at the four-cell stage. For rescue of XeILK depletion, mut. XeILK mRNA (0.5 ng) was co-injected with XeILK MO. Rhodamine-dextran was co-injected as a lineage tracer. At stage 10, DMZ explants were dissected, mounted on to fibronectin-coated coverslips and cultured until stage 19. Magnified images of the middle panels are shown in the bottom panels.

	Discussion

Top Abstract Introduction Results Discussion Experimental procedures References

 
This study has shown that XeILK plays an important role during gastrulation. XeILK is required for blastopore closure and anteroposterior elongation of the body axis but not for cell fate specification. A previous report showed that inhibition of cell–ECM adhesion by fibronectin-blocking antibody could lead to defects similar to XeILK deficient embryos, such as the delay in blastopore closure, anteroposterior axis truncation and head defects (Marsden & DeSimone 2001). Our result that XeILK regulates cell–ECM adhesions is consistent with this report. Regulation of cell–ECM adhesion by XeILK is also consistent with the result of genetic analysis in Drosophila and C. elegans. Loss of ILK expression in Drosophila leads to the severe defect in integrin-mediated adhesion and causes muscle detachment (Zervas et al. 2001). In C. elegans, absence of ILK expression leads to an embryonic lethal phenotype quite similar to the ß-integrin/PAT-3 loss-of-function phenotype called PAT (paralyzed and arrested elongation at the twofold stage) (Mackinnon et al. 2002). Our preliminary experiment showed that XeILK MO inhibited adhesion of cells dissociated from activin-treated animal caps on to the fibronectin-coated coverslips, supporting our idea. Our results also suggest that XeILK is required for cell–cell adhesion. In cultured epithelium cells, ILK over-expression results in disruption of cell–cell adhesion (Hannigan et al. 1996), which is likely caused by inhibition of E-cadherin expression (Wu et al. 1998). However, requirement for ILK in cell–cell adhesion has not been reported. The mechanism by which XeILK regulates cell–cell adhesion remains to be determined. As it has previously been shown that integrin–ECM interactions regulate cadherin-mediated cell–cell adhesion (Marsden & DeSimone 2003), it could be possible that ILK regulates cell–cell adhesion through this kind of mechanism.

To confirm the specificity of XeILK MO, we used the following control MOs: a five-base mismatched MO (5-mis MO) and an invert of the anti-sense MO (inv. MO). No significant differences were observed between the standard control MO (control MO) treatment and the inv. MO treatment, although the 5-mis MO treatment caused weak defects. It has previously been reported that control MOs with four-base mismatches often gave lower rates of defects (Cui et al. 2001).

In cultured cell studies, over-expression of ILK has been shown to result in phosphorylation and inactivation of GSK-3 (Delcommenne et al. 1998). GSK-3 is a negative regulator of the Wnt signaling pathway. Inactivation of GSK-3 activity by ILK was reported to result in the stabilization and nuclear translocation of ß-catenin, leading to regulation of gene expression (Novak et al. 1998; Wu & Dedhar 2001). On the other hand, studies in Drosophila showed that over-expression of ILK did not cause such defects that might result from modulation of ß-catenin-mediated signaling (Zervas et al. 2001). Also, it was demonstrated that treatment of ILK-deficient fibroblasts with PDGF and insulin resulted in robust phosphorylation of GSK-3 (Sakai et al. 2003). Then, to see possible effect of ILK on Wnt signaling in Xenopus, we injected XeILK mRNA into the ventral marginal zone of the four-cell embryos. It is well known that the activation of Wnt signaling on the ventral side of the embryo induces the axis duplication (McMahon & Moon 1989; Pierce & Kimelman 1995; He et al. 1995; Funayama et al. 1995). Over-expression of XeILK, however, did not induce axis duplication (data not shown). We also performed a luciferase reporter assay in animal cap explants with pTOPFLASH, a Wnt/ß-catenin-responsive reporter gene. While XWnt8 potently activated the reporter gene expression, over-expression of XeILK did not (data not shown). Thus, our results suggest that ILK is not directly involved in ß-catenin-mediated signaling in early Xenopus embryogenesis.

Most recently, it was reported that ILK knock-out mice die at the peri-implantation stage because they fail to polarize their epiblast and to cavitate (Sakai et al. 2003). Hence it has been difficult to uncover the function of ILK in later stages in mammals. Our results here report for the first time requirement of ILK in gastrulation in Xenopus. ILK has been shown to interact with many molecules such as ß1-integrin, paxillin, PINCH and - and ß-parvin, and also to be involved in the PKB/Akt mediated signaling pathways (Wu & Dedhar 2001; Zhang et al. 2002). Further studies are required to address the significance of these molecular interactions and signaling pathways in the function of XeILK.

	Experimental procedures

Top Abstract Introduction Results Discussion Experimental procedures References

 
Molecular cloning and plasmid construction

A Xenopus oocyte cDNA library (Clontech) was screened using the human ILK coding region as a probe, and a full-length cDNA clone of XeILK was obtained. The entire coding region of XeILK was amplified by PCR. Mutant XeILK (mut. XeILK) was constructed by the mutagenic oligonucleotides (AGATCTATGGACGATATATTTGCACAATGCAGGGAAGGCAAC), which do not change the amino acid sequence. Myc tag was added to the C-terminus of XeILK.

Xenopus embryo manipulation, in situ hybridization and RT-PCR

In vitro fertilization, injection, whole-mount in situ hybridization and RT-PCR were performed as described (Yamanaka et al. 2002). Primers for Xbra, muscle actin, otx2, Xsox17, Chordin, Xwnt8 and XeODC have been described elsewhere (Hudson et al. 1997; Shibuya et al. 1998; Masuyama et al. 1999). The sequences of other primer pairs used were as follows: XeILK [forward (f), 5'-CCGGCGGGGAATGGCTTTCCTACA; reverse (r), 5'-CGCGCCTTCATGCCAATCTCCA-TG]. The RNAs, morpholino oligonucleotides and dextran were injected into four- or eight-cell stage embryos. Animal caps and dorsal marginal zone (DMZ) explants were dissected at stage 8.5 and stage 10 (Davidson et al. 2002), respectively, and cultured in 1 x Steinberg's solution.

Morpholino oligonucleotides

Antisense morpholinos were obtained from Gene Tools Inc. The morpholino oligo sequences were as follows: XeILK MO, 5'-GACACTGGGCGAAAATGTCATCCAT-3'; a five-base mismatched MO (5-mis MO), 5'-GAGACTCGGCCAAAATGTGATCGAT-3'; an invert of the anti-sense MO (inv. MO), 5'-TACCTACTGTAAAAGCGGGTCACAG-3'; a standard control MO (control MO), 5'-CCTCTTACCTCAGTTACA ATTTATA-3'. Oligos were resuspended in sterile, filtered water and injected. In the experiment shown in Fig. 2As, embryos were injected with MO (25 ng) and mRNA (1.5 ng) into two dorsal blastomeres at the four-cell stage, and cultured until stage 10.5. Each of the five embryos was crushed by pipetting in a buffer (300 µL) containing 20 mM HEPES pH 7.2, 0.25 M sucrose, 0.1 M NaCl, 2.5 mM MgCl₂, 10 mM NaF, 10 mM EGTA, 10 mMß-glycerophosphate, 1 mM vanadate, 1 mM phenylmethylsulfonyl, 0.5% aprotinin, 1 mM dithiothreitol, and then centrifuged at 15 000 x g for 15 min. The supernatant was used for immunoblotting with anti-myc antibody (A-14; Santa Cruz) and anti-Xenopus MAPK antibody (Adachi et al. 2000).

Cell adhesion assays

DMZ explants, dissected as described above, were mounted on to fibronectin-coated coverslips with the deep cells facing the fibronectin substrate and cultured until stage 19. Coverslips were coated with 10 ng/mL fibronectin (Invitrogen, diluted to the appropriate concentration with DPBS) for 2 h at 37 °C.

	Acknowledgements

 
This work was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to E.N.).

	Footnotes

 
Communicated by: Yoshimi Takai

*Correspondence: E-mail: L50174{at}sakura.kudpc.kyoto-u.ac.jp

	References

Top Abstract Introduction Results Discussion Experimental procedures References

 
Adachi, M., Fukuda, M. & Nishida, E. (2000) Nuclear export of MAP kinase (ERK) involves a MAP kinase kinase (MEK)-dependent active transport mechanism. J. Cell Biol. 148, 849–856.[Abstract/Free Full Text]

Cui, Z., Clark, K.J., Kaufmen, C.D. & Hackett. P.B. (2001) Inhibition of skiA and skiB gene expression ventralizes zebrafish embryos. Genesis 30, 149–153.[CrossRef][Medline]

Davidson, L.A., Hoffstrom, B.G., Keller, R. & DeSimone, D.W. (2002) Mesendoderm extension and mantle closure in Xenopus laevis gastrulation: Combined roles for integrin alpha (5) beta (1), fibronectin, and tissue geometry. Dev. Biol. 242, 109–129.[CrossRef][Medline]

Delcommenne, M., Tan, C., Gray, V., Rue, L., Woodgett, J. & Dedhar, S. (1998) Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc. Natl. Acad. Sci. USA 95, 11211–11216.[Abstract/Free Full Text]

Funayama, N., Fagotto, F., McCrea, P. & Gumbiner, B.M. (1995) Embryonic axis induction by the armadillo repeat domain of ß-catenin: Evidence for intracellular signaling. J. Cell Biol. 128, 959–968.[Abstract/Free Full Text]

Hannigan, G.E., Leung-Hagesteijn, C., Fitz-Gibbon, L., et al. (1996) Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature 379, 91–96.[CrossRef][Medline]

He, X., Saint, J.J., Woodgett, J.R., Varmus, H.E. & Dawid, I.B. (1995) Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos. Nature 374, 617–622.[CrossRef][Medline]

Huang, Y., Li, J., Zhang, Y. & Wu, C. (2000) The roles of integrin linked kinase in the regulation of myogenic differentiation. J. Cell Biol. 150, 861–871.[Abstract/Free Full Text]

Hudson, C., Clements, D., Friday, R.V., Stott, D. & Woodland, H.R. (1997) Xsox17 and -ß mediate endoderm formation in Xenopus. Cell 91, 397–405.[CrossRef][Medline]

Hynes, R.O. (2002) Integrins: Bidirectional, allosteric signaling machines. Cell 110, 673–687.[CrossRef][Medline]

Keller, R., Davidson, L.A. & Shook, D.R. (2003) How we are shaped: The biomechanics of gastrulation. Differentiation 71, 171–205.[CrossRef][Medline]

Mackinnon, A.C., Qadota, H., Norman, K.R., Moerman, D.G. & Williams, B.D. (2002) C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Curr. Biol. 12, 787–797.[CrossRef][Medline]

Marsden, M. & DeSimone, D.W. (2001) Regulation of cell polarity, radial intercalation and epiboly in Xenopus: Novel roles for integrin and fibronectin. Development 128, 3635–3647.

Marsden, M. & DeSimone, D.W. (2003) Integrin–ECM interactions regulate cadherin-dependent cell adhesion and are required for convergent extension in Xenopus. Curr. Biol. 13, 1182–1191.[CrossRef][Medline]

Masuyama, N., Hanafusa, H., Kusakabe, M., Shibuya, H. & Nishida, E. (1999) Identification of two Smad4 proteins in Xenopus. Their common and distinct properties. J. Biol. Chem. 274, 12163–12170.[Abstract/Free Full Text]

McMahon, A.P. & Moon, R.T. (1989) Ectopic expression of the proto-oncogene int-1 in Xenopus embryos leads to duplication of the embryonic axis. Cell 58, 1075–1084.[CrossRef][Medline]

Novak, A., Hsu, S.C., Leung-Hagesteijn, C., et al. (1998) Cell adhesion and the integrin-linked kinase regulate the LEF-1 and ß-catenin signaling pathways. Proc. Natl. Acad. Sci. USA 95, 4374–4379.[Abstract/Free Full Text]

Pierce, S.B. & Kimelman, D. (1995) Regulation of Spemann organizer formation by the intracellular kinase Xgsk3. Development 121, 755–765.[Abstract]

Sakai, T., Li, S., Docheva, D., et al. (2003) Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev. 17, 926–940.[Abstract/Free Full Text]

Shibuya, H., Iwata, H., Masuyama, N., et al. (1998) Role of TAK1 and TAB1 in BMP signaling in early Xenopus development. EMBO J. 17, 1019–1028.[CrossRef][Medline]

Symes, K. & Smith, J.C. (1987) Gastrulation movements provide an early marker of mesoderm induction in Xenopus laevis. Development 101, 339–349.[Abstract]

Wu, C. & Dedhar, S. (2001) Integrin-linked kinase (ILK) and its interactors: A new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J. Cell Biol. 155, 505–510.[Abstract/Free Full Text]

Wu, C., Keightley, S.Y., Leung-Hagesteijn, C., et al. (1998) Integrin-linked protein kinase regulates fibronectin matrix assembly, E-cadherin expression, and tumorigenicity. J. Biol. Chem. 273, 528–536.[Abstract/Free Full Text]

Yamanaka, H., Moriguchi, T., Masuyama, N., et al. (2002) JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep. 3, 69–75.[CrossRef][Medline]

Zervas, C.G., Gregory, S.L. & Brown, N.H. (2001) Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J. Cell Biol. 152, 1007–1018.[Abstract/Free Full Text]

Zhang, Y., Chen, K., Guo, L. & Wu, C. (2002) Characterization of PINCH-2, a new focal adhesion protein that regulates the PINCH–1–ILK Interaction, cell spreading, and migration. J. Biol. Chem. 277, 38328–38338.[Abstract/Free Full Text]

Received: 24 December 2004
Accepted: 5 January 2005

This article has been cited by other articles:

				P. C. McDonald, A. B. Fielding, and S. Dedhar Integrin-linked kinase - essential roles in physiology and cancer biology J. Cell Sci., October 1, 2008; 121(19): 3121 - 3132. [Abstract] [Full Text] [PDF]

				Y. Li, C. Dai, C. Wu, and Y. Liu PINCH-1 Promotes Tubular Epithelial-to-Mesenchymal Transition by Interacting with Integrin-Linked Kinase J. Am. Soc. Nephrol., September 1, 2007; 18(9): 2534 - 2543. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yasunaga, T. Articles by Nishida, E. Search for Related Content PubMed PubMed Citation Articles by Yasunaga, T. Articles by Nishida, E.