GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2005) 10, 489-502. doi:10.1111/j.1365-2443.2005.00853.x
© 2005 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, X.
Right arrow Articles by Sakaguchi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, X.
Right arrow Articles by Sakaguchi, K.

Fibroblast growth factor 23 reduces expression of type IIa Na+/Pi co-transporter by signaling through a receptor functionally distinct from the known FGFRs in opossum kidney cells

Xiaomei Yan, Hideyuki Yokote, Xuefeng Jing, Li Yao, Takahiro Sawada, Yueqiang Zhang, Sitai Liang and Kazushige Sakaguchi*

Department of Molecular Cell Biology, Institute of Advanced Medicine, Wakayama Medical University, 811-1 Kimiidera, Wakayama 641-8509, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Fibroblast growth factor (FGF) 23 is an important phosphaturic factor that inhibits inorganic phosphate (Pi) reabsorption from the renal proximal tubule. Its overproduction and proteolysis-resistant mutation such as R179Q cause tumor-induced osteomalacia and autosomal dominant hypophosphatemic rickets, respectively. To clarify the signaling mechanisms of FGF23 that mediate the reduction of Pi reabsorption, we inhibited the function of the known FGFRs in opossum kidney (OK-E) cells by expressing a dominant-negative (DN) form of FGFR. OK-E cells, which represent the renal proximal tubular cells, expressed all four known FGFRs. FGF23(R179Q) bound to and activated FGFR2, a prominent FGFR expressed in OK-E cells. The activated receptor transmitted a signal to increase the expression of type IIa Na+/Pi co-transporter and the Pi uptake. Expression of FGFR2(DN), which suppresses the major FGFR-mediated signal through the FRS2{alpha}-ERK pathway, reversed the function of FGF23(R179Q). When FGF23(R179Q) was applied to the basolateral side of polarized OK-E cells, regardless of the FGFR2(DN) expression, the apical Pi uptake decreased significantly. The apical application of FGF23(R179Q) in the polarized cells did not show such decrease but increase. The exogenously expressed FGFR2 was detectable only at the apical membrane. These results suggest that an FGF23 receptor, which is functionally distinct from the known FGFRs, is expressed at the basolateral membrane of OK-E cells.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
FGF23 belongs to a family of FGF ligands. The gene was originally found by homology search of the GENBANK nucleotide sequence database using the amino acid sequence of mouse FGF15 (Yamashita et al. 2000). Subsequently FGF23 gene mutation such as R176Q, R179Q or R179W was found to be associated with autosomal dominant hypophosphatemic rickets (ADHR) by genetic linkage studies (The ADHR Consortium 2000). The mutated gene encodes a protein that is resistant to proteolytic cleavage at the mutated site. FGF23 is the largest FGF that shares 25–36% amino acid identity with other members of the FGF family in the common core sequence, which is located at the amino-terminal side of the ADHR mutation. The carboxy-terminal region is not homologous to other FGFs. Tumor-induced osteomalacia (TIO) is a disorder that shows a phenotype similar to ADHR. At least one of the causative factors for TIO appears to be FGF23 (Shimada et al. 2001). Overproduction of this peptide induces hypophosphatemia that leads to osteomalacia. X-linked hypophosphatemic rickets is another disorder caused by mutations of the gene encoding a protease, PHEX (The HYP Consortium 1995). This disease was first thought to be due to accumulation of FGF23 which was not degraded by the mutated PHEX (Bowe et al. 2001). However, a recent report does not support this hypothesis (Liu et al. 2003). The normal PHEX appears to be incapable of degrading FGF23, and is thus speculated to regulate the expression of FGF23.

One of the main mechanisms regulating the amount of phosphorus in a body fluid is by limiting reabsorption of inorganic phosphate (Pi) from the renal proximal tubule (Murer et al. 2000, 2001). Parathyroid hormone (PTH) inhibits the Pi reabsorption by reducing an apical expression of the type IIa Na+/Pi co-transporter (NaPi-IIa) in the proximal tubule. This mechanism has been studied extensively using an opossum kidney cell line, OK cells (Murer et al. 2000), which represent the proximal renal tubular cells. However, OK cells do not appear to show a consistent response to FGF23; two groups described a decrease (Bowe et al. 2001; Yamashita et al. 2002), and another reported no change (Shimada et al. 2001) in the apical Pi uptake which accounts for Pi reabsorption from the apical side. Currently FGFR3 and FGFR2 are known to bind to FGF23 (Yamashita et al. 2002).

To clarify why the inconsistency of Pi uptake response occurs and to find out the identity of the FGF23 receptor and its downstream signals, we have performed functional studies under the expression of dominant-negative (DN) and wild-type (WT) FGFR2 in OK-E cells, a subclone of OK cells. A retrovirus vector was used to express FGFR2(DN) and FGFR2(WT) to block and stimulate the downstream signals of FGFR, respectively. As a ligand, we have used an ADHR-associated form of FGF23, FGF23(R179Q) (designated FGF23 hereafter). From the difference in functional compartment of FGF23 and FGF2, and in suppressivity of their function by FGFR (DN), we propose that an FGF23 receptor which appears to be functionally distinct from the known FGFRs transmits a signal to reduce Pi uptake.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
OK-E cells respond to FGF23 biphasically in the apical Pi uptake

OK cells are regarded as the cell line that exhibits the Pi transport activity characteristic of the proximal tubular cells (Murer et al. 2000). The phosphaturic function of PTH has been studied extensively in this cell line. The hormone suppresses the apical Pi uptake into OK cells by reducing the apical expression of NaPi-IIa (Murer et al. 1999; Traebert et al. 2000). To examine the effect of FGF23 on the apical Pi uptake by OK-E cells, we plated cells on a plastic plate, and incubated them with varying concentrations of FGF23 for 3 h using FGF2, FGF1 and PTH as control reagents (Fig. 1A). The response to FGF23 was biphasic: the Pi uptake was reduced at low concentrations below 20 ng/mL, and increased at concentrations above 20 ng/mL (Fig. 1A,B). The Pi uptake reached the lowest point at about 5–10 ng/mL (Fig. 1B), and the response became a peak plateau level at about 100 ng/mL. In contrast, FGF2 and FGF1 induced a monophasic response with a peak plateau at 20 ng/mL or higher concentrations (Fig. 1A). PTH is a classical reagent to decrease the Pi uptake, which was also confirmed in our experiment. These findings suggest that OK-E cells express two functionally different receptor types for FGF23. One possibility is that the high-affinity receptor transmits a signal to reduce the Pi uptake, while the low-affinity receptor transmits a signal to increase it. FGF2 and FGF1 might bind to the low-affinity receptor to increase the Pi uptake.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 1  Effect of FGF23, FGF2 or FGF1 on the apical Pi uptake by OK-E cells seeded on a plastic plate. (A) Pi uptake in response to a wide concentration range of various FGFs. Confluent cells were preincubated with a serum-free medium for 3 h, and then exposed to the same medium containing a wide concentration range of FGFs or 0.1 µM PTH for 3 h. The Pi uptake studies were performed as described in Experimental procedures. aP < 0.01 and bP < 0.05 (n = 4) as compared to the value at 0 ng/mL of FGF23, FGF2 or FGF1 using two-tailed Student's t-test. (B) Pi uptake in response to low doses (up to 20 ng/mL) of FGF23. The Experimental procedures are the same as in (A).

 
The known FGFRs are expressed in OK-E cells

To examine the types of known FGFRs expressed in OK-E cells, we performed RT-PCR and immunoblotting studies. For RT-PCR studies, the exact opossum FGFR sequences are not available, so the primers were synthesized from the region where human and mouse have a high homology. The homology of the PCR products was confirmed using the DNA sequencing analysis. In FGFR2, two isoforms that have specific ligand-binding characteristics are known: IIIb (keratinocyte growth factor (KGF) receptor) and IIIc (bek) (Miki et al. 1992). The IIIb form binds to KGF but not to FGF2, whereas the IIIc form binds to FGF2 but not to KGF. Both FGFR2 isoforms bind to FGF1. We examined the presence of these two FGFR2 isoforms using two different forward PCR primers that specify these two isoforms and the same reverse primer. All four known FGFRs were expressed. As shown in Fig. 2A, the direct sequencing of the amplified FGFR cDNAs revealed that their readable regions had a high sequence homology with human counterparts: FGFR1, 99% in amino acids and 85.7% in nucleotides; FGFR2, 94.0% in amino acids and 86.5% in nucleotides; FGFR3, 92.2% in amino acids and 84.4% in nucleotides; FGFR4, 89.8% in amino acids and 81.6% in nucleotides. The molecular masses corresponding to the known four FGFRs were also detectable by immunoprecipitation followed by immunoblotting (Fig. 2B). There appear to be several isoforms for each receptor. FGFR2 exhibited especially fussy masses, which might be explained by the presence of an isoform modified by glycosaminoglycan chains (Sakaguchi et al. 1999a).



View larger version (79K):
[in this window]
[in a new window]
  		Figure 2  Expression of the known FGF receptors in OK-E cells. (A) Amino acid sequence homology of the RT-PCR-amplified opossum FGFRs (upper lanes, bold letters) against human counterparts (lower lanes). RT-PCR was carried out as described in Experimental procedures, and the nucleotide sequences were determined directly from the amplified DNA. Amino acid sequence homologies of the readable nucleotide sequences were 208 out of 209 in FGFR1, 109 out of 116 in FGFR2, 130 out of 141 in FGFR3, and 79 out of 88 in FGFR4. Asterisks indicate amino acid residues identical between the opossum and human sequences. (B) FGFRs expressed in OK-E cells. OK-E cell lysate, 4 mg protein, was immunoprecipitated and immunoblotted by anti-FGFR antibodies listed in Experimental procedures. Detected molecular masses are indicated by arrows, and their sizes are as follows: FGFR1, 165 and 145 kDa; FGFR2, 160, 135 and 120 kDa; FGFR3, 145 and 120 kDa; FGFR4, 150 and 125 kDa. Molecular size markers are shown on the left in kDa. (C) Association of FRS2{alpha} with FGFRs and its phosphorylation after ligand application. Cell lysate, 6 mg protein, which was harvested before and after stimulation (15 min) by FGF2 or FGF23 (50 ng/mL). FRS2{alpha} co-immunoprecipitated with FGFRs was detected using anti-FRS2{alpha} antibody (left panels), and the same filter was reblotted with anti-phosphotyrosine antibody (right panels) after denuding. (D) In vitro binding of FGF23 to the extracellular domains of FGFR2(IIIb) and FGFR2(IIIc) (ExFGFR2(IIIb) and ExFGFR2(IIIc), respectively). The supernatant of COS7 cells with or without expression of human ExFGFR2(IIIb) or ExFGFR2(IIIc) fused to human IgG-Fc was immobilized by GammaBind, and incubated with FGF23-HA-6His. The pulled-down material was fractionated by an SDS-PAGE gel, and FGF23-HA-6His was detected by immunoblotting using anti-HA antibody. Plus marks: the substances included in the incubation mixture; minus marks: those excluded from the mixture.

 
When cells were stimulated with FGF2 or FGF23 (50 ng/mL), and FGFRs were immunoprecipitated from the cell lysate with the same antibodies as those used for the above immunoblotting studies, FRS2{alpha}, a critical FGFR docking protein constitutively binding to FGFRs and mediating their major downstream signals (Kouhara et al. 1997; Hadari et al. 2001), was co-immunoprecipitated and phosphorylated over the basal level (Fig. 2C). The largest amount of FRS2{alpha} was co-immunoprecipitated by anti-FGFR2 antibody. The four antibodies were originally synthesized against the epitopes of human or mouse FGFRs. However, co-immunoprecipitation of FRS2{alpha} by these antibodies supports that they are also effective for opossum FGFRs. To examine the bindability of FGF23 to FGFR2, we have synthesized recombinant extracellular domains of FGFR2(IIIb) and FGFR2(IIIc) fused to IgG-Fc as secreted proteins in COS7 cells, immobilized them by GammaBind which binds to IgG-Fc, and mixed the immobilized recombinant receptor proteins with recombinant FGF23. Then, the substance pulled down by GammaBind was analyzed using immunoblotting following fractionation with an SDS-PAGE gel. As shown in Fig. 2D, a band corresponding to the size of the recombinant FGF23 was detected when the supernatant from the transfected COS7 cells was used (Fig. 2D, 4th and 5th lanes), while the supernatant from the untransfected cells did not produce such a band (Fig. 2D, 3rd lane). Thus, the recombinant receptor proteins that were secreted into the medium (supernatant) bound to recombinant FGF23.

These findings suggest that all four known FGFRs are expressed in OK-E cells with FGFR2 predominantly responding to FGF23 and FGF2. Since the known FGFRs are shown to heterodimerize with each other after ligand application (Bellot et al. 1991), the results also suggest that the exogenous expression of FGFR2(WT) and FGFR2(DN) may reveal the nature of the FGF23 receptor by enhancing and blocking the FGFR-mediated signaling, respectively.

FGFR2(WT) over-expression increases the Pi uptake, and FGFR2(DN) expression induces FGF23 to decrease the Pi uptake

To clarify the function of known FGFRs in the regulation of Pi uptake, we expressed FGFR2(IIIc)(WT) and FGFR2(IIIc)(DN) separately in OK-E cells using a retrovirus vector that co-expresses EGFP (enhanced green fluorescent protein), and performed the apical Pi uptake studies. EGFP gives an advantage to show the expression level of FGFR under the fluorescent microscope. Transduction with M.O.I. of 5 induced EGFP expression in more than 95% of OK-E cells. Expression of FGFR2(IIIc)(WT) with M.O.I. of 2 (OK-E/FGFR2(WT)L) and 5 (OK-E/FGFR2(WT)H) increased the basal Pi uptake in an FGFR2(WT) dose-dependent fashion (Fig. 3A). Phosphorylation levels of FGFR2 and FRS2{alpha} also increased in an FGFR2(WT) dose-dependent fashion (Fig. 3B). In addition, FGFR2(DN) expression at M.O.I. of 5 suppressed even the slightest basal activation of FRS2{alpha}. When these cells were exposed to FGF23 (50 ng/mL), the Pi uptake increased significantly in the cells expressing EGFP alone (vector alone), and decreased significantly in those expressing FGFR2(DN) as compared to each control (vehicle treatment) (Fig. 3C). However, the Pi uptake sustained the high level in cells expressing FGFR2(WT)H even after exposure to FGF23 (Fig. 3C). PTH (0.1 µM) decreased the Pi uptake to a similar extent against the basal level in all these cells. Expression of FGFR1(DN) induced an effect similar to that of FGFR2(DN) (data not shown). Furthermore, when exposed to FGF23 or FGF2 (100 ng/mL), MAP kinases (ERK-1 and ERK-2) were activated by phosphorylation in OK-E cells expressing EGFP alone (OK-E/EGFP), whereas the response was extremely suppressed in the cells expressing FGFR2(DN) (OK-E/FGFR2(DN)) (Fig. 3D). These findings suggest that FGF23 can bind not only to some of the known FGFRs which also bind to FGF2, but to an FGF23 receptor that signals through the pathway unrelated to ERK. The FGF23 receptor transmits a signal to reduce the Pi uptake, whereas the known FGFRs increase the Pi uptake when they are activated by over-expression or ligand application.



View larger version (53K):
[in this window]
[in a new window]
  		Figure 3  Effect of FGFR2(WT) or FGFR2(DN) on the Pi uptake by OK-E cells. (A) Pi uptake in OK-E cells expressing FGFR2(IIIc)(WT) or FGFR2(IIIc)(DN). OK-E cells were transduced with retrovirus expressing EGFP alone (Vector only), FGFR2(WT)-myc (L, M.O.I. = 2; H, M.O.I. = 5) or FGFR2(DN)-myc (M.O.I. = 5). The Pi uptake into these cells was measured as described in Experimental procedures. aP < 0.01 (n = 6) when any two of the groups were compared using Newman-Keuls’ multiple comparison test following anova. (B) Correlation of FGFR2 expression with FRS2{alpha} activation. OK-E cells expressing FGFR2 shown in (A) were kept in a serum-free medium for 3 h, and lyzed for detection of FGFR, phosphorylated FGFR (P-FGFR), phosphorylated FRS2{alpha} (P-FRS2{alpha}), and total FRS2{alpha}. Cell lysate, 2 mg protein, was used for detection of each molecule. P-FGFR was detected using the same membrane as that for FGFR after denuding; P-FRS2{alpha} using the same membrane as that for total FRS2{alpha}. The molecular size of FGFR2(DN) is about 55 kDa, and is not shown. (C) Pi uptake in OK-E cells expressing FGFR(WT) or FGFR(DN) following stimulation with FGF23. OK-E cells expressing EGFP alone, FGFR2(WT)H or FGFR2(DN) were exposed to vehicle, FGF23 (50 ng/mL) or PTH (0.1 µM) for 3 h, and the Pi uptake was measured. Statistical analysis was carried out by ANOVA followed by Newman-Keuls’ multiple comparison test. bP < 0.01 (n = 6) as compared to the vehicle-treated in each transductant; cP < 0.01 (n = 6) as compared to EGFP/Vehicle. (D) Activation of MAPK by FGF2 and FGF23. OK-E cells transduced with the retrovirus vector alone (OK-E/EGFP) and those transduced with the FGFR2(DN)-expressing vector (OK-E/FGFR2(DN)) were exposed to 100 ng/mL of FGF2 or FGF23 for 5 min, and phosphorylated active MAPK (P-ERK1 and P-ERK2) and total MAPK (ERK1 and ERK2) were detected by immunoblotting as described in Experimental procedures.

 
The NaPi-IIa expression and the Pi uptake are correlated, and FGF23 decreases them in the presence of FGFR2(DN) expression

Since the antibody against opossum NaPi-IIa was not available, we have created a system to examine the expression of Flag-NaPi-IIa protein and the Pi uptake after transfection of pcDNA/Flag-NaPi-IIa in OK-E cells. We first tried to express NaPi-IIa by stable transfection. However, the cells lost responsiveness even to PTH after many passages while cloning stable transfectants. Therefore, we decided to use the transient expression system. To avoid unphysiological over-expression of NaPi-IIa and still keep the basal expression level constant among samples, we titrated the amount of DNA (pcDNA/Flag-NaPi-IIa) used for transfection, and found that transfection using Lipofectamine 2000 (Life Technologies) and 1 µg/6-cm plate or 0.1 µg/well of a 24-well plate satisfied these conditions. Total amount of DNA used for transfection was 5 µg/6-cm plate or 0.5 µg/well, and the difference was supplemented with pcDNA vector DNA. As is clearly shown in Fig. 4C,D, the variation of the Pi uptake values for each treatment was very small; the standard deviations were less than 1.5% of the values. The NaPi-IIa expression was unchanged after treatment with actinomycin D, a transcriptional inhibitor, but was almost completely abolished following a 3-h treatment with cycloheximide, a protein synthesis inhibitor (Fig. 4A) as reported before (Murer et al. 2000). PTH decreased the expression of NaPi-IIa in a dose-dependent fashion (data not shown) as reported (Murer et al. 2003).



View larger version (51K):
[in this window]
[in a new window]
  		Figure 4  Characterization of NaPi-IIa expression and Pi uptake in OK-E cells. (A) Responsiveness of NaPi-IIa protein expression to actinomycin D and cycloheximide. OK-E cells transiently expressing Flag-NaPi-IIa was incubated with vehicle, actinomycin D (5 µg/mL) or cycloheximide (10 µg/mL) for 3 h, and lyzed. Cell lysate, 500 µg protein, was used for immunoprecipitation followed by immunoblotting using anti-Flag antibody. Each treatment was carried out in duplicate. (B) Effect of FGF23 (50 ng/mL), FGF2 (50 ng/mL) and PTH (0.1 µm) on the NaPi-IIa expression. OK-E/EGFP or OK-E/FGFR2(DN) transiently expressing Flag-NaPi-IIa was incubated with ligands for 3 h, and the expression of Flag-NaPi-IIa was quantified by immunoblotting following immunoprecipitation. (C) Effect of increasing doses of FGF23 on the Pi uptake in OK-E/EGFP. OK-E/EGFP transiently transfected with pcDNA/Flag-NaPi-IIa or vector alone (w/o Flag-NaPi) was exposed to FGF23, and the Pi uptake was determined as described in Experimental procedures. Bars represent SD (n = 4). (D) Effect of increasing doses of FGF23 on the Pi uptake in OK-E/FGFR2(DN). Experiments were performed as in (C) except that OK-E/FGFR2(DN) was used instead of OK-E/EGFP. Statistical analysis in (C) and (D) was carried out by anova followed by Newman-Keuls’ multiple comparison test. aP < 0.001 (n = 4) as compared to the control (FGF23, 0 w/o Flag-NaPi); bP < 0.05 (n = 4); cP < 0.001 (n = 4). (E) NaPi-IIa expression in OK-E/FGFR2(DN) following exposure to FGF23. OK-E/FGFR2(DN) transfected with pcDNA/Flag-NaPi-IIa was exposed to varying concentrations of FGF23 (0, 6, 12, 25, 50 ng/mL) for 3 h, and the Flag-NaPi-IIa expression was detected as in (B).

 
Under NaPi-IIa transient expression, OK-E/EGFP responded to both FGF23 and FGF2 (50 ng/mL) with an increase in NaPi-IIa expression, whereas OK-E/FGFR2(DN) responded to these ligands differently; a decrease in NaPi-IIa expression in response to FGF23 and a slight increase to FGF2 (Fig. 4B). PTH induced a similar extent of decrease of NaPi-IIa expression in both transductants. These findings were further supported by the Pi uptake studies using OK-E/EGFP and OK-E/FGFR2(DN) in response to increasing concentrations of FGF23 (0–50 ng/mL) (Fig. 4C,D). The transfected NaPi-IIa was functional in increasing the Pi uptake. FGF23 induced a dose-dependent increase of Pi uptake in OK-E/EGFP (Fig. 4C), while it caused a dose-dependent decrease in OK-E/FGFR2(DN) (Fig. 4D). When the NaPi-IIa expression study was carried out under the same conditions as those used for the Pi uptake study in OK-E/FGFR2(DN), the FGF23 dose-dependent decrease of Pi uptake was reflected by the dose-dependent decrease of NaPi-IIa expression (Fig. 4E). Taken together, the good correlation between the Pi uptake and the NaPi-IIa expression suggests that the Pi uptake by OK-E cells is mainly mediated by NaPi-IIa. The results also indicate that the FGF23 receptor transmitting a signal to decrease both the apical Pi uptake and the NaPi-IIa expression is distinct from the known FGFRs represented by FGFR2. FGFR2 appears to be responsible for transmitting a signal to increase both the Pi uptake and the NaPi-IIa expression.

Polarized OK-E cells express an FGF23 receptor that transmits a signal to decrease the apical Pi uptake at the basolateral membrane

In the renal tubules in vivo, humoral factors influence cells from the basolateral membrane. To examine whether the two distinct FGF23 receptors are localized apically or basolaterally, we plated OK-E cells on a porous filter and carried out the apical Pi uptake studies after cells became confluent. When FGF23 was applied to the basolateral side of cells, the Pi uptake reduced in an FGF23 dose-dependent fashion (more than 30% decrease from the basal level at 100 ng/mL) (Fig. 5A), whereas an apical application of FGF23 increased the Pi uptake (Fig. 5B). The cells plated on a plastic plate responded to the apical application of FGF23 biphasically (Fig. 2). However, those on a filter did not show such a biphasic response to FGF23. The response to PTH was significant in both applications. On the other hand, FGF2 did not change the Pi uptake significantly when applied from the basolateral side (Fig. 5C), whereas it increased the Pi uptake when applied from the apical side (Fig. 5D). These findings suggest that OK-E cells express, at the basolateral side, the receptor type that transmits a signal to reduce the Pi uptake, and that the apical side might bear the known FGFRs that increase the Pi uptake by responding to both FGF2 and FGF23.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 5  Effect of basolateral (A, C) or apical (B, D) application of FGF23 or FGF2 on the apical Pi uptake by OK-E cells plated on a filter. Cells confluent on the insert filters were exposed to FGF23 (A, B) or FGF2 (C, D) from either basolateral (A, C) or apical (B, D) side for 3 h. PTH, 0.1 µM, was used as a control reagent. The Pi uptake from the apical side was measured as described in Experimental procedures. Bars represent SD. aP < 0.01 (n = 4) as compared to the value at 0 ng/mL of FGF23 or FGF2 using two-tailed Student's t-test.

 
FGFR2 is expressed and functional solely at the apical membrane

To examine the localization of FGFR2 in OK-E cells, we plated OK-E cells retrovirally expressing FGFR2(WT) and FGFR2(DN) tagged with a myc epitope on a porous filter. When immunostained by anti-myc antibody, both FGFR2(WT) and (DN) were detected only at the apical side of the cells, while EGFP was expressed all over the cell body (Fig. 6A; only FGFR2(WT) is shown). In concordance with the localization of FGFR2, in OK-E/FGFR2(DN) basolateral application of FGF23 (50 ng/mL) induced the same extent of decrease in Pi uptake as in Fig. 5A (Fig. 6B), whereas the increase caused by apical exposure (Fig. 5B) was nullified (Fig. 6C). On the other hand, in the same cells basolateral application of FGF2 (50 ng/mL) induced no change in Pi uptake as is same as the results in Fig. 5A, whereas the response to apical application was completely abrogated. These findings using polarized OK-E cells suggest that the apical localization of FGFR2 corresponds well to the function of FGF23 and FGF2 in the Pi uptake studies using OK-E/FGFR2(DN). The confluent monolayer of OK-E cells does not appear to be leaky to FGF23 or FGF2 at the concentrations examined.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 6  Effect of FGFR2(DN) on the Pi uptake by OK-E cells plated on a filter. (A) Immunocytochemical localization of retrovially expressed FGFR2(IIIc)(WT)-myc (red) co-expressing EGFP (green). The retrovirally transduced OK-E cells were plated on a filter, and the expressed FGFR2(IIIc)(WT)-myc was visualized by immunostaining using anti-myc antibody as the first antibody followed by a confocal analysis. Top panels represent horizontal views at the apical surface; bottom panels show the vertical views of the sections at the yellow line. a: apical side, b: basolateral side. (B) Effect of basolateral application of FGF23 or FGF2 (50 ng/mL) on the apical Pi uptake in OK-E/FGFR2(DN). PTH, 0.1 µm, was used as a control reagent. The apical Pi uptake was measured as in Figure 5. Bars represent SD. (C) Effect of apical application of FGF23 or FGF2 (50 ng/mL) on the apical Pi uptake in OK-E/FGFR2(DN). Procedures were same as in (B) except that reagents were applied from the apical side. Statistical analysis in (B) and (C) was carried out by anova followed by Newman-Keuls’ multiple comparison test. aP < 0.001 (n = 4) as compared to the cells treated with vehicle alone or FGF2 (50 ng/mL).

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
We have discovered that OK-E cells bear both the known FGFRs and a distinct receptor for FGF23. The biphasic response of Pi uptake to FGF23 in contrast to the monophasic response to FGF2 in the cells seeded on a plastic plate suggests the presence of two functionally distinct receptors for FGF23. The bindability of FGF23 to FGFR2(IIIc) and the reversal of the FGF23-induced response in Pi uptake from increase to decrease in the presence of FGFR2(IIIc)(DN) expression suggest that one of the receptor types comprises the known receptors. Furthermore, the increase of Pi uptake in response to FGF2 application or FGFR2(WT) over-expression suggests that the increase in Pi uptake is attributed to the activation of known FGFRs bindable to FGF2, while the decrease is to the activation of a functionally distinct FGF23 receptor which remains to be determined molecularly. The known FGFRs and the FGF23 receptor appear to transmit distinct downstream signals following FGF23 binding; the former transmitting the signal through the FRS2{alpha}-Ras-ERK pathway and the latter an unidentified signal. These findings under the expression of FGFR2(WT) or FGFR2(DN) can be generalized for all the FGFRs based on the current knowledge that four FGFRs are known to heterodimerize with each other and transmit a signal through the same pathway via FRS2{alpha} (Bellot et al. 1991). This hypothesis is further supported by the same effect induced by FGFR1(DN).

The high responsiveness to applications of PTH and FGF23 is one of the main characteristics of the renal proximal tubular cells (Tenenhouse & Sabbagh 2002). The renal tubular cells respond to these humoral factors from the basolateral side in vivo, since any peptide hormones are not filtered through the glomeruli unless they are damaged. OK cells are regarded as a model cell line showing some of the characteristics of renal proximal tubular cells, but an immortal line that might have lost some of the functions that are present in the native renal proximal tubular cells and gained some functions that are not present in the native cells. Since OK-E cells, a subclone of OK cells, responded to the basolateral application of PTH with a large decrease in Pi uptake, we regard the cell line as retaining the major functions of the native tubular cells. Our immunocytochemical and functional studies in OK-E cells plated on a filter, which are regarded as polarized and more differentiated than those on a plastic plate, indicate that the FGF23 receptor is mainly expressed at and functional from the basolateral side as opposed to the exclusive apical expression and function of the known FGFRs. These findings together with opposite functions of the two types of receptors might explain at least partially the inconsistent findings of Pi uptake in OK cells (Bowe et al. 2001; Shimada et al. 2001; Yamashita et al. 2002). However, it is not clear whether the function of the known FGFRs in increasing the Pi uptake represents the native one in vivo.

According to one study (Yamashita et al. 2002), they could get a decrease of Pi uptake in response to FGF23 only in the presence of 10 µg/mL of heparin, and their study was limited to 0–10 ng/mL of FGF23. The requirement of heparin might be due to the nature of FGF23; theirs is mouse normal FGF23 while ours is human FGF23 with an ADHR-type mutation, since the proteolysis-protective and potentiating effects of heparin on FGF are well known (Gospodarowicz & Cheng 1986; Rosengart et al. 1988; Damon et al. 1989). We could get a good Pi-uptake response to the proteolysis-resistant mutated FGF23 without heparin. When the concentration range is limited to 0–10 ng/mL, our results are similar to theirs. However, we reached a quite different conclusion using a wider concentration range of FGF23 and polarized cells on a filter. We found that known FGFRs do not mediate the function of FGF23 in decreasing the apical Pi uptake in OK-E cells. ERK activation by FGF23 is related not with a decrease but with an increase in the Pi uptake. They assumed FGFR3 as an FGF23 receptor based on the reported high expression of FGFR3 in the rat proximal tubule (Cancilla et al. 2001), its expression in OK cells, and its in vitro bindability to FGF23. According to them, the requirement of FGFR3 in inducing the inhibition of Pi uptake was examined using a chemical inhibitor (SU5402). This chemical might be specific to FGFRs when compared with the effects on the known other receptor tyrosine kinases. However, it might inhibit the distinct FGF23 receptor. The MAPK inhibitors (PD98059 and SB203580) were also used to show the requirement of ERK and p38MAPK activation. However, we do not know their effects on the distinct FGF23 receptor that we claim to be present, and on the receptor's downstream signal transduction pathway which we do not know now. On the other hand, we have found that OK-E cells express all four known FGFRs, among which FGFR2 binds to FGF23 and elicits a signal through the FRS2{alpha}-Ras-ERK pathway. Retrovirus-mediated expression of FGFR2(DN) in almost 100% of the mass-cultured cells has led us to conclude that the FGF23 receptor responsible for decreasing the Pi uptake is functionally different from the known FGFRs. The discrepancy between their results and ours might also be explained by the differences in FGF23 preparation, mouse normal vs. human mutated, and by the cells used in the study, OK vs. OK-E subclonal line. These points will remain to be clarified until we know the molecular identity of the FGF23 receptor.

In our studies, the effect of FGF23 on the Pi uptake corresponded well with that on the NaPi-IIa expression. The finding that a 3-h treatment with cycloheximide, a protein synthesis inhibitor, completely nullified the expression of NaPi-IIa supports that a metabolic pathway that transports and degrades the protein in the cell is in operation as reported before (Pfister et al. 1998). The protein appears to be turning over very quickly with less than 3 h for total replacement. The transiently expressed NaPi-IIa was functional in transporting Pi into OK-E cells, and FGF23 decreased the amount of NaPi-IIa in a dose-dependent fashion by binding to the FGF23 receptor (in the presence of FGFR2(DN) expression). This effect is apparently similar to the function of PTH. The reported functional studies of PTH in OK cells indicate that the hormone induces NaPi-IIa to translocate from the apical surface into the cytoplasm for degradation in the lysosome (Pfister et al. 1998; Murer et al. 1999, 2003). The exact cellular mechanism for FGF23 signal to decrease the NaPi-IIa expression is not known (Saito et al. 2003; Shimada et al. 2004). The signals via the known FGFRs, the FGF23 receptor and PTH receptor appear to converge on the expression level of NaPi-IIa, and affect the apical Pi uptake in OK-E cells. The FGF23-transgenic mice that express FGF23 in heart, brain and thymus appear to express less NaPi-IIa at the apical side of proximal renal tubules and show typical hypophosphatemic features (Shimada et al. 2003). The in vivo renal tubular cells have a direct contact with the blood circulation only through their basolateral side. Therefore, their finding is consistent with ours in that FGF23 functions from the basolateral side.

In conclusion, we have found that FGF23 can bind to some of the known FGFRs and a functionally distinct FGF23 receptor. The present study also suggests that the FGF23 receptor transmits a signal to reduce both the expression of NaPi-IIa and the Pi uptake through a pathway unrelated to ERK in OK-E cells, whereas the known FGFRs signal to increase the Pi uptake. OK-E cells plated on a plastic plate appear to express both types of receptors at the apical membrane. However, the polarized cells plated on a filter express the FGF23 receptor at the basolateral membrane while expressing FGF2-binding receptors at the apical membrane. Molecular identification of the FGF23 receptor will help clarify the nature of Pi metabolism.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
FGF preparations

Human mutant FGF23 having the R179Q substitution (The ADHR Consortium 2000) and a carboxy-terminal tag encoding HA-6His was created in E. coli using a bacterial expression vector, pTrcHis (Invitrogen), as a mature peptide (FGF23(R179Q)-HA-6His). The human peptide was purified by Talon affinity chromatography followed by purification using heparin-Sepharose affinity chromatography. The preparation was quantified against a peptide, GST-HA-6His, by immunoblotting using anti-HA antibody as the first antibody. This mutant FGF23 resistant to proteolytic cleavage was used in all the studies. FGF1 and FGF2 were human recombinant peptides purchased from R & D systems.

Cell culture

OK-E cells were maintained in a medium containing 5% foetal calf serum in 50% Dulbecco's minimum essential medium/50% Ham's F12 medium in 10-cm culture dishes (Greiner bio-one). HEK293 cells used for retrovirus production were maintained in a medium containing 10% foetal calf serum in Dulbecco's minimum essential medium.

Pi transport studies

OK-E cells were seeded in 24-well plastic plates (Greiner bio-one) or in cell culture filter inserts (Falcon Cat#[35]3095) with a seeding number of 1.5 x 105 or 2.0 x 105 per well or insert, respectively. Cells were maintained for 4 days or until they become confluent in the wells or inserts. The medium was replaced and incubated with serum-free medium for 3 h, and FGF23 or human PTH(1-34) was added to make the final concentrations, and incubated with the cells for 3 h before measuring Pi transport. Pi transport was measured at 0.1 mM phosphate concentration with [32P] dibasic potassium phosphate in the uptake solution containing 137 mM NaCl (replaced by choline chloride for Na-free solution); 5.4 mM KCl, 2.8 mM CaCl2, 1.2 mM MgSO4 and 10 mM HEPES/Tris, pH 7.4.

In the studies using cells seeded on plastic plates, cells were washed with the uptake solution containing NaCl three times, and incubated with the same uptake solution added with 0.1 mM phosphate and isotope for exactly 8 min. The Pi uptake was stopped by an ice-cold stopping solution containing 137 mM NaCl and 14 mM HEPES/Tris, pH 7.4, and washed with the same solution three times. Then, cells were lyzed in 0.1 N NaOH, and the radioactivity was measured using a scintillation counter after mixing with a scintillation cocktail, Hionic-Fluor (Perkin-Elmer). In the studies using cells seeded on filter inserts, cells were washed with the Na-free solution from both apical and basolateral sides three times, and the apical Pi uptake was carried out by incubating cells with the uptake solution containing 137 mM NaCl, 0.1 mM phosphate and isotope on the apical side. The basolateral side was bathed in the Na-free solution. The uptake was stopped and the radioactivity counted by the same method as described above. Nonspecific binding (blank) was assessed measuring the zero-time uptake by starting uptake in an ice-cold isotonic solution and immediately aspirating the uptake solution followed by three washes with the same ice-cold isotonic solution. The nonspecific binding was less than 10% of the radioactivity at any experimental point in both types of studies using plastic plates or filter inserts, and the value was subtracted from that of the total binding. The Pi uptake was always corrected by the protein amount in the cell lysate per well or insert.

Transfection, immunoprecipitation and immunoblotting

Mouse NaPi-IIa was incorporated into an eukaryotic expression vector, pcDNA3.1, with a Flag-encoding sequence fused at the 5' end (pcDNA/Flag-NaPi-IIa). The protein was expressed as a molecule N-terminally fused with Flag via Lipofectamine 2000 (Life Technologies)-mediated transfection. Cells were lyzed for immunoprecipitation using anti-Flag antibody at 36–48 h of transfection. Whenever necessary, cells were treated with reagents or humoral factors for 3 h before lysis. The lysis buffer contained 20 mM Tris-HCl buffer, pH 7.5, 1% Triton X-100, 0.1% sodium deoxycholate, 150 mM NaCl, 0.1% sodium dodecyl sulfate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate and protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µM aprotinin, 1 µM leupeptin, and 1 µM pepstatin A). Immunoprecipitated proteins were fractionated by an SDS-PAGE gel, blotted on to a PVDF membrane, and incubated with anti-Flag antibody. For immuno-detection, the ECL Western Blotting Detection System was used according to the manufacturer's instructions (Amersham Biosciences, Code#RPN2108).

For immunodetection of FGFRs and FRS2{alpha}, cells were incubated with a serum-free medium for at least 3 h, exposed to FGF23, FGF2 or vehicle alone for 15 min and lyzed. FGFRs immunoprecipitated by their specific antibodies and FRS2{alpha} co-immunoprecipitated with FGFRs were detected by immunoblotting using the specific antibodies or an anti-phosphotyrosine antibody. In the case of detecting activated FRS2{alpha} in stable FGFR2 transductants, individual proteins were immunoprecipitated using specific antibodies or an antibody against the epitope tag followed by immunoblotting with the same antibodies or an anti-phosphotyrosine antibody.

For detection of ERK and phosphorylated ERK, cells were exposed to FGF for 5 min after incubating them in a serum-free medium for at least 3 h, and lyzed in the lysis buffer described above. Cell lysate (50 µg of total protein) from each sample was used for immunoblotting using rabbit anti-phospho-p44/42 polyclonal MAPK (Thr202/Tyr204) antibody (Cell Signaling Tech., 9101) and rabbit anti-p44/42 MAPK polyclonal antibody (Cell Signaling Tech., 9102).

In vitro binding assay

The cDNA encoding the extracellular domain of human FGFR2(IIIb) or FGFR2(IIIc) fused to human IgG-Fc in a pCMV vector was transfected into COS7 cells, and the recombinant protein in the supernatant was immobilized by GammaBind (Pharmacia). The immobilized recombinant FGFR2 extracellular domain was incubated with recombinant FGF23(R179Q)-HA-6His, and the pulled-down material was fractionated by an SDS-PAGE gel. The bound ligand was detected by immunoblotting using anti-HA antibody.

Retrovirus-mediated expression

For expression using retrovirus, we have constructed human wild-type FGFR2(IIIc) (FGFR2(WT)) (Sakaguchi et al. 1999b), and dominant-negative FGFR2(IIIc) (FGFR2(DN)) linked to the enhanced green fluorescent protein (EGFP) through the IRES (internal ribosomal entry site) sequence in the pMXs-IG vector (a gift from Dr Kitamura, University of Tokyo). FGFR2(DN) is devoid of the whole cytoplasmic domain but retains the extracellular and the transmembrane domains. Human FGFR1(DN) was also constructed in a way similar to FGFR2(DN) in the same vector. A myc epitope was fused to FGFR2(WT), FGFR2(DN) and FGFR1(DN) at their carboxy-termini. These pMXs-IG constructs were co-transfected with pCAGVSV-G (encoding vesicular stomatitis virus surface protein at the downstream of a chicken ß-actin promoter) into 293/gpIRES cells (a gift from Dr Miyazawa, Osaka University), HEK293 cells stably transfected with pGag-pol-IRES-bsr (created by Dr Kitamura, University of Tokyo). The resulting pseudo-typed retrovirus particles in the culture supernatant were concentrated using centrifugation at 140 000 g for 90 min. The concentrated retrovirus particles were resuspended in the culture medium, and used for transduction of OK-E cells at M.O.I. (multiplicity of infection) of 5 unless otherwise specified. Transduction at M.O.I. of 5 gave an expression efficiency of more than 95%.

RT-PCR

RT-PCR was performed according to the manufacturer's instructions (Perkin-Elmer) with 35 cycles of the following thermal cycling: 30 s of 95 °C, 30 s of 55 °C and 1 min of 72 °C. Primers used for the reactions were listed as follows with suffixes F and R indicating the forward and the reverse primers, respectively: CTGCGCAGACAGGTAACAGT (FGFR1-F), GGTGCCATCCACTTCACAGG (FGFR1-R), TATAGGGCAGGCCAACCAGTC (FGFR2(IIIb)-F), ATATACGTGCTTGGCGGGTAA (FGFR2(IIIc)-F), TTGTCAATTCCCACTGCTTC (FGFR2-R), GATGCTGAAAGATGATGCGACTG (FGFR3-F), GTGGGTGTAGACTCGGTCAAAAAG (FGFR3-R), TGCGCCGCCAAGGGAAACCT (FGFR4-F), GAGCCCCCGAGGGTGAAG (FGFR4-R). The PCR products were fractionated by 2% agarose gel electrophoresis, and their nucleotide sequences were determined.

Immunostaining and confocal studies

OK-E cells transduced with the retrovirus that co-expresses EGFP and FGFR2(WT)-myc or FGFR2(DN)-myc were plated on a filter (Falcon cell culture inserts, Cat#[35]3090 or [35]3095), and kept for at least 48 h. Fixation was carried out in 3.7% formaldehyde (pH 7.4) for 10 min at room temperature, and permeabilized with 0.2% Triton X-100 in PBS for 5 min on ice after washing the cells three times with PBS. Incubation with the 1st antibody (anti-myc antibody) was initiated after washing permeabilized cells three times with PBS containing 1% normal goat serum. After 1-h incubation with the 1st antibody, samples were washed with PBS containing 1% normal goat serum and incubated with the 2nd antibody conjugated with AlexaFluor568 for 1 h. Cells on a filter were then washed with PBS three times, and mounted in GEL/MOUNT (Biomeda Corp., Foster City, CA, USA). Immunofluorescence was detected using a confocal microscopy system equipped with Bio-Rad Radiance 2000.

Antibodies

The followings are the antibodies used in the current study: mouse anti-myc antibody derived from hybridoma MYC1-9E10.2 (ATCC); mouse anti-Flag antibody derived from hybridoma (Sigma-Aldrich Co., FLAG M2); rabbit anti-FGFR1 polyclonal antibody (Sigma-Aldrich, F5421); rabbit anti-FGFR2 polyclonal antibody (Sigma-Aldrich, F6796); rabbit anti-FGFR3 polyclonal antibody (Sigma-Aldrich, F3922); rabbit anti-FGFR4 polyclonal antibody (Santa Cruz, sc-9006); mouse monoclonal anti-phosphotyrosine antibody, clone 4G10 (Upstate); rabbit anti-FRS2{alpha} polyclonal antibody (Santa Cruz, sc-8318); rabbit anti-phospho-p44/42 polyclonal MAPK (Thr202/Tyr204) antibody (Cell Signaling Tech., 9101); rabbit anti-p44/42 MAPK polyclonal antibody (Cell Signaling Tech., 9102).

Statistical analysis was carried out using Student's t-test or ANOVA followed by Newman-Keuls’ multiple comparison test as described in each figure.


   Acknowledgements
 
We are grateful to the kind gift of OK-E cells from Dr Peter A. Friedman (University of Pittsburgh). Research was supported in part by grants to K.S. from the Japan Society for the Promotion of Science (Grant-in-Aid for Scientific Research (C)), from the Ministry of Education, Culture, Sports, Science and Technology, the Japanese Government (Special Coordination Funds for Promoting Science and Technology), from the Wakayama Medical University (Research Grant on Priority Areas), from the Wakayama Foundation for the Promotion of Medicine (Medical Research Grant), and from the Uehara Memorial Foundation (Research Grant), foreigner's research grants to S.L and Y.Z. from the Wakayama Foundation for the Promotion of Medicine sponsored by NORITSUKOKI CO., LTD, and the Japanese Government Scholarship to X.Y.


   Footnotes
 
Communicated by: Yoshimi Takai

* Correspondence: E-mail: ksaka{at}wakayama-med.ac.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bellot, F., Crumley, G., Kaplow, J.M., Schlessinger, J., Jaye, M. & Dionne, C.A. (1991) Ligand-induced transphosphorylation between different FGF receptors. EMBO J. 10, 2849–2854.[Medline]

Bowe, A.E., Finnegan, R., Jan de Beur, S.M., et al. (2001) FGF-23 inhibits renal tubular phosphate transport and is a PHEX substrate. Biochem. Biophys. Res. Commun. 284, 977–981.[CrossRef][Medline]

Cancilla, B., Davies, A., Cauchi, J.A., Risbridger, G.P. & Bertram, J.F. (2001) Fibroblast growth factor receptors and their ligands in the adult kidney. Kidney Int. 60, 147–155.[CrossRef][Medline]

Damon, D.H., Lobb, R.R., D’Amore, P.A. & Wagner, J.A. (1989) Heparin potentiates the action of acidic fibroblast growth factor by prolonging its biological half-life. J. Cell. Physiol. 138, 221–226.[CrossRef][Medline]

Gospodarowicz, D. & Cheng, J. (1986) Heparin protects basic and acidic FGF from inactivation. J. Cell. Physiol. 128, 475–484.

Hadari, Y.R., Gotoh, N., Kouhara, H., Lax, I. & Schlessinger, J. (2001) Critical role for the docking-protein FRS2a in FGF receptor-mediated signal transduction pathway. Proc. Natl. Acad. Sci. USA 98, 8578–8583.[Abstract/Free Full Text]

Kouhara, H., Hadari, Y.R., Spivak-Kroizman, T., et al. (1997) A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89, 693–702.[CrossRef][Medline]

Liu, S., Guo, R., Simpson, L.G., Xiao, Z.S., Burnham, C.E. & Quarles, L.D. (2003) Regulation of fibroblastic growth factor 23 expression but not degradation by PHEX. J. Biol. Chem. 278, 37419–37426.[Abstract/Free Full Text]

Miki, T., Bottaro, D.P., Fleming, T.P., et al. (1992) Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene. Proc. Natl. Acad. Sci. USA 89, 246–250.[Abstract/Free Full Text]

Murer, H., Forster, I., Hernando, N., Lambert, G., Traebert, M. & Biber, J. (1999) Posttranscriptional regulation of the proximal tubule NaPi-II transporter in response to PTH and dietary P(i). Am. J. Physiol. 277, F676–F684.

Murer, H., Hernando, N., Forster, I. & Biber, J. (2000) Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol. Rev. 80, 1373–1409.[Abstract/Free Full Text]

Murer, H., Hernando, N., Forster, L. & Biber, J. (2001) Molecular mechanisms in proximal tubular and small intestinal phosphate reabsorption (plenary lecture). Mol. Membr. Biol. 18, 3–11.[Medline]

Murer, H., Hernando, N., Forster, I. & Biber, J. (2003) Regulation of Na/Pi transporter in the proximal tubule. Annu. Rev. Physiol. 65, 531–542.[CrossRef][Medline]

Pfister, M.F., Ruf, I., Stange, G., et al. (1998) Parathyroid hormone leads to the lysosomal degradation of the renal type II Na/Pi cotransporter. Proc. Natl. Acad. Sci. USA 95, 1909–1914.[Abstract/Free Full Text]

Rosengart, T.K., Johnson, W.V., Friesel, R., Clark, R. & Maciag, T. (1988) Heparin protects heparin-binding growth factor-1 from proteolytic inactivation in vitro. Biochem. Biophys. Res. Commun. 152, 432–440.[CrossRef][Medline]

Saito, H., Kusano, K., Kinosaki, M., et al. (2003) Human fibroblast growth factor-23 mutants suppress Na+-dependent phosphate co-transport activity and 1alpha, 25-dihydroxyvitamin D3 production. J. Biol. Chem. 278, 2206–2211.[Abstract/Free Full Text]

Sakaguchi, K., Lorenzi, M.V., Bottaro, D.P. & Miki, T. (1999a) The acidic domain and first immunoglobulin-like loop of fibroblast growth factor receptor 2 modulate downstream signaling through glycosaminoglycan modification. Mol. Cell. Biol. 19, 6754–6764.[Abstract/Free Full Text]

Sakaguchi, K., Lorenzi, M.V., Matsushita, H. & Miki, T. (1999b) Identification of a novel activated form of the keratinocyte growth factor receptor by expression cloning from parathyroid adenoma tissue. Oncogene 18, 5497–5505.[CrossRef][Medline]

Shimada, T., Mizutani, S., Muto, T., et al. (2001) Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc. Natl. Acad. Sci. USA 98, 6500–6505.[Abstract/Free Full Text]

Shimada, T., Urakawa, I., Yamazaki, Y., et al. (2003) FGF-23 transgenic mice demonstrate hypophosphatemic rickets with reduced expression of sodium phosphate cotransporter type IIa. Biochem. Biophys. Res. Commun. 314, 409–414.

Shimada, T., Kakitani, M., Yamazaki, Y., et al. (2004) Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J. Clin. Invest. 113, 561–568.[CrossRef][Medline]

Tenenhouse, H.S. & Sabbagh, Y. (2002) Novel phosphate-regulating genes in the pathogenesis of renal phosphate wasting disorders. Pflugers Arch. 444, 317–326.[CrossRef][Medline]

The ADHR Consortium (2000) Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nature Genet. 26, 345–348.[CrossRef][Medline]

The HYP Consortium (1995) A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nature Genet. 11, 130–136.[CrossRef][Medline]

Traebert, M., Roth, J., Biber, J., Murer, H. & Kaissling, B. (2000) Internalization of proximal tubular type II Na-P (i) cotransporter by PTH: immunogold electron microscopy. Am. J. Physiol. Renal. Physiol. 278, F148–F154.[Abstract/Free Full Text]

Yamashita, T., Yoshioka, M. & Itoh, N. (2000) Identification of a novel fibroblast growth factor, FGF-23, preferentially expressed in the ventrolateral thalamic nucleus of the brain. Biochem. Biophys. Res. Commun. 277, 494–498.[CrossRef][Medline]

Yamashita, T., Konishi, M., Miyake, A., Inui, K. & Itoh, N. (2002) Fibroblast growth factor (FGF)-23 inhibits renal phosphate reabsorption by activation of the mitogen-activated protein kinase pathway. J. Biol. Chem. 277, 28265–28270.[Abstract/Free Full Text]

Received: 14 December 2004
Accepted: 10 February 2005




This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Berndt, L. F. Thomas, T. A. Craig, S. Sommer, X. Li, E. J. Bergstralh, and R. Kumar
Evidence for a signaling axis by which intestinal phosphate rapidly modulates renal phosphate reabsorption
PNAS, June 26, 2007; 104(26): 11085 - 11090.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
S. L. Kuslak, J. L. Thielen, and P. C. Marker
The mouse seminal vesicle shape mutation is allelic with Fgfr2
Development, February 1, 2007; 134(3): 557 - 565.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Zhang, O. A. Ibrahimi, S. K. Olsen, H. Umemori, M. Mohammadi, and D. M. Ornitz
Receptor Specificity of the Fibroblast Growth Factor Family: THE COMPLETE MAMMALIAN FGF FAMILY
J. Biol. Chem., June 9, 2006; 281(23): 15694 - 15700.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
S. Liu, W. Tang, J. Zhou, J. R. Stubbs, Q. Luo, M. Pi, and L. D. Quarles
Fibroblast Growth Factor 23 Is a Counter-Regulatory Phosphaturic Hormone for Vitamin D
J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1305 - 1315.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
D. Rendina, G. Mossetti, G. De Filippo, M. Cioffi, and P. Strazzullo
Fibroblast Growth Factor 23 Is Increased in Calcium Nephrolithiasis with Hypophosphatemia and Renal Phosphate Leak
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 959 - 963.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
X. Yu, O. A. Ibrahimi, R. Goetz, F. Zhang, S. I. Davis, H. J. Garringer, R. J. Linhardt, D. M. Ornitz, M. Mohammadi, and K. E. White
Analysis of the Biochemical Mechanisms for the Endocrine Actions of Fibroblast Growth Factor-23
Endocrinology, November 1, 2005; 146(11): 4647 - 4656.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, X.
Right arrow Articles by Sakaguchi, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, X.
Right arrow Articles by Sakaguchi, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS