GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 455-464. doi:10.1111/j.1365-2443.2005.00850.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamasaki, H.
Right arrow Articles by Yoneda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamasaki, H.
Right arrow Articles by Yoneda, Y.

Zinc finger domain of Snail functions as a nuclear localization signal for importin ß-mediated nuclear import pathway

Hideki Yamasaki1,2,{dagger}, Toshihiro Sekimoto3,{dagger}, Tadashi Ohkubo1, Tsutomu Douchi2, Yukihiro Nagata2, Masayuki Ozawa1 and Yoshihiro Yoneda3,*

1 Department of Biochemistry and Molecular Biology, and 2 Department of Gynecology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima 890-8520, Japan
3 Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, Osaka 565-0871, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Snail, a DNA-binding zinc finger protein, functions as a transcriptional repressor for genes including E-cadherin during development and the acquisition of tumor cell invasiveness. Human Snail is a 264-amino acid nuclear protein with an amino-terminal basic amino acid-rich domain (SNAG domain) and a carboxyl-terminal DNA-binding domain (zinc finger domain). A series of fusion proteins composed of green fluorescent protein (GFP) and portions of the Snail protein were generated, and their subcellular localization was examined. Fusion of the four zinc fingers to GFP led to the targeting of GFP to the nucleus, demonstrating that the zinc finger domain is sufficient for nuclear localization. Using an in vitro transport system, the nuclear import of Snail was reconstituted by importin (karyopherin) ß in the presence of Ran and NTF2. We further demonstrated that Snail binds directly to importin ß in a zinc finger domain-dependent manner. These results indicate that zinc finger domain of Snail functions as a nuclear localization signal and Snail can be transported into the nucleus in an importin ß-mediated manner.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Genes of the Snail family encode zinc finger proteins that have been reported to function as transcriptional repressors in a variety of experimental systems (Hemavathy et al. 2000). The Snail families of genes are evolutionarily conserved, and studies have implicated Snail family proteins in the regulation of epithelial-mesenchymal transition in tissue culture systems and in both vertebrate and invertebrate embryos (Leptin 1995; Savagner et al. 1997; Batlle et al. 2000; Cano et al. 2000; LaBonne & Bronner-Fraser 2000; Carver et al. 2001; Locascio & Nieto 2001). Snail binds to specific DNA sequences called E-boxes in the promoter of E-cadherin and other genes and represses their transcription (Batlle et al. 2000; Cano et al. 2000; Guaita et al. 2002; Ikenouchi et al. 2003; Ohkubo & Ozawa 2004). Since E-cadherin is a major cell-cell adhesion molecule in epithelial cells, the down-regulation of E-cadherin expression by Snail is assumed to be responsible for the acquisition of the invasive phenotypes of Snail-expressing tumor cells (Batlle et al. 2000; Cano et al. 2000; Poser et al. 2001). However, in some instances, E-cadherin and Snail mRNA messages have been detected in the same cell lines (Comijn et al. 2001; Hajra et al. 2002; Dominguez et al. 2003).

Control of the nuclear localization of specific proteins is an important mechanism in the regulation of many signal transduction pathways. Transcription factors cannot function until they are translocated to the nucleus in response to specific signals (Vandromme et al. 1996). The translocation of proteins through nuclear pore complexes is mediated by a selective mechanism that is controlled by saturable receptors and specific signals, which are termed nuclear localization signals (NLSs) and nuclear export signals (NESs) (Mattaj & Englmeier 1998; Yoneda et al. 1999).

The best-characterized process of nuclear import has been shown to be mediated by a basic type NLS, referred to as ‘classical NLS,’ which contains one or two clusters of basic amino acids. The import of substrates containing the classical NLS is initiated by the formation of an NLS-dependent ternary complex with importin (also called karyopherin) {alpha}/ß in the cytoplasm. Importin {alpha} recognizes the NLS and binds to importin ß via its N-terminal sequences, which are rich in basic amino acids, and is referred to as the importin ß-binding (IBB) domain (Görlich et al. 1996a). Importin ß accounts for the targeting of the complex to nuclear pore complexes. Nuclear RanGTP terminates the import reaction. After translocation of the trimeric complex, which is composed of importin {alpha} and a karyophile with the classical NLS, through the nuclear pores, the direct binding of nuclear RanGTP to importin ß causes the dissociation of the complex, thus releasing the cargo in the nucleus (Rexach & Blobel 1995; Görlich et al. 1996b; Moroianu et al. 1996). NTF2 (nuclear transport factor 2) mediates the import of RanGDP into the nucleus. In addition to this classical import pathway, several alternate pathways have been identified, which involve importin ß or importin ß family members that bind directly to their cognate cargo proteins without the need for adaptor proteins such as importin {alpha} (Chan et al. 1998; Nagoshi et al. 1999; Yoneda 2000; Kurisaki et al. 2001; Lee et al. 2003).

The Snail family is defined by a highly homologous DNA-binding domain situated at the carboxyl terminus. The domain consists of four to six zinc fingers of the C2H2-type. Outside the zinc-finger domain, there is much less conservation among the family members. Nonetheless, the presence of many basic residues at the amino-terminus suggests that this region might be involved in nuclear localization (Hemavathy et al. 2000). All the vertebrate members contain a conserved motif at their amino-terminus, the so-called SNAG domain. This domain was originally identified in the oncoprotein Gfi-1, which contains six zinc fingers (Grimes et al. 1996). The first 20 amino acids of Gfi-1 are essential for nuclear localization and are necessary and sufficient for transcriptional repression (Grimes et al. 1996). Although the amino-terminal 7 amino acids in the SNAG domain of Gfi-1, which are conserved among the vertebrate Snail family of proteins and Gfi-1 proteins, have been shown to be essential for the nuclear localization of Gfi-1, the NLS of Snail has not been determined. Furthermore, although the nuclear localization of Snail is one of the most crucial processes in the Snail-mediated gene regulation, the precise molecular mechanism for the nuclear import of Snail remains to be determined.

In this study, we show that the carboxyl-terminal zinc finger domain of Snail, which exhibits considerable sequence similarity among family members, is sufficient for the selective nuclear accumulation of Snail. The mechanism of nuclear import was also investigated using a recombinant Snail protein in an in vitro transport assay system and in living cells. Our results indicate that the nuclear import of Snail occurs through a direct interaction of the zinc finger domain with importin ß in a Ran-dependent manner.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Snail protein tagged with GFP at its carboxyl-terminus accumulates in the nucleus and induces epithelial-mesenchymal transition

We previously reported that the Snail protein, when tagged at its carboxyl-terminus with HA (Snail-HA), could be detected in the nuclei of stably transfected canine kidney epithelial MDCK cells (Ohkubo & Ozawa 2004). This suggests that Snail was selectively imported into the nucleus of the transfectants. However, because of the small size of the fusion protein (32 kDa), the possibility that Snail-HA passively diffused into the nucleus and was retained there cannot be excluded, since proteins smaller than ~40 kDa have been reported to enter the nucleus through the nuclear pore complex by passive diffusion (Görlich 1998). To verify the selective nuclear import of Snail, we constructed a full-length Snail fusion protein tagged with GFP at its carboxyl-terminus (Snail-GFP), which would not be expected to enter the nucleus by passive diffusion, and introduced it into MDCK cells. After the isolation of stable transfectants, the subcellular localization of Snail-GFP was examined. Snail-GFP had an apparent molecular mass of ~60 kDa (data not shown) consistent with the estimated molecular mass of the fused proteins.

Like Snail-HA (Ohkubo & Ozawa 2004), Snail-GFP expressed in MDCK cells was detected in the nucleus (Fig. 1B). Interestingly, the expression of Snail-GFP in MDCK cells induced a morphological change; the cells became fibroblastic (Fig. 1A). The down-regulation of E-cadherin expression was also observed in MDCK cells expressing Snail-GFP (Fig. 1C). Thus, Snail-GFP retains the ability to induce epithelial-mesenchymal transition. Therefore, addition of the GFP tag at the carboxyl-terminus had no effect on protein activity. In a control experiment, GFP alone was distributed diffusely throughout both the cytoplasm and the nucleus (data not shown). The nuclear fluorescence observed is probably due to the passive diffusion of 30-kDa GFP. Stable transfectants did not show any morphological changes (not shown), nor was the down-regulation of E-cadherin expression observed (Fig. 1C). These results indicate that Snail-GFP is selectively translocated from the cytoplasm into the nucleus.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 1  A fusion protein composed of Snail and green fluorescent protein is localized in the nucleus and represses E-cadherin expression in MDCK cells. (A) MDCK cells stably expressing a fusion protein composed of Snail and green fluorescent protein at the carboxyl-terminus show morphology similar to fibroblastic cells. (B) The same cells show nuclear accumulation of Snail-GFP. (C) E-cadherin expression is down-regulated in MDCK cells expressing full-length Snail-GFP (Snail-GFP), but not in cells expressing control neo vector, GFP alone, GFP fusion proteins with the amino-terminal region (Snail-N-GFP), the middle part of Snail (Snail-M-GFP), or the carboxyl-terminal portion of Snail (Snail-C-GFP; see Figure 2).

 
The zinc finger domain of Snail is necessary and for its nuclear localization

To define the region of Snail that is required for nuclear translocation, we divided Snail molecule into three parts, the amino-terminal region containing the SNAG domain, the middle portion of Snail, and the carboxyl-terminal region with four zinc finger domains (Fig. 2). Expression vectors encoding the different Snail domains fused to GFP were introduced into MDCK cells, and stable transfectants were isolated. A GFP fusion protein in which the carboxyl-terminal region contained four zinc finger domains (Snail-C-GFP), was exclusively localized to the nucleus (Fig. 3A), suggesting that the region containing the zinc finger domain contains an NLS. On the other hand, constructs containing the amino-terminal region or the middle portion of Snail (Snail-N-GFP and Snail-M-GFP, respectively) both displayed an intracellular localization similar to GFP alone (Fig. 3A), indicating that these regions do not contribute to the intracellular localization of Snail. Immunoblot analysis of cells expressing these constructs, after fractionation into nuclear and cytoplasmic fractions, supported this conclusion, although some Snail-N-GFP was detected in the nuclear fraction (Fig. 3B). Treatment of the transfectants with Leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, had no effect on the distribution of these proteins (data not shown), suggesting that Snail is specifically imported and is efficiently accumulated within the nucleus of MDCK cells even without inhibition of CRM1-mediated nuclear export.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2  Schematic representation of Snail and its derivatives expressed in MDCK cells as fusion proteins with GFP. The basic amino acid-rich SNAG domain is located at the amino-terminus. Four zinc finger domains are located at the carboxyl-terminus.

 


View larger version (59K):
[in this window]
[in a new window]
 
Figure 3  Fusion of the carboxy-terminal four zinc fingers to GFP targeted GFP to the nucleus. (A) Fluorescent microscopic detection of the constructs. MDCK cells stably expressing the constructs were analyzed by fluorescent microscopy. (B) Immunoblot detection of the constructs in the nuclear and cytoplasmic fractions. After fractionation, proteins were run on gels and subjected to immunoblot analysis with anti-GFP antibodies.

 
To further define the region responsible for the observed nuclear localization of Snail, we prepared a series of deletion constructs of the zinc finger domains, which were fused in-frame to GFP (Fig. 2). The expression vectors for these constructs were transfected into MDCK cells, and stable transfectants were isolated. Microscopic observation (data not shown) and a quantitative analysis after cell fractionation (Fig. 4) revealed that deletion of any zinc finger domain singly or in combination significantly diminished the ability of Snail-C-GFP to become localized in the nucleus. Thus, all four zinc fingers are essential for complete nuclear localization.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4  Quantitative analysis of the Snail constructs in the nucleus of stably transfected MDCK cells. Cells expressing different Snail constructs were fractionated. Proteins in the nuclear and cytoplasmic fractions were separated by SDS-PAGE and transferred to nitrocellulose membranes. After immunoblotting with anti-GFP antibodies, signals of the respective bands were quantified. Results are expressed as the percentages of the amounts of each construct in nuclear fraction to the total amount of protein.

 
In order to further confirm this, we employed a HeLa cell system that had been previously used successfully in the analysis of nuclear import. Human Snail was expressed as a fusion protein tagged with GST and GFP at the amino-terminal and carboxy-terminal ends, respectively, in E. coli. Purified GST-Snail-GFP was injected into the cytoplasm of cultured HeLa cells. As shown in Fig. 5, full-length Snail accumulated efficiently in the nucleus after 30 min incubation at 37 °C, whereas no accumulation of co-injected RITC-BSA was detected. Consistent with our observations of the stable transfectants (Fig. 3), a GST-Snail-GFP fusion protein with the Snail carboxyl-terminal region accumulated efficiently in the nucleus, whereas fusion proteins with the Snail amino-terminal region or middle portion did not accumulate at all (Fig. 5). From these findings, we conclude that the C-terminal domain, including the four zinc fingers, functions as an NLS of Snail.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 5  Nuclear accumulation of exogenously injected Snail in living cells. Purified GFP-tagged Snail was injected into the cytoplasm of HeLa cells together with RITC-BSA. After incubation for 30 min at 37 °C, cells were fixed and subcellular localization of fusion proteins were detected.

 
Importin ß mediates the nuclear import of Snail

In order to define the factors required for the nuclear import of Snail, we performed a digitonin-permeabilized cell-free transport assay. As shown in Fig. 6A, in the presence of a previously described ATP regeneration system, GST-Snail-GFP accumulated in nucleus in the presence of exogenous cytosolic extracts but not in their absence. These results were highly reproducible, and indicate that the nuclear import of Snail requires soluble transport factors.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 6  Importin ß mediates nuclear import of Snail in an in vitro transport assay. (A) GST-Snail-GFP was added to digitonin-permeabilized cells and incubated with buffer (–), cytosolic extract (cytosol), importin ß containing Ran and NTF2 (ß) or importin ß alone (ß-Ran/NTF2)). (B) GST-Snail-GFP constructs with either the full-length Snail (full), the amino-terminal region (N), middle portion (M), or carboxyl-terminal region (C) of Snail were incubated with importin ß in the presence of Ran and NTF2.

 
As shown above, the findings herein show that the zinc finger domain, which does not contain the typical classical basic type NLS, functions as the NLS of Snail, suggesting that the classical importin {alpha}/ß-mediated import pathway is not involved in its nuclear import. As expected, we found that GST-Snail-GFP accumulated in the nucleus in the presence of importin ß (Fig. 6A). On the other hand, in the absence of Ran and NTF2, GST-Snail-GFP showed nuclear rim staining, which means its targeting to the nuclear pore complex (Fig. 6A). Furthermore, addition of dominant negative Ran (RanG19V) strongly inhibited nuclear import of Snail (data not shown), indicating that importin ß, Ran and NTF2 play a pivotal role in nuclear import of Snail. When the in vitro assays were performed with Snail-N, Snail-M, and Snail-C constructs, only Snail-C was transported into the nucleus by importin ß-mediated pathway (Fig. 6B). Furthermore, as shown in Fig. 7 lane 3, solution binding assays consistently demonstrated that GST-Snail-GFP binds directly to importin ß. In addition, this interaction is dependent on the NLS of Snail (Fig. 7 lane 12), confirming that the nuclear import of Snail occurs through the direct interaction of importin ß with the zinc finger domains.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7  Zinc finger domain of Snail binds directly to importin ß. GST-Snail-GFP constructs with either full-length Snail (full), the amino-terminal region (N), middle portion (M), or carboxyl-terminal region (C) of Snail were incubated with (lanes 3, 6, 9, 12) or without (lanes 2, 5, 8, 11) HA-importin ß in the presence of anti-HA agarose, and the bound proteins were eluted by SDS sample buffer. *Indicates the position of GST-Snail-GFPs.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The process of epithelial-mesenchymal transition is essential in certain morphogenetic events within the embryo and is strongly associated with pathological processes such as tumor cell invasion (Hay 1995; Thiery 2002). The transcription factors of the Snail family play a critical role in this process, and the down-regulation of E-cadherin expression is one of the primary effects (Batlle et al. 2000; Cano et al. 2000; Blanco et al. 2002; Nieto 2002). Different growth factors, such as fibroblast growth factor and transforming growth factor ß, which have been implicated in the process of epithelial-mesenchymal transitions, have been recently reported to induce the expression of Snail in several cell systems (Spagnoli et al. 2000; Valdes et al. 2002; Peinado et al. 2003; Yanez-Mo et al. 2003).

In addition to transcriptional regulation, the activity of the transcription factors can be controlled by changing their cellular location. This permits rapid response to signals, resulting in a powerful modulation of the system (Beg et al. 1992; Vandromme et al. 1996; Engel et al. 1998; Zhang & Xiong 2001), suggesting that it is important to understand the molecular mechanism of the nuclear import of the transcription factors. In this report, we present data that indicates that the transcription factor Snail enters the nucleus by mechanisms involving importin ß, and that the four carboxyl-terminal zinc finger domains are responsible for its transport into the nucleus.

A previous mutational analysis of the Gfi-1 oncoprotein revealed that a possible NLS is located in the amino terminal SNAG domain, which is found in all the vertebrate members of the Snail family (Grimes et al. 1996). This signal, however, was not sufficient to cause the amino terminal region of Gfi-1, which lacks the carboxyl-terminal zinc finger domain, to localize to the nucleus. The authors proposed that an additional NLS is present in the zinc finger domain, and that the nuclear localization of the Gfi-1 protein is achieved by the concerted effects of an NLS within the SNAG domain and a secondary signal in the zinc finger domain. In contrast to these findings, we found that the carboxy-terminal zinc finger domain, which was stably expressed in MDCK cells as a GFP fusion protein was exclusively detected in nucleus (Fig. 3A). Consistent with our observation that, of the stable transfectants, only the Snail-C-GFP construct, but not the Snail-N-GFP or the Snail-M-GFP constructs, was localized in the nucleus, only GST-Snail-C-GFP was transported into the nucleus in vitro in the presence of importin ß (Fig. 6B). Thus the zinc finger domain of Snail is necessary and sufficient for the nuclear localization of the Snail protein.

In addition, our results revealed that all four zinc fingers are necessary for efficient nuclear localization, because deletion of any individual finger alone or in combination resulted in a decreased nuclear accumulation (Fig. 4). It is likely that all four fingers are required for the coordination of the structure of the carboxyl-terminal domain to interact efficiently with the nuclear import machinery and actually function as the NLS of Snail. The NLS of several zinc finger proteins such as Wilms’ tumor 1 (Wt1) (Bruening et al. 1996), mouse orphan receptor (TR2; Yu et al. 1998), EKLF/KLF1 (Pandya & Townes 2002; Quadrini & Bieker 2002), NGFI-A (Matheny et al. 1994), JAZ (Yang et al. 1999), and Zif268 (Shields & Yang 1997) are known to be localized to their zinc finger regions. However, these proteins appear to have different sequence requirements for nuclear localization. For example, the NLS of Wt1 was delimited to the first (of four) zinc fingers, whereas the second (of two) zinc fingers of TR2 was sufficient for nuclear localization (Bruening et al. 1996; Yu et al. 1998). In contrast, all three zinc fingers are necessary for the efficient nuclear localization of EKLF/KLF1 (Pandya & Townes 2002; Quadrini & Bieker 2002). Results obtained for NGFI-A and JAZ demonstrate that mutations that disrupt the tertiary structure of zinc fingers also abrogated nuclear localization (Matheny et al. 1994; Yang et al. 1999), although the nuclear import activity of EKLF/KLF1 was independent of zinc finger ternary structure (Pandya & Townes 2002). On the other hand, the disruption of any one of the three zinc fingers of Zif268 resulted in cytoplasmic mislocalization (Shields & Yang 1997). It should be noted that there remains a possibility that deletion of any zinc finger domains or disruption of the ternary structure of zinc fingers may cause a loss of DNA binding activity, resulting in a loss of nuclear retention. Therefore, the effects of deletion of zinc finger on the nuclear retention and the importin ß binding activity should be further examined to confirm definitely that all four zinc fingers are actually required for efficient nuclear localization of Snail. In this study, we found that Snail can be transported into the nucleus by pathway involving importin ß. Direct interactions of the zinc finger domain of EKLF/KLF1 with both importin {alpha} ({alpha}1 and {alpha}2) and importin ß were recently reported (Quadrini & Bieker 2002). No experimental evidence to show that the importin-mediated pathways actually transport EKLF/KLF1 was provided in this previous study, however. Thus, this is the first example to definitely demonstrate the nuclear import mechanism of the zinc finger proteins on a molecular basis.

It has been known that importin ß directly interacts with and carries several distinct proteins including importin {alpha} and snurportin as adaptors and the human immunodeficiency virus Rev, cyclin B1, the sterol regulatory element-binding protein 2 and Smad3 as cargoes (Harel & Forbes 2004). Recent advance of crystal structural analysis has revealed that importin ß consists of 19 HEAT repeats and that each interacting protein uses a different binding site on importin ß and has a different binding mode. Thus, it appears that importin ß has the intrinsic flexibility for binding many types of cargoes or adaptors (Lee et al. 2003). This study has added another novel and interesting example of direct binding cargoes for importin ß, the zinc finger protein Snail. Since the structure of the zinc finger domains appears to be quite different from that of known cargoes’ NLS for importin ß, it will be of interest to know how importin ß recognizes such different type of ligands as Snail.

The NES of Snail was recently identified in residues 132–143 of mouse Snail (Dominguez et al. 2003). The activity of the Snail NES appeared to be variable among the cell lines tested. Snail preferred a nuclear location in some cell lines, whereas it had a marked preference for an extranuclear location in others (Dominguez et al. 2003). Snail protein was exclusively detected in the nucleus of MDCK cells used in the present study (Dominguez et al. 2003; Ohkubo & Ozawa 2004), suggesting that the Snail NES is less active in MDCK cells compared with other cells, in which the Snail protein is localized in the cytoplasm. One of the mechanisms that regulate the export of Snail appears to be phosphorylation (Dominguez et al. 2003). Phosphorylation of a Ser-rich sequence adjacent to the NES of Snail facilitates its export. Thus, it would be interesting to determine how the nuclear import and export of Snail are regulated so as to develop a more complete understanding of the function of Snail.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Reagents and antibodies

Enzymes used in the cDNA construction were commercially available products. Leptomycin B (Kudo et al. 1999) was kindly provided by Dr Minoru Yoshida (RIKEN, Tsukuba, Japan). A mouse monoclonal anti-GFP antibody was purchased from Clontech and was used for immunoblotting.

cDNA construction

cDNA, encoding full-length human Snail, has been previously described (Ohkubo & Ozawa 2004). cDNAs encoding various Snail peptide fragments were prepared by PCR using human Snail cDNA as a template. All the constructs expressed in stable transfectants were cloned into an expression vector, pCAGGSneo (Niwa et al. 1991; a gift from Dr K. Yamamura, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, Japan) at a site upstream of green fluorescent protein (GFP) in frame as described in Ozawa (2002). The nucleotide sequences of the primers used for PCR are described below. BamHI and EcoRV sites were created by PCR at the 5'-end and 3'-end of all the constructs, respectively. All PCR products were cloned into the BamHI and EcoRV sites of pBluescript II KS (+) vector (Stratagene) and their sequences were confirmed. The following primers were used: the Snail-N construct (5'-CGGGATCCACTATGCCGCGCTCTTT and 5'-ATCACTCTCCTGGAGCCGAAGG), the Snail-M construct (5'-CGGGATCCACTATGCCAATTGCCTGGGCCTC and 5'-ATCGTTGAAGGCCTTTCGAGCCT), the Snail-C construct (5'-CGGGATCCACTATGGCCTTCAACTGCAAATACTG and 5'-ATCGCGGGGACATCCTGAGCA), the Snail-C-{Delta}ZF1 construct (5'-TGCCATAGTGGATCCACTAGT and 5'-TGCGTCTGCGGAACCTGC), the Snail-C-{Delta}ZF2 construct (5'-GCTCTAGAGTGTGGCTTCGGATGTG and 5'- GCTCTAGAGAAGCCCTTCTCCTGTC), the Snail-C-{Delta}ZF3 construct (5'-AAAGGCTTCTCGCCAGTGTG and 5'-AAAGTACCAGTGCCAGGCGT), the Snail-C-f’ZF4 construct (5'-CGGGATCCACTATGGCCTTCAACTGCAAATACTG and 5'-ATCTGAGTGGGTCTGGAGG), the Snail-C-{Delta}ZF2,3,4 construct (5'-ATCCAGCGTGTGGCTTCGGATG and 5'-ATCGGCTACCCCTACGACG), the Snail-C-{Delta}ZF1,3,4 construct (5'-ATCGCCAGTGTGGGTCCGGAC and 5'-ATCGGCTACCCCTACGACG), the Snail-C-{Delta}ZF1,2,4 construct (5'-AAAGGCCATAGTGGATCCACTA and 5'-AAACCCTTCTCCTGTCCCCAC), the Snail-C-{Delta}ZF1,2,3 construct (5'-AAAGGCCATAGTGGATCCACTA and 5'-AAATACCAGTGCCAGGCGTGT), the Snail-C-{Delta}ZF3,4 construct (5'-GTGGCGGCCGCTCTAGAA and 5'- ATCGAAGGGCTTCTCGCCAGTG), the Snail-C-{Delta}ZF1,4 construct (5'-ATTTGCGGCCGCCATGCTGCCCTGCGTCTGCGG and 5'-ATCGTACTTCTTGACATCTGAGTG), the Snail-C-{Delta}ZF1,2 construct (5'-ATTTGCGGCCGCCATGGGCGAGAAGCCCTTCTCC and 5'-ATCGCGGGGACATCCTGAG), the Snail-C-{Delta}ZF2,4 construct (5'-GTGGCGGCCGCTCTAGAA and 5'-ATCGTACTTCTTGACATCTGAGTG), the Snail-C-{Delta}ZF1,3 construct (5'-ATTTGCGGCCGCCATGCTGCCCTGCGTCTGCGG and 5'-ATCGCGGGGACATCCTGAG), the Snail-C-{Delta}ZF2,3 construct (5'-GGGGTCAAGAAGTACCAGTGCCA and 5'-GGGCAGCGTGTGGCTTCG). The NotI and EcoRV sites were used for ligation of the constructs with the unique NotI and EcoRV sites, which is upstream of the GFP epitope sequence in the pCAGGSneo vector (Ozawa 2002). To construct glutathione S-transferase (GST)-tagged Snail-GFP (GST-Snail-GFP), cDNA encoding full-length Snail-GFP fusion protein was isolated from the pCAGGSneo vector by digestion with NotI and EcoRV and cloned into pGEX4T vector in frame. GST-Snail-GFP fusion proteins with the amino-terminal region of Snail (GST-Snail-N-GFP), the middle portion (GST-Snail-M-GFP), and the carboxyl-terminal portion (GST-Snail-C-GFP) were constructed in exactly the same manner.

Cells and transfection

MDCK cells and their transfectants were grown in Dulbecco's Modified Eagle's Medium (DMEM; Life Technologies, Gaithersburg, MD, USA) supplemented with 10% fetal calf serum under a humidified atmosphere containing 10% CO2 at 37 °C. To obtain transfectants, appropriate expression vectors (5 µg each) were introduced into MDCK cells (5 x 105) by the calcium phosphate method (Ozawa et al. 1989). After selection in medium containing G418, single colonies were isolated and the expression of the constructs was determined by fluorescent microscopic observations of cells for GFP and immunoblot analysis using anti-GFP antibody. The transfected cells were cultured for 24 h in serum-containing medium before subcellular localization analysis. For analysis of the nuclear export of Snail constructs, transfected cells that had been cultured for 24 h were treated with or without 5 ng/mL leptomycin B in serum-containing medium for 2 h.

Immunoblotting

After washing with phosphate-buffered saline (PBS), cells (1 x 106) were boiled for 5 min in Laemmli SDS-PAGE sample buffer, run on 12% polyacrylamide gels, and then electroblotted on to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk in PBS, incubated with primary antibodies for 2 h at room temperature, and finally with secondary antibodies. After washing the membranes with PBS containing 0.05% Tween 20, the protein bands were visualized with an ECL detection kit (Amersham Corp., Amersham, UK).

Subcellular localization analyses

To study the subcellular localization of GFP fusion proteins, GFP fluorescence in transfected cells was visualized with an Olympus fluorescence microscope. To quantify the degree of nuclear localization, cells were fractionated into nuclear and cytoplasmic fractions as follows. Cells were homogenized in 20 mM Tris-HCl buffer, pH 8.0, containing 1 mM phenylmethylsulfonylfluoride, and centrifuged at 5000 r.p.m. for 10 min. The precipitates correspond to the nuclear fractions and the supernatants correspond to the cytoplasmic fractions. Microscopic examination confirmed that the fractionation was valid.

Expression and purification of recombinant proteins

Glutathione S-transferase (GST)-tagged Snail-GFP (GST-Snail-GFP) was expressed and purified as previously described (Nagoshi et al. 1999) with minor modifications. Briefly, a pGEX vector containing GST-Snail-GFP construct was introduced into an Escherichia coli strain BL21. Expression was induced by the addition of 1 mM isopropyl-ß-D-thiogalactopyranoside and incubated for 16–24 h at 18 °C. Cells were harvested by centrifugation and resuspended in a high-salt buffer (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, and 5 mM EDTA) containing 1 mM PMSF, 1 mM DTT, and 2% Triton X-100. After sonication, the extract was clarified by centrifugation and filtered through a 0.45 µm membrane. The extract was applied to a glutathione-Sepharose (Pharmacia) column. After washing with high-salt buffer without Triton X-100 and buffer without Triton X-100 and NaCl, the protein was eluted from the Sepharose beads with Tris-HCl buffer, pH 8.0, containing 10 mM glutathione. HA-importin ß, NTF2 and Ran were expressed, purified as previously described (Imamoto et al. 1995; Sekimoto et al. 1996; Tachibana et al. 1996).

Microinjection

Microinjection was carried out as previously described (Sekimoto et al. 2004). Briefly, HeLa cells were grown in DMEM supplemented with 10% fetal calf serum and plated on coverslips 24 h before use. Purified GST-Snail-GFPs at 2 mg/mL were injected through a glass capillary into the cytoplasm of HeLa cells. To monitor the injection, fluorescent rhodamine isothiocyanate-labeled bovine serum albumin (RITC-BSA) was included in the protein solution. After incubation at 37 °C for 30 min, the cells were fixed with 3.7% formaldehyde in PBS. The injected GFP-tagged protein and RITC-BSA were detected by fluorescent microscopy (Axiophot II; Carl Zeiss, Inc.).

In vitro transport assay

Transport assays were performed as previously described (Sekimoto et al. 2004). Briefly, HeLa cells were plated on eight-well multitest slide (ICN, Costa Mesa, CA) 36–48 h before use. The cells were permeabilized for 5 min in ice-cold transport buffer containing 40 µg/mL digitonin. Each reaction mixture contained an import substrate (10 pmol) combined with cytosol or a combination of recombinant transport factors (each 10 pmol) in the presence or absence of an ATP regeneration system. After incubation at 28 °C for 30 min, the cells were fixed and the import of GST-Snail-GFP was detected by Axiophot microscopy.

Solution binding assay using recombinant proteins

Binding assays using recombinant proteins expressed in E. coli were performed as previously described (Sekimoto et al. 2004). Briefly, purified GST-Snail-GFP (5 µg) and HA-importin ß (5 µg) were mixed in 100 µL of transport buffer containing 0.1% Triton X-100 in the presence of anti-HA agarose (Sigma) at 4 °C for 2 h. After extensive washing, bound proteins were eluted by SDS-sample buffer, applied on SDS-PAGE and stained with Coomassie Brilliant Blue.


    Acknowledgements
 
We wish to thank Drs. Minoru Yoshida (RIKEN, Japan) and Ken-ichi Yamamura (Kumamoto University, Japan) for providing us with reagents. This work was supported by Grant-in-Aid for Scientific Research on Priority Areas (B; no. 11237202 and 11237207), Grant-in-Aid for Scientific Research (B; no. 12480215), Grant-in-Aid for COE Research (No. 12CE2007) from the Japanese Ministry of Education, Culture, Sports, Science and Technology, the Mitsubishi Foundation and the Human Frontiers Science Program.


    Footnotes
 
Communicated by: Yoshimi Takai

{dagger}These authors contributed equally to the article. Back

* Correspondence: E-mail: yyoneda{at}anat3.med.osaka-u.ac.jp. mozawa{at}m.kufm.kagoshima-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Batlle, E., Sancho, E., Franci, C., et al. (2000) The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nature Cell Biol. 2, 84–89.[CrossRef][Medline]

Beg, A.A., Ruben, S.M., Scheinman, R.I., Haskill, S., Rosen, C.A. & Baldwin, A.S. Jr (1992) I kappa B interacts with the nuclear localization sequences of the subunits of NF-kappa B: a mechanism for cytoplasmic retention. Genes Dev. 6, 1899–1913.[Abstract/Free Full Text]

Blanco, M.J., Moreno-Bueno, G., Sarrio, D., et al. (2002) Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21, 3241–3246.[CrossRef][Medline]

Bruening, W., Moffett, P., Chia, S., Heinrich, G. & Pelletier, J. (1996) Identification of nuclear localization signals within the zinc fingers of the WT1 tumor suppressor gene product. FEBS Lett. 393, 41–47.[CrossRef][Medline]

Cano, A., Perez-Moreno, M.A., Rodrigo, I., et al. (2000) The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biol. 2, 76–83.[CrossRef][Medline]

Carver, E.A., Jiang, R., Lan, Y., Oram, K.F. & Gridley, T. (2001) The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol. Cell. Biol. 21, 8184–8188.[Abstract/Free Full Text]

Chan, C.K., Hubner, S., Hu, W. & Jans, D.A. (1998) Mutual exclusivity of DNA binding and nuclear localization signal recognition by the yeast transcription factor GAL4: implications for nonviral DNA delivery. Gene Ther. 5, 1204–1212.[CrossRef][Medline]

Comijn, J., Berx, G., Vermassen, P., et al. (2001) The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol. Cell 7, 1267–1278.[CrossRef][Medline]

Dominguez, D., Montserrat-Sentis, B., Virgos-Soler, A., et al. (2003) Phosphorylation regulates the subcellular location and activity of the snail transcriptional repressor. Mol. Cell. Biol. 23, 5078–5089.[Abstract/Free Full Text]

Engel, K., Kotlyarov, A. & Gaestel, M. (1998) Leptomycin B-sensitive nuclear export of MAPKAP kinase 2 is regulated by phosphorylation. EMBO J. 17, 3363–3371.[CrossRef][Medline]

Görlich, D. (1998) Transport into and out of the cell nucleus. EMBO J. 17, 2721–2727.[CrossRef][Medline]

Görlich, D., Henklein, P., Laskey, R.A. & Hartmann, E. (1996a) A 41 amino acid motif in importin-alpha confers binding to importin-beta and hence transit into the nucleus. EMBO J. 15, 1810–1817.[Medline]

Görlich, D., Pante, N., Kutay, U., Aebi, U. & Bischoff, F.R. (1996b) Identification of different roles for RanGDP and RanGTP in nuclear protein import. EMBO J. 15, 5584–5594.[Medline]

Grimes, H.L., Chan, T.O., Zweidler-McKay, P.A., Tong, B. & Tsichlis, P.N. (1996) The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal. Mol. Cell. Biol. 16, 6263–6272.[Abstract/Free Full Text]

Guaita, S., Puig, I., Franci, C., et al. (2002) Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J. Biol. Chem. 277, 39209–39216.[Abstract/Free Full Text]

Hajra, K.M., Chen, D.Y. & Fearon, E.R. (2002) The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 62, 1613–1618.[Abstract/Free Full Text]

Harel, A. & Forbes, D.J. (2004) Importin beta: conducting a much larger cellular symphony. Mol. Cell 16, 319–330.[Medline]

Hay, E.D. (1995) An overview of epithelio-mesenchymal transformation. Acta Anat. 154, 8–20.[Medline]

Hemavathy, K., Ashraf, S.I. & Ip, Y.T. (2000) Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 257, 1–12.[CrossRef][Medline]

Ikenouchi, J., Matsuda, M., Furuse, M. & Tsukita, S. (2003) Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J. Cell Sci. 116, 1959–1967.[Abstract/Free Full Text]

Imamoto, N., Shimamoto, T., Kose, S., et al. (1995) The nuclear pore-targeting complex binds to nuclear pores after association with a karyophile. FEBS Lett. 368, 415–419.[CrossRef][Medline]

Kudo, N., Matsumori, N., Taoka, H., et al. (1999) Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc. Natl. Acad. Sci. USA 96, 9112–9117.[Abstract/Free Full Text]

Kurisaki, A., Kose, S., Yoneda, Y., Heldin, C.-H. & Moustakas, A. (2001) Transforming growth factor-ß induces nuclear import of Smad3 in an importin-ß1 and Ran-dependent manner. Mol. Biol. Cell 12, 1079–1091.[Abstract/Free Full Text]

LaBonne, C. & Bronner-Fraser, M. (2000) Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration. Dev. Biol. 221, 195–205.[CrossRef][Medline]

Lee, S.J., Sekimoto, T., Yamashita, E., et al. (2003) The structure of importin-beta bound to SREBP-2: nuclear import of a transcription factor. Science 302, 1571–1575.[Abstract/Free Full Text]

Leptin, M. (1995) Drosophila gastrulation: from pattern formation to morphogenesis. Annu. Rev. Cell Dev. Biol. 11, 189–212.[CrossRef][Medline]

Locascio, A. & Nieto, M.A. (2001) Cell movements during vertebrate development: integrated tissue behaviour versus individual cell migration. Curr. Opin. Genet. Dev. 11, 464–469.[CrossRef][Medline]

Matheny, C., Day, M.L. & Milbrandt, J. (1994) The nuclear localization signal of NGFI-A is located within the zinc finger DNA binding domain. J. Biol. Chem. 269, 8176–8181.[Abstract/Free Full Text]

Mattaj, I.W. & Englmeier, L. (1998) Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67, 265–306.[CrossRef][Medline]

Moroianu, J., Blobel, G. & Radu, A. (1996) Nuclear protein import: Ran-GTP dissociates the karyopherin alpha/beta heterodimer by displacing alpha from an overlapping binding site on beta. Proc. Natl. Acad. Sci. USA 93, 7059–7062.[Abstract/Free Full Text]

Nagoshi, E., Imamoto, N., Sato, R. & Yoneda, Y. (1999) Nuclear import of sterol regulatory element-binding protein-2, a basic helix-loop-helix-leucine zipper (bHLH-Zip)-containing transcription factor, occurs through the direct interaction of importin beta with HLH-Zip. Mol. Biol. Cell 10, 2221–2233.[Abstract/Free Full Text]

Nieto, M.A. (2002) The snail superfamily of zinc-finger transcription factors. Nature Rev. Mol. Cell. Biol. 3, 155–166.[CrossRef][Medline]

Niwa, H., Yamamura, K. & Miyazaki, J. (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–199.[CrossRef][Medline]

Ohkubo, T. & Ozawa, M. (2004) The transcription factor Snail downregulates the tight junction components independently of E-cadherin downregulation. J. Cell Sci. 117, 1675–1685.[Abstract/Free Full Text]

Ozawa, M. (2002) Lateral dimerization of the E-cadherin extracellular domain is necessary but not sufficient for adhesive activity. J. Biol. Chem. 277, 19600–19608.[Abstract/Free Full Text]

Ozawa, M., Baribault, H. & Kemler, R. (1989) The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 8, 1711–1717.[Medline]

Pandya, K. & Townes, T.M. (2002) Basic residues within the Kruppel zinc finger DNA binding domains are the critical nuclear localization determinants of EKLF/KLF-1. J. Biol. Chem. 277, 16304–16312.[Abstract/Free Full Text]

Peinado, H., Quintanilla, M. & Cano, A. (2003) Transforming growth factor beta-1 induces snail transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal transitions. J. Biol. Chem. 278, 21113–21123.[Abstract/Free Full Text]

Poser, I., Dominguez, D., de Herreros, A.G., Varnai, A., Buettner, R. & Bosserhoff, A.K. (2001) Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor Snail. J. Biol. Chem. 276, 24661–24666.[Abstract/Free Full Text]

Quadrini, K.J. & Bieker, J.J. (2002) Kruppel-like zinc fingers bind to nuclear import proteins and are required for efficient nuclear localization of erythroid Kruppel-like factor. J. Biol. Chem. 277, 32243–32252.[Abstract/Free Full Text]

Rexach, M. & Blobel, G. (1995) Protein import into nuclei: association and dissociation reactions involving transport substrate, transport factors, and nucleoporins. Cell 83, 683–692.[CrossRef][Medline]

Savagner, P., Yamada, K.M. & Thiery, J.P. (1997) The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J. Cell Biol. 137, 1403–1419.[Abstract/Free Full Text]

Sekimoto, T., Nakajima, K., Tachibana, T., Hirano, T. & Yoneda, Y. (1996) Interferon-gamma-dependent nuclear import of Stat1 is mediated by the GTPase activity of Ran/TC4. J. Biol. Chem. 271, 31017–31020.[Abstract/Free Full Text]

Sekimoto, T., Fukumoto, M. & Yoneda, Y. (2004) 14–3–3 suppresses the nuclear localization of threonine 157-phosphorylated p27 (Kip1). EMBO J. 23, 1934–1942.[CrossRef][Medline]

Shields, J.M. & Yang, V.W. (1997) Two potent nuclear localization signals in the gut-enriched Kruppel-like factor define a subfamily of closely related Kruppel proteins. J. Biol. Chem. 272, 18504–18507.[Abstract/Free Full Text]

Spagnoli, F.M., Cicchini, C., Tripodi, M. & Weiss, M.C. (2000) Inhibition of MMH (Met murine hepatocyte) cell differentiation by TGF (beta) is abrogated by pre-treatment with the heritable differentiation effector FGF1. J. Cell Sci. 113, 3639–3647.[Abstract]

Tachibana, T., Hieda, M., Sekimoto, T. & Yoneda, Y. (1996) Exogenously injected nuclear import factor p10/NTF2 inhibits signal-mediated nuclear import and export of proteins in living cells. FEBS Lett. 397, 177–182.[CrossRef][Medline]

Thiery, J.P. (2002) Epithelial-mesenchymal transitions in tumour progression. Nature Rev. Cancer 2, 442–454.[CrossRef][Medline]

Valdes, F., Alvarez, A.M., Locascio, A., et al. (2002) The epithelial mesenchymal transition confers resistance to the apoptotic effects of transforming growth factor Beta in fetal rat hepatocytes. Mol. Cancer Res. 1, 68–78.[Abstract/Free Full Text]

Vandromme, M., Gauthier-Rouviere, C., Lamb, N. & Fernandez, A. (1996) Regulation of transcription factor localization: fine-tuning of gene expression. Trends Biochem. Sci. 21, 59–64.[CrossRef][Medline]

Yanez-Mo, M., Lara-Pezzi, E., Selgas, R., et al. (2003) Peritoneal dialysis and epithelial-to-mesenchymal transition of mesothelial cells. New Engl. J. Med. 348, 403–413.[Abstract/Free Full Text]

Yang, M., May, W.S. & Ito, T. (1999) JAZ requires the double-stranded RNA-binding zinc finger motifs for nuclear localization. J. Biol. Chem. 274, 27399–27406.[Abstract/Free Full Text]

Yoneda, Y. (2000) Nucleocytoplasmic protein traffic and its significance to cell function. Genes Cells 5, 777–787.[Abstract]

Yoneda, Y., Hieda, M., Nagoshi, E. & Miyamoto, Y. (1999) Nucleocytoplasmic protein transport and recycling of Ran. Cell Struct. Funct. 24, 425–433.[CrossRef][Medline]

Yu, Z., Lee, C.H., Chinpaisal, C. & Wei, L.N. (1998) A constitutive nuclear localization signal from the second zinc-finger of orphan nuclear receptor TR2. J. Endocrinol. 159, 53–60.[Abstract]

Zhang, Y. & Xiong, Y. (2001) A p53 amino-terminal nuclear export signal inhibited by DNA damage-induced phosphorylation. Science 292, 1910–1915.[Abstract/Free Full Text]

Received: 24 December 2004
Accepted: 1 February 2005




This article has been cited by other articles:


Home page
J. Cell Sci.Home page
J.-M. Mingot, S. Vega, B. Maestro, J. M. Sanz, and M. A. Nieto
Characterization of Snail nuclear import pathways as representatives of C2H2 zinc finger transcription factors
J. Cell Sci., May 1, 2009; 122(9): 1452 - 1460.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Y. Beak, H. S. Kang, Y.-S. Kim, and A. M. Jetten
Functional analysis of the zinc finger and activation domains of Glis3 and mutant Glis3(NDH1)
Nucleic Acids Res., March 1, 2008; 36(5): 1690 - 1702.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Saijou, T. Itoh, K.-W. Kim, S.-i. Iemura, T. Natsume, and A. Miyajima
Nucleocytoplasmic Shuttling of the Zinc Finger Protein EZI Is Mediated by Importin-7-dependent Nuclear Import and CRM1-independent Export Mechanisms
J. Biol. Chem., November 2, 2007; 282(44): 32327 - 32337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tsuji, N. Sheehy, V. W. Gautier, H. Hayakawa, H. Sawa, and W. W. Hall
The Nuclear Import of the Human T Lymphotropic Virus Type I (HTLV-1) Tax Protein Is Carrier- and Energy-independent
J. Biol. Chem., May 4, 2007; 282(18): 13875 - 13883.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Arnold, A. Nath, J. Hauber, and R. H. Kehlenbach
Multiple Importins Function as Nuclear Transport Receptors for the Rev Protein of Human Immunodeficiency Virus Type 1
J. Biol. Chem., July 28, 2006; 281(30): 20883 - 20890.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Kim and H. Lee
Importin-beta Mediates Cdc7 Nuclear Import by Binding to the Kinase Insert II Domain, Which Can Be Antagonized by Importin-{alpha}
J. Biol. Chem., April 28, 2006; 281(17): 12041 - 12049.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Arnold, A. Nath, D. Wohlwend, and R. H. Kehlenbach
Transportin Is a Major Nuclear Import Receptor for c-Fos: A NOVEL MODE OF CARGO INTERACTION
J. Biol. Chem., March 3, 2006; 281(9): 5492 - 5499.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamasaki, H.
Right arrow Articles by Yoneda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamasaki, H.
Right arrow Articles by Yoneda, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS