GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2005) 10, 717-731. doi:10.1111/j.1365-2443.2005.00873.x
© 2005 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deléhouzée, S.
Right arrow Articles by Handa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deléhouzée, S.
Right arrow Articles by Handa, H.

GABP, HCF-1 and YY1 are involved in Rb gene expression during myogenesis

Sophie Deléhouzée1, Tatsufumi Yoshikawa1, Chika Sawa2, Jun-ichi Sawada3, Takumi Ito1, Masashi Omori1, Tadashi Wada1, Yuki Yamaguchi1,4, Yasuaki Kabe1 and Hiroshi Handa1,*

1 Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan
2 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA
3 Center for Drug Discovery, University of Shizuoka, 52-1 Yada, Shizuoka, 422-8002, Japan
4 PRESTO, Japan Science and Technology Agency, Yokohama 226-8501, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Muscle cell differentiation, or myogenesis, is a well-characterized process and involves the expression of specific sets of genes in an orderly manner. A prerequisite for myogenesis is the exit from the cell cycle, which is associated with the up-regulation of the tumor suppressor Rb. In this study, we set to investigate the regulatory mechanism of the Rb promoter that allows adequate up-regulation in differentiating myoblasts. We report that Rb expression is regulated by the transcription factors GABP, HCF-1 and YY1. Before induction of differentiation, Rb is expressed at a low level and GABP and YY1 are both present on the promoter. YY1, which exerts an inhibitory effect on Rb expression, is removed from the promoter as cells advance through myogenesis and translocates from the nucleus to the cytoplasm. On the other hand, upon induction of differentiation, the GABP cofactor HCF-1 is recruited to and coactivates the promoter with GABP. RNAi-mediated knock-down of HCF-1 results in inhibition of Rb up-regulation as well as myotube formation. These results indicate that the Rb promoter is subject to regulation by positive and negative factors and that this intricate activation mechanism is critical to allow the accurate Rb gene up-regulation observed during myogenesis.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Cell differentiation is characterized by terminal exit of cells from the cell cycle. A critical regulator for cell cycle arrest at the G0/G1 phase is the tumor suppressor Retinoblastoma (Rb). Two functions are attributed to Rb during differentiation. First, Rb induces terminal exit from the cell cycle through the negative regulation of genes involved in proliferation. Second, Rb cooperates with cell-specific transcription factors to activate the downstream effectors of differentiation (Sellers et al. 1998; Lipinski & Jacks 1999; Novitch et al. 1999). The mRNA and protein levels of Rb are known to increase during erythroid and muscle differentiation (Martelli et al. 1994; Condorelli et al. 1995) and Rb knock-out mice result in embryonic lethality with profound defects in erythroid, neuronal, lens and skeletal muscle development (Jacks et al. 1992; Lee et al. 1992; Morgenbesser et al. 1994; Jacks 1996; Zacksenhaus et al. 1996). Although it is likely that the expression level of Rb is tightly regulated, the regulation mechanism of the Rb promoter is still largely unclear. The transcription factor GABP has been reported to act as a critical positive regulator of the Rb gene (Sakai et al. 1991; Zacksenhaus et al. 1993; Sowa et al. 1997). Alternatively, Rb may be subject to repression by transcription inhibitors to prevent inadequate gene activation.

The transcription factor YY1 has been associated with both positive and negative transcriptional regulation, as well as transcription initiation (Shi et al. 1997). YY1 is considered to be the mammalian homolog of the Drosophila Pleiohomeotic (PHO) gene product (Atchison et al. 2003), which is a member of the Polycomb group (PcG) proteins, known to repress gene expression through epigenetic control of genomic regions (Orlando 2003). YY1 was recently found to be present, together with the PcG protein Ezh2 and the histone deacetylase HDAC1, on genomic regions of silent muscle-specific genes in undifferentiated myoblasts and to dissociate from these loci upon gene activation (Caretti et al. 2004). Dissociation may involve degradation, as YY1 has been reported to undergo m-calpain-mediated proteolysis during myogenesis (Walowitz et al. 1998). YY1 may also be negatively regulating other genes repressed in myoblasts and acting as a general repressor of differentiation which loses its activity as cells differentiate.

GABP, also referred to as E4TF1, is a member of the Ets family of transcription factors and consists of the DNA-binding GABP{alpha} (E4TF1-60) subunit and the transactivating GABPß subunit (E4TF1-53) (Watanabe et al. 1990; LaMarco et al. 1991). GABP forms a highly transcriptionally active {alpha}2ß2 heterotetramer (Watanabe et al. 1990; Chinenov et al. 2000) and regulates a large number of both housekeeping and cell type-specific cellular genes, as well as viral genes (Rosmarin et al. 2004). The transcription cofactor HCF-1 has recently been shown to directly associate with GABP (Vogel & Kristie 2000). HCF-1 is a chromatin-associated factor, reported to play a role in cell proliferation, cytokinesis and spliceosome formation (Goto et al. 1997; Ajuh et al. 2002; Julien & Herr 2003). HCF-1 has also been shown to directly interact with Sin3 histone deacetylase and the Set1/Ash2 histone methyltransferase complex, which are involved in transcriptional repression and activation, respectively, suggesting that HCF-1 exerts both positive and negative regulatory functions depending on the cellular context (Wysocka et al. 2003). Mutations on GABPß that reduce the GABP transactivation potential also impair HCF-1/GABP interaction, suggesting that HCF-1 functions as a coactivator of GABP-mediated transcription (Vogel & Kristie 2000). GABP's function in various cellular processes, including differentiation, may thus also be mediated by HCF-1. In this regard, hamster cells possessing a temperature-sensitive point mutation on HCF-1 were shown to undergo arrest at the G0/G1 phase of the cell cycle at the non-permissive temperature (Goto et al. 1997), indicating a regulatory role of HCF-1 in cell cycle and a potential implication in cell differentiation.

In this study, we report that YY1 acts as a transcriptional repressor on the Rb promoter. YY1 dissociates from the Rb promoter during myogenesis. GABP and HCF-1 positively regulate and are present on the Rb promoter during myogenesis. RNAi-mediated knock-down of HCF-1 results in inhibition of myotube formation, suggesting that HCF-1 is involved in cell differentiation, possibly through the regulation of the Rb gene expression. From these results, a regulatory mechanism can be suggested where the removal of YY1-mediated promoter inhibition in addition to activation by GABP and HCF-1 are required for efficient Rb gene expression during myogenesis.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Rb is up-regulated during myoblast differentiation

Mouse myoblast C2C12 cells were plated at high confluency and induced to differentiate by switching the culture medium from a serum-rich to a serum-poor medium. By day 4 in differentiation medium, approximately 50% of the myoblast cells had fused with neighboring cells to form multinucleated myotubes (Fig. 1A). The other 50% remained as mononucleated myoblasts, consistent with previous observations that a portion of skeletal muscle cells do not differentiate and remain as reserve cells (Yoshida et al. 1998). Immunofluorescence analysis indicated that myotubes expressed the muscle marker myosin, whereas undifferentiated myoblasts did not, confirming that the multinucleated myotubes represent the terminally differentiated myoblast cells (Fig. 1A).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 1  Myosin and Rb expression during myogenesis. (A) Myotube formation and expression of myosin and Rb during myogenesis. C2C12 cells were plated at high confluency and immunofluorescence assays using anti-myosin and anti-Rb antibodies were performed at day 0 and day 4 after induction of differentiation. Nuclei were visualized by 4,6-diamidino-2-phenylindole (dapi)-staining of DNA. (B) RT-PCR analysis of Rb mRNA during myogenesis. C2C12 cells were induced to differentiate and total RNAs were collected at the indicated times. Equal amounts (100 ng) were used for quantitative RT-PCR analysis for the endogenous Rb mRNA level. Each value was standardized against GAPDH's value and plotted as fold increase over 0 h's value. The result shown is a representative of the RT-PCR done in duplicate from the experiment performed at least three times. (C) Immunoblot analysis of myosin and Rb proteins during myogenesis. C2C12 cells were induced to differentiate and whole cell lysates were collected at the indicated times. Equal amounts (10 µg) were subjected to SDS-PAGE analysis followed by immunoblotting with the indicated antibodies.

 
The expression of Rb during myogenesis was subsequently analyzed. Immunofluorescence analysis revealed that myoblasts before differentiation (day 0) expressed a low level of Rb in the nucleus. On the other hand, upon differentiation (day 4), Rb expression in nuclei of multinucleated myotubes had increased (Fig. 1A), confirming Rb's involvement in differentiation.

The up-regulation of the Rb gene has been reported as a prerequisite for muscle and erythroid differentiation (Martelli et al. 1994; Condorelli et al. 1995). The time course for Rb gene up-regulation during myogenesis was analyzed at the RNA level. C2C12 cells were induced to differentiate, and total RNA samples were collected at different time points for up to three days. Quantitative RT-PCR analysis showed a steady 5-fold increase in the Rb mRNA level, starting by 12 h and being maximal by day 2 of differentiation (Fig. 1B).

The protein level of Rb was analyzed by Western blot analysis. C2C12 cells were similarly induced to differentiate, and lysates were collected at different time points after induction, as indicated in Fig. 1C. Differentiating myoblasts between day 2 and day 4 after induction expressed a high level of Rb protein compared to myoblasts at day 0. On the other hand, myosin expression was observed starting from day 3 in differentiation medium, consistent with the nature of myosin as a late differentiation marker. This result indicates that Rb up-regulation precedes the expression of differentiation markers, and suggests the involvement of Rb in the early steps of differentiation.

YY1 is involved in Rb gene expression

YY1 has been reported to negatively regulate genomic regions of muscle-specific genes, such as the myosin heavy chain IIb and muscle creatine kinase (Caretti et al. 2004). To test the possibility that YY1 is also involved in the regulation of the Rb gene expression during myogenesis, the localization of YY1 was first analyzed in differentiating myoblast cells. Myoblasts and myotubes were probed with anti-YY1 antibody, and endogenous YY1 protein was visualized by immunofluorescence analysis. As shown in Fig. 2A, YY1 localized to the nucleus in myoblasts before differentiation (day 0). At day 4 of differentiation, YY1 seemed absent from most of the nuclei in differentiated myotubes and localized in the cytoplasm. On the other hand, YY1 was expressed and remained in the nucleus in undifferentiated single myoblasts at day 4. This result indicates that YY1 translocates from the nucleus to the cytoplasm in myoblasts undergoing differentiation. Translocation of YY1 to the cytoplasm has previously been reported in Xenopus during specific stages of oocyte and embryonic development (Ficzycz et al. 2001).



View larger version (41K):
[in this window]
[in a new window]
  		Figure 2  YY1 expression during myogenesis and YY1's function on Rb expression. (A) YY1 expression during myogenesis. C2C12 cells were plated at high confluency and immunofluorescence assay using anti-YY1 antibody was performed at day 0 and day 4 after induction of differentiation. Nuclei were visualized by 4,6-diamidino-2-phenylindole (dapi)-staining of DNA. (B) Immunoblot analysis of YY1 protein during myogenesis. C2C12 cells were induced to differentiate and whole cell lysates were collected at the indicated times. Equal amounts (10 µg) were subjected to SDS-PAGE analysis followed by immunoblotting with the indicated antibodies. The intensity of each YY1 band is indicated as a percentage. (C) ChIP analysis of YY1 protein on the Rb core promoter region. C2C12 cells were induced to differentiate and crosslinked with formaldehyde at the indicated times. Lysates were used for chromatin immunoprecipitation using anti-YY1 antibody or normal IgG. Precipitated DNAs were amplified by PCR for the region corresponding to the Rb core promoter. The result shown is a representative of the PCR done in duplicate from the experiment performed at least three times. (D) Transfection analysis and effect of YY1 over-expression on Rb expression. HeLa cells were transfected with an increasing amount of the expression plasmid for YY1. Total DNA amount transfected was adjusted to 1.8 µg with the vector plasmid. Two days post-transfection, total RNAs were collected and an aliquot (100 ng) was subjected to RT-PCR analysis for the endogenous Rb mRNA level. The result shown is a representative result of the RT-PCR done in duplicate from the experiment performed at least three times. (E) Electrophoretic mobility shift assay of the Rb promoter DNA in the presence of GABP and YY1. Radiolabeled DNA fragments, representing the sequence between –198 bp and –85 bp of mouse Rb promoter, were incubated with 5 or 10 µg nuclear extract prepared from YY1-over-expressing 293T cells, in the presence or absence of 0.5 µg nuclear extract prepared from GABP{alpha}/ß-over-expressing 293T cells. Total protein amount was adjusted to 11 µg by the addition of nuclear extract prepared from vector-transfected 293T cells.

 
The protein level of YY1 during myogenesis was subsequently analyzed. C2C12 cells were induced to differentiate, and whole cell lysates were prepared at the indicated time points (Fig. 2B). Western blot analysis revealed that the protein level of YY1 gradually decreases from day 1 to day 4 after induction, whereas the level of ß-actin is unchanged throughout differentiation. This may result from m-calpain-mediated proteolysis of YY1, as reported by Walowitz et al. (1998).

To determine the presence of YY1 on the Rb promoter in vivo, a chromatin immunoprecipitation (ChIP) experiment was performed using lysates from myoblasts and myotubes. The presence of YY1 was determined by quantitative PCR amplification of a segment of the mouse genome corresponding to the core promoter region of the Rb promoter. As shown in Fig. 2C, chromatin immunoprecipitation of YY1 at day 0 resulted in significant amplification of the promoter region compared to the background level observed with chromatin immunoprecipitation using normal IgG, indicating that YY1 is present on the Rb promoter in undifferentiated myoblasts at day 0. The amount of YY1 on the promoter decreased as cells advanced through differentiation, indicating that YY1 gradually dissociates from the Rb promoter during myogenesis.

To see whether YY1 is involved in the regulation of the Rb gene, the expression level of Rb was analyzed in YY1-over-expressing cells. Because over-expression of YY1 in C2C12 cells resulted in cell toxicity for yet unknown reasons (data not shown, see Experimental procedures), the effect of YY1 over-expression was analyzed using human cervical carcinoma HeLa cells. HeLa cells were transfected with an expression plasmid for YY1, total RNAs were collected two days later and used for RT-PCR analysis for the endogenous Rb mRNA level. As shown in Fig. 2D, over-expression of YY1 resulted in a down-regulation of Rb expression in a dose-dependent manner, suggesting that YY1 negatively regulates the Rb gene expression.

To see whether YY1's negative effect on Rb expression is exerted through direct binding to the promoter, an electrophoretic mobility shift assay was performed. Nuclear extracts prepared from GABP{alpha}/ß or YY1-over-expressing 293T cells were incubated with radiolabelled Rb promoter DNA fragments. As shown in Fig. 2E, incubation of YY1 with DNA resulted in the appearance of a slower migrating band in a dose-dependent manner, indicating that YY1 binds to the Rb promoter. Incubation of YY1 with DNA in the presence of GABP{alpha}/ß resulted in supershifting of the DNA/GABP{alpha}/ß complex, indicating that GABP{alpha}/ß and YY1 simultaneously bind to the Rb promoter DNA. These results show that the negative regulation of Rb expression by YY1 is not due to the removal of the activator GABP from the promoter, but to simultaneous binding of YY1 to the core promoter region.

GABP and HCF-1 are present on the Rb promoter during myogenesis

The Rb promoter contains a GABP-binding site, and GABP has been shown to be a critical activator of the Rb gene promoter (Sakai et al. 1991; Sowa et al. 1997; Zacksenhaus et al. 1993). Since HCF-1 has been defined as a cofactor for GABP from studies on Herpes Simplex Virus Immediate Early gene expression, it is possible that HCF-1 is acting as a cofactor for the expression of the Rb gene as well. The expression of GABP and HCF-1 was analyzed in differentiating myoblasts. As shown in Fig. 3A, Western blot analysis revealed that the expression of HCF-1 increases upon induction of differentiation, and precedes Rb's up-regulation observed by day 2. Additionally, immunofluorescence analysis showed that both GABP{alpha} and HCF-1 were expressed and localized in the nucleus of differentiating myoblasts (Fig. 3B).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3  Chromatin immunoprecipitation analysis of GABP and HCF-1 during myogenesis. (A) Immunoblot analysis of HCF-1 protein during myogenesis. C2C12 cells were induced to differentiate and whole cell lysates were collected at the indicated times. Equal amounts (10 µg) were subjected to SDS-PAGE analysis followed by immunoblotting with the indicated antibodies. (B) Expression of GABP{alpha} and HCF-1 in myotubes. C2C12 cells were induced to differentiate and immunofluorescence assays using anti-GABP{alpha} and anti-HCF-1 antibodies were performed at day 4 of differentiation. (C) Schematic representation of the genomic regions of mouse Rb amplified by PCR following chromatin immunoprecipitation. Arrows indicate the reported multiple transcription initiation sites and +1 indicates the translation initiation site of the Rb gene. (D, E) ChIP analysis of GABP{alpha} and HCF-1 proteins on the Rb genomic regions. C2C12 cells were induced to differentiate and crosslinked with formaldehyde at the indicated times. Lysates were used for chromatin immunoprecipitation using (D) anti-GABP{alpha} and (E) anti-HCF-1 antibodies. Precipitated DNAs were amplified by PCR for the regions corresponding to the 5' upstream, core promoter region or coding region on the mouse Rb gene. The results shown are representatives of the PCR done in duplicate from the experiments performed at least three times.

 
To see whether differentiation-associated Rb gene up-regulation involves GABP and HCF-1 in vivo, chromatin immunoprecipitation experiments were performed using lysates from differentiating C2C12 cells. Amplification of immunoprecipitated DNA was performed for the core promoter region of the Rb gene, as well as a region approximately 1.3 kb upstream and a region corresponding to exon 18 situated 72 kb downstream from the translation initiation site on the mouse genome. Because the Rb gene is transcribed from multiple initiation sites, the translation initiation site is designated as +1 (Fig. 3C) (Zacksenhaus et al. 1993). As shown in Fig. 3D, chromatin immunoprecipitation of GABP{alpha} led to a significant amplification of the core promoter region compared to the upstream and coding regions, indicating that GABP{alpha} was present on the Rb core promoter region. Although the amplification level of the promoter region seems to slightly increase with time, the result indicates that GABP{alpha} is constantly present on the Rb promoter during myogenesis. Chromatin immunoprecipitation of HCF-1 revealed that HCF-1 is also present on the Rb promoter. As shown in Fig. 3E, chromatin immunoprecipitation of HCF-1 at day 0 did not result in significant amplification of the promoter region compared to the upstream and coding regions. HCF-1 thus seems to be almost absent from the promoter at day 0 of differentiation. The level of HCF-1 on the promoter increases as myoblasts differentiate, being maximal by day 2 and showing an approximately eightfold increase compared to the level on day 0. The low percentage of DNA immunoprecipitated by anti-HCF-1 antibody may be due to low affinity of the antibody, or may reflect the fact that HCF-1 binds to DNA indirectly through GABP. Normal IgG only precipitated a marginal amount of Rb promoter DNA (data not shown), suggesting that the DNA immunoprecipitated by each antibody was not a result of nonspecific binding to the antibody. Thus the experiment revealed that GABP is constantly present, but HCF-1 is recuited to the Rb promoter as cells undergo myogenesis.

HCF-1 and YY1 positively and negatively regulate GABP-induced Rb promoter activity respectively

The effects of GABP and HCF-1 on the Rb promoter were investigated by reporter assays using Drosophila Schneider SL2 cells, which are highly responsive to exogenous transcription factors, in contrast to mammalian cells (Courey & Tjian 1988; Thanos & Maniatis 1995). SL2 cells were transfected with the reporter plasmid PGV-B-RbPromoter-1353/-85, which consists of a firefly luciferase gene located downstream of an approximately 1.3 kb mouse Rb promoter sequence (Fig. 4A, construct A), together with activator plasmids A5C{Delta}P-GABP{alpha}, A5C{Delta}P-GABPß and A5C{Delta}P-HCF-1. Although GABP{alpha} and GABPß alone did not lead to promoter activation (data not shown), transfection of both GABP{alpha} and GABPß subunits resulted in Rb promoter activation (Fig. 4B). Transfection of an increasing amount of HCF-1 plasmid did not lead to an increase in luciferase activity in the absence of GABP plasmids; however, in the presence of GABP, addition of HCF-1 further stimulated GABP-induced promoter activity in a dose-dependent manner (Fig. 4B). The result indicates that HCF-1 acts as a coactivator for GABP for the expression of the Rb gene.



View larger version (36K):
[in this window]
[in a new window]
  		Figure 4  Effect of GABP, HCF-1 and YY1 on Rb promoter activation. (A) Schematic representation of the various Rb promoter reporter constructs and the sequence between –198 bp and –163 bp of the promoter with the reported GABP binding site indicated. (B–F) Transfection analysis and effect of GABP, HCF-1 and YY1 on Rb expression in Drosophila SL2 cells. SL2 cells were transfected with 100 ng of the reporter plasmid PGV-B-RbPromoter-1353/-85 (construct A), 50 ng of Renilla luciferase expression plasmid, 20 ng, 80 ng or 320 ng of HCF-1 expression plasmid along with or without 80 ng each of expression plasmids of GABP{alpha} and GABPß (B). SL2 cells were transfected with 100 ng of the various Rb promoter reporter constructs, 50 ng of Renilla luciferase expression plasmid, 320 ng of HCF-1 expression plasmid along with or without 80 ng each of GABP{alpha} and GABPß expression plasmids (C). SL2 cells were transfected with 100 ng of the reporter plasmid PGV-B-RbPromoter-1353/-85 (construct A), 50 ng of Renilla luciferase expression plasmid, 8 ng, 40 ng, 80 ng or 160 ng of YY1 expression plasmid along with or without 80 ng each of expression plasmids of GABP{alpha} and GABPß (D). SL2 cells were transfected with 100 ng of the various Rb promoter reporter constructs, 50 ng of Renilla luciferase expression plasmid, 160 ng of YY1 expression plasmid along with or without 80 ng each of GABP{alpha} and GABPß expression plasmids (E). SL2 cells were transfected with 100 ng of the reporter plasmid PGV-B-RbPromoter-1353/-85 (construct A), 50 ng of Renilla luciferase expression plasmid, 80 ng each of expression plasmids for GABP{alpha} and GABPß and 20 ng, 80 ng, 160 ng or 320 ng of HCF-1 or YY1 expression plasmids (F). In all of the above experiments, total amount of transfected DNA was normalized by the addition of the empty vector plasmid A5C{Delta}P. Luciferase activities were standardized against the corresponding activities of the internal control Renilla luciferase. The result shown is a representative of the experiment done in duplicate at least three times.

 
To determine the requirement for DNA sequence in HCF-1 coactivation, reporter plasmids containing the Rb promoter of various lengths were constructed (Fig. 4A) and analyzed. GABP-mediated promoter activation and HCF-1-mediated coactivation were observed when reporter constructs containing the GABP-binding site (constructs A, B and C) were used. Assay using a reporter construct that did not contain the GABP binding site (construct D) resulted in the absence of promoter activation, suggesting that HCF-1 mediated Rb promoter coactivation requires GABP expression and the GABP binding site on the promoter.

YY1's effect on Rb promoter activation was analyzed by reporter assays as well. SL2 cells were transfected with the reporter plasmid PGV-B-RbPromoter-1353/-85 (Fig. 4, construct A), the activator plasmids A5C{Delta}P-GABP{alpha} and A5C{Delta}P-GABPß, and an increasing amount of the plasmid A5C{Delta}P-YY1. As shown in Fig. 4D, although YY1 has no effect on the Rb promoter by itself, YY1 causes a dose-dependent down-regulation of GABP-induced Rb promoter activation. Interestingly, the increase in YY1 amount did not lead to a complete inhibition of GABP-mediated promoter activity, suggesting that Rb is expressed at a low level even in the presence of a high level of YY1.

The DNA sequence requirement for YY1-mediated promoter repression was analyzed using the various Rb promoter constructs, as indicated in Fig. 4E. YY1-mediated negative regulation of GABP-induced Rb promoter activity was observed as long as the reporter constructs contained the GABP-binding site (constructs A, B and C). No GABP-induced activation and no inhibition mediated by YY1 were observed when this site was deleted from the reporter construct (construct D), suggesting that YY1-associated repression requires GABP expression and the GABP-binding site.

HCF-1 exerts a positive effect on the Rb promoter, whereas YY1 acts as a negative regulator. To see the effect of the simultaneous presence of GABP, HCF-1 and YY1 on Rb promoter activation, SL2 cells were transfected with the reporter plasmid PGV-B-RbPromoter-1353/-85 (Fig. 4A, construct A), together with various amounts of the effector plasmids A5C{Delta}P-GABP{alpha}, A5C{Delta}P-GABPß, A5C{Delta}P-HCF-1 and A5C{Delta}P-YY1. As shown in Fig. 4F, increasing amount of YY1 resulted in a dose-dependent inhibition of GABP and HCF-1-mediated activation. On another hand, increasing amount of HCF-1 in the presence of GABP and YY1 resulted in a gradual but weak increase of Rb promoter activation. YY1 thus appears to act as the dominant regulator on the Rb promoter, since addition of an increasing amount of HCF-1 in the presence of YY1 results in a slight up-regulation of GABP-mediated promoter activation; however, full promoter activation is achieved following the removal of YY1.

Effect of HCF-1 knock-down on myogenesis

The increase in the Rb expression level is a prerequisite for myoblast differentiation. HCF-1 can coactivate the Rb promoter with GABP and is found to be recruited to the Rb promoter during differentiation. However, Rb up-regulation may solely be the result of the dissociation of YY1 from the promoter. To see whether HCF-1 recruitment is required for up-regulation of Rb expression, we examined whether RNAi-mediated knock-down of HCF-1 in C2C12 mouse myoblast cells results in inhibition of Rb gene induction and abrogation of myotubes formation.

A synthetic double-stranded siRNA complementary to the sequence between 296 bp and 314 bp of mouse HCF-1 was designed to target and repress HCF-1. siRNA targeting the GFP gene was used as a control. To test the effect of HCF-1 knock-down on HCF-1 expression as well as Rb induction, C2C12 cells were transfected with the siRNAs and induced to differentiate three days later. After incubation in differentiation medium for two days, cells were collected, and lysates were subjected to SDS-PAGE analysis. As shown in Fig. 5A, siRNA to HCF-1 effectively repressed HCF-1 expression. Whereas differentiation-induced Rb up-regulation occurred in mock and control siRNA-transfected cells, the Rb level in cells transfected with HCF-1 siRNA remained low. The expression levels of GABP{alpha} and tubulin {alpha} were unchanged, indicating that siRNA-associated down-regulation is specific to HCF-1 and Rb. These results indicate that repression of HCF-1 led to an inhibition of Rb expression in differentiating myoblasts.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 5  Effect of RNAi-mediated knock-down of HCF-1 on Rb expression and myotube formation. (A) Immunoblot analysis of HCF-1, Rb and GABP{alpha} proteins in differentiating myoblasts following HCF-1 knock-down. C2C12 cells were transfected with control or HCF-1 siRNA and induced to differentiate three days later. After two days incubation in differentiation medium, whole cell lysates were prepared and equal amounts were subjected to SDS-PAGE analysis, followed by immunoblotting with the indicated antibodies. (B) Myosin expression in myoblasts transfected with HCF-1 siRNA. C2C12 cells were transfected with control or HCF-1 siRNA together with an expression plasmid for the fluorescent protein DsRed and induced to differentiate three days later. After four days in differentiation medium, an immunofluorescence assay was performed using anti-myosin antibody and the expression of myosin and DsRed was analyzed by fluorescence microscopy. (C) Percentage of myotube formation among siRNA-transfected cells. C2C12 cells were co-transfected with the siRNAs and DsRed as in Fig. 5B and over a hundred nuclei from DsRed-positive cells from five microscopic fields were counted and categorized depending on whether they belonged to single myoblasts (single) or multinucleated myotubes (tube).

 
To see the effect of HCF-1 knock-down on myotubes formation, C2C12 cells were co-transfected with an expression plasmid for the fluorescent protein DsRed and the siRNAs. At day 3 post-transfection, the medium was switched to the differentiation medium and cells were left to differentiate for another four days. As shown in Fig. 5B, co-transfection of control siRNA and the DsRed plasmid resulted in the formation of myosin-expressing DsRed-positive myotubes. In comparison, in the case of HCF-1 siRNA co-transfection, DsRed-positive cells remained as single cells and myotubes expressing myosin consisted of DsRed-negative cells. This result indicates that myoblasts co-transfected with the HCF-1 siRNA and DsRed plasmid did not express myosin and did not form myotubes and suggests that HCF-1 is essential for myogenesis.

The efficiency in inhibition of differentiation was quantitated by determining the percentage of myotube formation among siRNA-transfected cells. Over a hundred nuclei from DsRed-positive cells from five microscopic fields were counted and categorized depending on whether they belonged to mononucleated single myoblasts or multinucleated myotubes. As indicated in Fig. 5C, upon co-transfection of control siRNA and DsRed, 64% of nuclei belonged to DsRed-positive myotubes as opposed to 36% that belonged to DsRed-positive myoblasts. In comparison, following transfection of HCF-1 siRNA and DsRed, only 4% of nuclei belonged to myotubes and 96% belonged to myoblasts, indicating that the majority of HCF-1 siRNA-transfected myoblasts did not differentiate and remained as single cells. Since up-regulation of Rb is a prerequisite for myoblast differentiation, the abrogation of myogenesis observed in Fig. 5B is likely due to HCF-1 knock-down-associated repression of Rb expression. On the basis of its role as a coactivator for Rb expression, HCF-1 can therefore be defined as a critical myogenesis-inducing factor.


   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
Rb is a critical regulator of cell cycle and cell differentiation and up-regulation of the Rb level is a prerequisite for myoblast differentiation. Using the C2C12 myoblast cell line as a tool to study myogenesis in vitro, we set to investigate the regulatory mechanism for the induction of Rb expression at the molecular level. High cell confluency and incubation in the differentiation medium induced the differentiation of approximately 50% of the myoblasts, which formed multinucleated myotubes expressing Rb and myosin at a high level. Transfection and promoter analyses revealed that YY1 is a negative regulator of the Rb gene promoter, although a low level of Rb expression occurs even under a high level of YY1. YY1 dissociates from the promoter and translocates from the nuclei to the cytoplasm as cells advance through myogenesis. On another hand, GABP and HCF-1 synergistically activate the Rb promoter. Whereas GABP is constantly present on the promoter, HCF-1 is recruited during myogenesis. GABP alone directs Rb gene expression; however, recruitment of HCF-1 results in amplification of expression and maximal expression is achieved in the absence of YY1. RNAi-mediated knock-down of HCF-1 results in inhibition of Rb up-regulation and abrogation of myotube formation, indicating that HCF-1 is required for myogenesis.

From this study, a model can be conceived explaining the steps of Rb expression during myogenesis, as illustrated in Fig. 6. Before differentiation, GABP and YY1 are present on the Rb promoter and their presence results in the expression of a low level of Rb expression. As cells advance through myogenesis, HCF-1 is recruited to, and YY1 is removed from, the promoter. The recruitment of a coactivator and the removal of a repressor allow the sharp up-regulation of the Rb gene expression seen from day 2 of myogenesis.



View larger version (10K):
[in this window]
[in a new window]
  		Figure 6  Schematic model showing Rb promoter activation during myogenesis. Before differentiation, Rb is expressed at a low level as a result of the presence of both GABP and YY1 on the promoter. Upon induction of differentiation, HCF-1 is recruited to and YY1 is removed from the promoter, leading to the gradual up-regulation of Rb expression observed in differentiating myotubes.

 
Previous studies have implicated HCF-1 in various cellular processes including cell cycle progression, mitotic control as well as splicing and spliceosome assembly (Goto et al. 1997; Ajuh et al. 2002; Julien & Herr 2003). A temperature-sensitive point mutation on the HCF-1 gene in a hamster cell line was shown to cause cell cycle arrest at the G0/G1 phase at the non-permissive temperature (Goto et al. 1997), indicating a regulatory role of HCF-1 in cell cycle. In this paper, we have shown that HCF-1 acts as a cofactor for GABP on the Rb promoter; we propose that some of the cellular functions attributed to HCF-1 are exerted through regulation of the Rb gene at the transcriptional level. Additionally, we have defined through this study a novel role for HCF-1 in cellular differentiation.

YY1-mediated negative regulation of the Rb promoter was shown to require GABP and GABP's binding site. YY1's effect may be the result of YY1's recruitment to the GABP-regulated promoter through protein–protein interactions. In this regard, YEAF1/RYBP has been shown to act as a bridging factor between YY1 and GABP (Sawa et al. 2002). However, we have also shown that YY1 physically binds to the Rb core promoter region, simultaneously with GABP. Since, compared to GABP, a higher amount of YY1 protein was required to detect a protein/DNA complex by electrophoretic mobility shift assay, the affinity between YY1 and the Rb promoter DNA may be weak. The possibility that, in addition to DNA-binding, interactions between YY1 and other transcription factors are required for efficient YY1-mediated regulation could not be ruled out.

From the observation that nuclear localization occurs only in undifferentiated myoblasts, YY1 could be defined as a marker associated with the undifferentiated phenotype. Translocation of YY1 has also been reported from earlier studies on Xenopus development, where YY1 was found to be localized in the cytoplasm in specific stages of oocyte and embryonic development (Ficzycz et al. 2001). Rb gene activation required for efficient advancement through differentiation may thus involve the removal of YY1's negative transcriptional activity from the nucleus by cytoplasmic sequestration by a yet undetermined mechanism. Alternatively, since YY1 has been reported to undergo m-calpain-mediated proteolysis (Walowitz et al. 1998) and Western blot analysis revealed that the protein level of YY1 slightly decreases during myogenesis, the removal of YY1's regulatory activity may also involve degradation. However, the decrease in YY1 protein level was not apparent by immunofluorescence analysis of myotubes. Based on this observation, although the possibility that cytoplasmic YY1 recognized by the anti-YY1 antibody consists of proteolyzed fragments of YY1 still remains, we suggest that the removal of YY1's negative regulatory activity depends mainly on cytoplasmic translocation rather than proteolysis.

YY1 may be exerting a repressive activity that is removed only at a correct timing during myogenesis and preventing premature gene activation. Other genetic regions repressed in myoblasts and activated in myotubes, such as those of the myosin heavy chain IIb and the muscle creatine kinase genes, have been associated with the presence and absence of YY1, respectively (Caretti et al. 2004). In these cases, the presence of YY1 correlated with the presence of the PcG protein Ezh2 and the deacetylase HDAC1, as well as histone H3 methylation, pointing for an epigenetic gene repression mechanism. We are currently addressing the question whether negative regulation of the Rb gene by YY1 involves the PcG and histone methylation. Despite YY1's involvement in both cases, the Rb promoter and the myogenic gene promoters may be regulated in a different manner, since the expression of the myogenic genes is null, but a basal level of Rb is constantly expressed, in undifferentiated myoblasts. Further analyses are required to clarify the molecular events associated with Rb gene expression and myogenesis.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Plasmid construction

The GFP expression vector pHygEF2-GFP was a gift of K. Kataoka (Nara Institute of Science and Technology, Japan). The mammalian expression plasmid pCAGGS-YY1 contains the cDNA for human YY1 inserted in the BglII site of the vector pCAGGS. The Drosophila expression plasmids for GAPB{alpha} and GABPß have been previously described (Sawa et al. 1996). The expression plasmid A5C{Delta}P-YY1 contains the cDNA for human YY1 inserted in the BamHI site of the vector A5C{Delta}P. The expression plasmid A5C{Delta}P-HA-HCF-1 was constructed from pCGN-HA-HCF-1 (gift of W. Herr) in two steps. The NotI/BamHI fragment of the cDNA, encoding HCF-1 amino acids 551–2035, was first subcloned into A5C{Delta}P at the NotI and BamHI sites. The 5' portion was amplified by PCR using primers AAAAGCGGCCGCGGATCCATGGCTTCTAGCTATCCTTATG and CAGGGTTGCTCACCATGAC, digested with NotI and subcloned into the NotI site of this plasmid. The mouse Rb promoter was cloned from mouse genomic DNA derived from NIH3T3 cells. An approximately 1.3 kb-long fraction representing the –1353 bp to –85 bp region from the translational start site of the promoter was PCR-amplified using the forward primer AAAGGTACCGAACTCAAGTGCTATTTTAATTC and reverse primer AAAAAGCTTCTCACCCGACTCCCGTTAC, digested with KpnI and HindIII and inserted in the KpnI/HindIII sites of the vector PicaGene PGV-B (Toyo-ink). PGV-B-RbPromoter-628/-85 construct was generated by removal of the KpnI/BglII portion of PGV-B-RbPromoter-1353/-85 and blunt religation. PGV-B-RbPromoter-198/-85 was made in the same way as PGV-B-RbPromoter-1353/-85 except that the forward primer AAAGCTAGCCGCCGCGGGCGGAAGTG was used instead. PGV-B-RbPromoter-163/-85 was made by SmaI digestion of PGV-B-RbPromoter-1353/-85 and self-religation.

Cell culture

Mouse C2C12 myoblast cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 1 mM sodium pyruvate and 10% fetal bovine serum (FBS) in a way that they never reach confluency to maintain their differentiation potential. To induce differentiation, C2C12 cells were plated in 35 mm dishes at 2 x 105 cells/dish and the medium switched to DMEM supplemented with 1 mM sodium pyruvate and 10% horse serum (HS). 293T and HeLa cells were maintained in DMEM supplemented with 10% FBS. C2C12, 293T and HeLa cells were cultured under 5% CO2 at 37 °C. Schneider's 2 (SL2) Drosophila melanogaster cells were maintained at 27 °C in tissue culture flasks containing Schneider's Drosophila Medium (Invitrogen) supplemented with 10% FBS.

Quantitative RT-PCR

Total cellular RNAs were extracted using Sepasol RNA-I Super reagent (Nacalai) following the manufacturer's protocol. Quantitative RT-PCR was performed using 100 ng of total RNA and QuantiTect SYBR Green RT-PCR kit (Qiagen) with the iCycler (Bio-Rad). The following primers were used to amplify mouse Rb: AAAGCTAGCATGCCGCCCAAAGCCCCG and TCTTCAAACTCAAGCCTGGC; mouse GAPDH: ATCTTGGGCTACACTGAGGA and GGTGGTCCAGGGTTTCTTAC; mouse ß-actin: GTGATGGTGGGAATGGGTC and CTGGGTCATCTTTTCACGGT. Each value was standardized against GAPDH or ß-actin's value and plotted as fold increase over 0 h or control-transfected cells’ value. The result shown is a representative of the RT-PCR done in duplicate at least three times.

Immunoblotting

Anti-GABP{alpha} (H180, rabbit polyclonal), anti-YY1 (C-20, rabbit polyclonal), anti-ß-actin (I-19, goat polyclonal) and anti-tubulin {alpha} (H-300, rabbit polyclonal) antibodies were obtained from Santa Cruz Biotechnology. Mouse monoclonal anti-Rb was obtained from Pharmingen. Mouse monoclonal anti-skeletal myosin was obtained from Sigma. Rabbit polyclonal anti-HCF-1 antibodies N18 (HCF-1N) and H12 (HCF-1C) were a kind gift of W. Herr (Cold Spring Harbor Laboratories, New York, USA). For immunoblotting, cells were washed with phosphate-buffered saline and lyzed with RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF)). Whole cell extracts (10 µg) were resolved by 6% or 8% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore). Immunoreactive bands were visualized by ECL (Amersham Biosciences). The intensity of the immunoreactive bands was determined using the NIH image software.

Immunofluorescence assay

C2C12 cells were plated in 35 mm dishes containing collagen-coated coverslips (Iwaki) at 2 x 105 cells/dish and the medium was switched to the differentiation medium two days later. Cells were then fixed with phosphate-buffered saline containing 4% formaldehyde at room temperature for 15 min and treated with 0.25% Triton-X100 in phosphate-buffered saline for an additional 20 min. Cells were probed with anti-skeletal myosin (Sigma), anti-Rb (Pharmingen), anti-YY1 (rabbit polyclonal C-20, Santa Cruz Biotechnology), anti-GABP{alpha} (rabbit polyclonal H-180, Santa Cruz Biotechnology) or anti-HCF-1 (rabbit polyclonal H12, gift of W. Herr), followed by probing with Alexa Fluor 594-labeled anti-mouse IgG, Alexa Fluor 594-labeled anti-rabbit IgG or Alexa Fluor 488-labeled anti-rabbit IgG (Molecular Probes). Coverslips were mounted on slide glasses using Vectashield mounting medium (Vector Laboratories) containing 4,6-diamidino-2-phenylindole (dapi).

For the co-transfection experiments, C2C12 cells were plated in 12 well plates containing collagen-coated coverslips (Iwaki) at 105 cells/well and transfected the following day with siRNA at 100 nM and 0.8 µg expression plasmid pDsRed2-C1 (Clontech) using Lipofectamine 2000 (Invitrogen). At day three post-transfection, the medium was switched to the differentiation medium and cells were left to differentiate for four days. Cells were fixed and stained with mouse monoclonal anti-skeletal myosin (Sigma) and Alexa Fluor 488-labeled anti-mouse IgG (Molecular Probes). To determine the percentage of myotube formation among siRNA-transfected cells, over a hundred nuclei from DsRed-positive cells from five microscopic fields were counted and categorized depending on whether they belonged to single myoblasts or multinucleated myotubes.

Chromatin immunoprecipitation

C2C12 cells were plated in 15 cm dishes at 3 x 106 cells per plate in DMEM-10% FBS and induced to differentiate two days later by switching the medium to DMEM-10% HS. Cells were crosslinked with 1% formaldehyde at room temperature for 15 min and the reaction terminated by addition of 0.125 M glycine. Cells were collected, lyzed with lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.1, 1 mM PMSF, 1 µg/mL aprotinin) for 10 min on ice and sonicated to yield genomic DNA fragments of 200 bp to 1 kb in size. An aliquot (500 µg) of lysate, diluted 10 times with dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8.1, 167 mM NaCl, 1 mM PMSF, 1 µg/mL aprotinin), was precleared with Protein G-Sepharose, incubated with 3 µg respective antibodies at 4 °C overnight and further incubated for 1 h at 4 °C with Protein G-Sepharose preblocked with herring sperm DNA and bovine serum albumin. The beads were washed sequentially with low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 150 mM NaCl), high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 500 mM NaCl), LiCl buffer (0.25 mM LiCl, 1% Nonidet P-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8.1) and TE buffer (10 mM Tris-HCl pH 8.1, 1 mM EDTA), and eluted twice with 50 µL elution buffer (10 mM DTT, 1% SDS, 0.1 M NaHCO3). Crosslink was reversed by adding NaCl to 200 mM and heating at 65 °C overnight. EDTA and Tris-HCl (pH 6.5) were added to 10 mM and 40 mM, respectively, and samples were treated with 36 µg/mL Proteinase K for 1 h at 45 °C. After purification by phenol/chloroform extraction and ethanol purification, one tenth volume of eluate and input were used for PCR analysis.

For amplification of the Rb upstream and coding fragments, quantitative PCR was performed using QuantiTect SYBR Green PCR (Qiagen) according to the manufacturer's protocol and the iCycler (BioRad). For amplification of the Rb promoter, Advantage-GC 2 PCR (Clontech) was used with addition of SYBR Green I (Molecular Probes) to a final 1 x concentration. The following primers were used for the PCR amplification: Rb promoter region: CGCCGCGGGCGGAAGTG and CTCACCCGACTCCCGTTAC; Rb 5' upstream region: AACATTTGGTCTCTAGAAGGC and AGCTGAGCAAGGACTGAGG; Rb coding region: GAAGTACATTGCAGCATCTTG and GAAAGCCATGCAAGGGATTC. Anti-YY1 (rabbit polyclonal C-20), anti-GABP{alpha} (rabbit polyclonal H180), anti-HCF-1 (goat polyclonal N16) antibodies and normal rabbit IgG were obtained from Santa Cruz Biotechnology.

Electrophoretic mobility shift assay

The 114 bp-long DNA probes containing the sequence between –198 bp and –85 bp of mouse Rb promoter were prepared by PCR reactions using the primers AAAGCTAGCCGCCGCGGGCGGAAGTG and AAAAAGCTTCTCACCCGACTCCCGTTAC and purified following polyacrylamide gel electrophoresis. Protein samples used for the electrophoretic mobility shift assays were prepared from human kidney-derived 293T cells. Briefly, 293T cells were transfected with the expression vectors for GABP{alpha} and GABPß, YY1 or the empty vector. At day 3 post-transfection, nuclear extracts were prepared according to the method of Dignam et al. (Dignam et al. 1983). Protein samples (11 µg) were incubated with 16 000 cpm of end-labeled DNA fragments (1.2 ng) in the presence of 1 µg poly(dI-dC) in a volume of 10 µL. The reaction buffer contained 12% glycerol, 12 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) pH 7.9, 150 mM NaCl, 5 mM MgCl2, 0.6 mM EDTA and 0.6 mM dithiothreitol. After incubation at 30 °C for 30 min, samples were loaded on 4% polyacrylamide gels, which had been pre-electrophoresed for 30 min at 80 V, and electrophoresed at 200 V in buffer containing 45 mM Tris-borate and 1 mM EDTA. After electrophoresis, gels were transferred to Whatman 3 mM filter paper, dried and autoradiographed.

Luciferase assay and transfection

Transfection of SL2 cells was performed using Effectene transfection reagent (Qiagen) according to the manufacturer's protocol. Briefly, 2.5 x 105 cells were seeded in each well of a 12 well plate and transfected the next day with a total of 650 ng (Fig. 4B–E) or 800 ng (Fig. 4F) plasmid DNA. The transfection mixture contained 100 ng of a reporter construct, 50 ng of the Renilla luciferase plasmid as an internal control for transfection efficiency and various activator's expression plasmids. The total amount of transfected DNA was normalized by the addition of the empty vector plasmid A5C{Delta}P. Cells were incubated at 27 °C for 48 h and harvested for luciferase assay performed using Dual-luciferase reporter system (Promega). Cells were washed with phosphate-buffered saline and lyzed with 100 µL Passive Lysis Buffer. For each assay, 20 µL of the cell lysate supernatant was mixed with 100 µL Luciferase Assay Reagent and 100 µL Stop and Glo reagent and the luciferase activity was measured in a Lumat LB 9501 luminometer (Berthod). Each luciferase activity was standardized against the corresponding Renilla luciferase activity.

YY1 over-expression in C2C12 and HeLa cells

C2C12 cells were plated in 35 mm dishes at 2 x 105 cells/dish and transfected the next day with either 1.2 µg of pCAGGS-YY1 and 1.2 µg pHygEF2-GFP, or 1.2 µg pCAGGS and 1.2 µg pHygEF2-GFP. At day 2 post-transfection, GFP-positive cells were examined by fluorescence microscopy. Whereas vector-transfected GFP-positive cells were visible, YY1-transfected GFP-positive cells were almost absent, indicating that YY1 over-expression in C2C12 cells resulted in cell toxicity. Transfection experiments with YY1 were therefore performed using HeLa cells. Transfection of YY1 into HeLa cells was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Briefly 2.5 x 105 cells were seeded in each well of a 12 well plate and transfected the next day with 0.9 µg or 1.8 µg pCAGGS-YY1 plasmid. Total DNA amount transfected was adjusted to 1.8 µg by the addition of the empty vector pCAGGS. Cells were incubated at 37 °C for 48 h and total cellular RNAs were extracted for quantitative RT-PCR analysis.

HCF-1 knock-down

For the mouse HCF-1 knock-down experiment, complementary RNA (sense: GAAUGGUAGAGUAUGGAAAdTdT; anti-sense: UUUCCAUACUCUACCAUUCdTdT) targeting the sequence between 296 bp to 314 bp of mouse HCF-1 were synthesized (Dharmacon) and annealed following the manufacturer's protocol. siRNA against GFP (sense: GCUGACCCUGAAGUUCAUGdTdT, anti-sense: GAUGAACUUCAGGGUCAGCdTdT) was used as a negative control. C2C12 myoblast cells were plated in 12 well plates at 105 cells/well and transfected the following day with siRNA at 100 nM using Lipofectamine 2000 (Invitrogen). At 24 h post-transfection, cells were rinsed with phosphate-buffered saline and transfected in the same way for a second time.


   Acknowledgements
 
This work was supported by a grant from the 21st Century COE Program, a grant-in-aid for scientific research from the Ministry of Education, Culture, Sports, Science and Technology of Japan and by a grant for Research and Development Projects in Cooperation with Academic Institutions from the New Energy and Industrial Technology Development Organization.We thank W. Herr for providing HCF-1 cDNA and antibodies; K. Kataoka for the pHygEF2-GFP plasmid; J. Kato for technical assistance; A. Nakanishi for helpful discussion.


   Footnotes
 
Communicated by: Shunsuke Ishii

*Correspondence: E-mail: hhanda{at}bio.titech.ac.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Ajuh, P., Chusainow, J., Ryder, U. & Lamond, A.I. (2002) A novel function for human factor C1 (HCF-1), a host protein required for herpes simplex virus infection, in pre-mRNA splicing. EMBO J. 21, 6590–6602.[CrossRef][Medline]

Atchison, L., Ghias, A., Wilkinson, F., Bonini, N. & Atchison, M.L. (2003) Transcription factor YY1 functions as a PcG protein in vivo. EMBO J. 22, 1347–1358.[CrossRef][Medline]

Caretti, G., Di Padova, M., Micales, B., Lyons, G.E. & Sartorelli, V. (2004) The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes Dev. 18, 2627–2638.[Abstract/Free Full Text]

Chinenov, Y., Henzl, M. & Martin, M.E. (2000) The alpha and beta subunits of the GA-binding protein form a stable heterodimer in solution. Revised model of heterotetrameric complex assembly. J. Biol. Chem. 275, 7749–7756.[Abstract/Free Full Text]

Condorelli, G.L., Testa, U., Valtieri, M., et al. (1995) Modulation of retinoblastoma gene in normal adult hematopoiesis: peak expression and functional role in advanced erythroid differentiation. Proc. Natl. Acad. Sci. USA 92, 4808–4812.[Abstract/Free Full Text]

Courey, A.J. & Tjian, R. (1988) Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55, 887–898.[CrossRef][Medline]

Dignam, J.D., Lebovitz, R.M. & Roeder, R.G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475–1489.

Ficzycz, A., Eskiw, C., Meyer, D., Marley, K.E., Hurt, M. & Ovsenek, N. (2001) Expression, activity, and subcellular localization of the Yin Yang 1 transcription factor in Xenopus oocytes and embryos. J. Biol. Chem. 276, 22819–22825.[Abstract/Free Full Text]

Goto, H., Motomura, S., Wilson, A.C., et al. (1997) A single-point mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16 function. Genes Dev. 11, 726–737.[Abstract/Free Full Text]

Jacks, T., Fazeli, A., Schmitt, E.M., Bronson, R.T., Goodell, M.A. & Weinberg, R.A. (1992) Effects of an Rb mutation in the mouse. Nature 359, 295–300.[CrossRef][Medline]

Jacks, T. (1996) Tumor suppressor gene mutations in mice. Annu. Rev. Genet. 30, 603–636.[CrossRef][Medline]

Julien, E. & Herr, W. (2003) Proteolytic processing is necessary to separate and ensure proper cell growth and cytokinesis functions of HCF-1. EMBO J. 22, 2360–2369.[CrossRef][Medline]

LaMarco, K., Thompson, C.C., Byers, B.P., Walton, E.M. & McKnight, S.L. (1991) Identification of Ets- and notch-related subunits in GA binding protein. Science 253, 789–792.[Abstract/Free Full Text]

Lee, E.Y., Chang, C.Y., Hu, N., et al. (1992) Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 359, 288–294.[CrossRef][Medline]

Lipinski, M.M. & Jacks, T. (1999) The retinoblastoma gene family in differentiation and development. Oncogene 18, 7873–7882.[CrossRef][Medline]

Martelli, F., Cenciarelli, C., Santarelli, G., Polikar, B., Felsani, A. & Caruso, M. (1994) MyoD induces retinoblastoma gene expression during myogenic differentiation. Oncogene 9, 3579–3590.[Medline]

Morgenbesser, S.D., Williams, B.O., Jacks, T. & DePinho, R.A. (1994) p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens. Nature 371, 72–74.[CrossRef][Medline]

Novitch, B.G., Spicer, D.B., Kim, P.S., Cheung, W.L. & Lassar, A.B. (1999) pRb is required for MEF2-dependent gene expression as well as cell-cycle arrest during skeletal muscle differentiation. Curr. Biol. 9, 449–459.[CrossRef][Medline]

Orlando, V. (2003) Polycomb, epigenomes, and control of cell identity. Cell 112, 599–606.[CrossRef][Medline]

Rosmarin, A.G., Resendes, K.K., Yang, Z., McMillan, J.N. & Fleming, S.L. (2004) GA-binding protein transcription factor: a review of GABP as an integrator of intracellular signaling and protein–protein interactions. Blood Cells Mol. Dis. 32, 143–154.[CrossRef][Medline]

Sakai, T., Ohtani, N., McGee, T.L., Robbins, P.D. & Dryja, T.P. (1991) Oncogenic germ-line mutations in Sp1 and ATF sites in the human retinoblastoma gene. Nature 353, 83–86.[CrossRef][Medline]

Sawa, C., Goto, M., Suzuki, F., Watanabe, H., Sawada, J. & Handa, H. (1996) Functional domains of transcription factor hGABP beta1/E4TF1–53 required for nuclear localization and transcription activation. Nucleic Acids Res. 24, 4954–4961.[Abstract/Free Full Text]

Sawa, C., Yoshikawa, T., Matsuda-Suzuki, F., et al. (2002) YEAF1/RYBP and YAF-2 are functionally distinct members of a cofactor family for the YY1 and E4TF1/hGABP transcription factors. J. Biol. Chem. 277, 22484–22490.[Abstract/Free Full Text]

Sellers, W.R., Novitch, B.G., Miyake, S., et al. (1998) Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth. Genes Dev. 12, 95–106.[Abstract/Free Full Text]

Shi, Y., Lee, J.S. & Galvin, K.M. (1997) Everything you have ever wanted to know about Yin Yang 1Biochim. Biophys. Acta 1332, F49–F66.[Medline]

Sowa, Y., Shiio, Y., Fujita, T., et al. (1997) Retinoblastoma binding factor 1 site in the core promoter region of the human RB gene is activated by hGABP/E4TF1. Cancer Res. 57, 3145–3148.[Abstract/Free Full Text]

Thanos, D. & Maniatis, T. (1995) Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 83, 1091–1100.[CrossRef][Medline]

Vogel, J.L. & Kristie, T.M. (2000) The novel coactivator C1 (HCF) coordinates multiprotein enhancer formation and mediates transcription activation by GABP. EMBO J. 19, 683–690.[CrossRef][Medline]

Walowitz, J.L., Bradley, M.E., Chen, S. & Lee, T. (1998) Proteolytic regulation of the zinc finger transcription factor YY1, a repressor of muscle-restricted gene expression. J. Biol. Chem. 273, 6656–6661.[Abstract/Free Full Text]

Watanabe, H., Wada, T. & Handa, H. (1990) Transcription factor E4TF1 contains two subunits with different functions. EMBO J. 9, 841–847.[Medline]

Wysocka, J., Myers, M.P., Laherty, C.D., Eisenman, R.N. & Herr, W. (2003) Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3–K4 methyltransferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes Dev. 17, 896–911.[Abstract/Free Full Text]

Yoshida, N., Yoshida, S., Koishi, K., Masuda, K. & Nabeshima, Y. (1998) Cell heterogeneity upon myogenic differentiation: down-regulation of MyoD and Myf-5 generates ‘reserve cells.’ J. Cell Sci. 111, 769–779.[Abstract]

Zacksenhaus, E., Gill, R.M., Phillips, R.A. & Gallie, B.L. (1993) Molecular cloning and characterization of the mouse RB1 promoter. Oncogene 8, 2343–2351.[Medline]

Zacksenhaus, E., Jiang, Z., Chung, D., Marth, J.D., Phillips, R.A. & Gallie, B.L. (1996) pRb controls proliferation, differentiation, and death of skeletal muscle cells and other lineages during embryogenesis. Genes Dev. 10, 3051–3064.[Abstract/Free Full Text]

Received: 1 March 2005
Accepted: 12 April 2005




This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
R. Rizkallah and M. M. Hurt
Regulation of the Transcription Factor YY1 in Mitosis through Phosphorylation of Its DNA-binding Domain
Mol. Biol. Cell, November 15, 2009; 20(22): 4766 - 4776.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B.-N. Jeon, J.-Y. Yoo, W.-I. Choi, C.-E. Lee, H.-G. Yoon, and M.-W. Hur
Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors
J. Biol. Chem., November 28, 2008; 283(48): 33199 - 33210.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
G. Kolb and T. M. Kristie
Association of the Cellular Coactivator HCF-1 with the Golgi Apparatus in Sensory Neurons
J. Virol., October 1, 2008; 82(19): 9555 - 9563.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
Z. Wang, A. Pandey, and G. W. Hart
Dynamic Interplay between O-Linked N-Acetylglucosaminylation and Glycogen Synthase Kinase-3-dependent Phosphorylation
Mol. Cell. Proteomics, August 1, 2007; 6(8): 1365 - 1379.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Narayanan, W. T. Ruyechan, and T. M. Kristie
The coactivator host cell factor-1 mediates Set1 and MLL1 H3K4 trimethylation at herpesvirus immediate early promoters for initiation of infection
PNAS, June 26, 2007; 104(26): 10835 - 10840.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Agromayor, E. Wloga, B. Naglieri, J. Abrashkin, K. Verma, and L. Yamasaki
Visualizing Dynamic E2F-Mediated Repression In Vivo
Mol. Cell. Biol., June 15, 2006; 26(12): 4448 - 4461.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deléhouzée, S.
Right arrow Articles by Handa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deléhouzée, S.
Right arrow Articles by Handa, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS