|
|
||||||||
1 Graduate School of Pharmaceutical Sciences, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
2 Laboratory of Cellular Biochemistry, RIKEN, 2-1, Hirosawa, Wako-shi, Saitama 351-0198, Japan
3 Laboratory for Systems Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904, Japan
| Abstract |
|---|
|
|
|---|
90% did not affect 25-HC-induced inhibition of transcription of 3-hydoxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and squalene epoxidase to any extent. Exogenous lysophosphatidylcholine (LPC), which is known to cause the efflux of cellular cholesterol into the medium and to increase cholesterol synthesis, was found to rescue the 25-HC-induced down-regulation of sterol regulated genes, while LPC did not affect 25-HC-induced association of OSBP with the Golgi apparatus. These results suggest that inhibition of cholesterol biosynthesis genes by 25-HC is OSBP-independent. | Introduction |
|---|
|
|
|---|
Oxysterol binding protein (OSBP) is a cytosolic protein that binds 25-HC with high affinity and translocates from the cytosol to Golgi apparatus membranes after addition of 25-HC to cell cultures (Ridgway et al. 1992). This membrane interaction is attributed to the N-terminal pleckstrin homology (PH) domain in the protein, which most probably associates with phosphatidylinositol-4, 5-bisphosphate or a related phosphatidylinositide on Golgi membranes (Lagace et al. 1997; Levine & Munro 1998). The C-terminal part of the protein is responsible for oxysterol binding and when this is removed, the remainder of the protein localizes spontaneously to the Golgi apparatus (Ridgway et al. 1992). OSBP over-expression experiments using Chinese hamster ovary (CHO) cells have shown that OSBP plays a role in the regulation of cellular cholesterol homeostasis via its translocation to the Golgi complex (Lagace et al. 1997; Ridgway et al. 1998; Storey et al. 1998). However, it is not clear whether OSBP is involved in 25-HC-mediated regulation of cholesterol metabolism or, more precisely, in the inhibition of cholesterol biosynthesis by translocation of OSBP via 25-HC.
In this study, we knocked down expression of OSBP by using duplex small interfering RNAs (siRNAs) specific for OSBP to examine the relationship between OSBP and 25-HC-induced inhibition of cholesterol biosynthesis.
| Results |
|---|
|
|
|---|
When 25-HC is added to CHO cells, OSBP translocates from a cytosolic or vesicular compartment to the Golgi apparatus and cholesterol biosynthesis is strongly inhibited (Ridgway et al. 1992; Wolf 1999). To address whether this phenomenon is also observed in other cell types, we analyzed the subcellular localization of endogenous OSBP and cholesterol biosynthesis gene in HeLa cells treated with 25-HC. We first raised rabbit polyclonal antibodies against human OSBP by using part of its N-terminal region (see Experimental procedures). The purified OSBP polyclonal antibody (anti-OSBP pAb) detected a doublet endogenous protein of
97 kDa in HeLa cell lysate, and these immuno-reactive bands were significantly reduced in OSBP siRNA-treated cell lysate (Fig. 2A, described below), indicating that this pAb specifically recognized endogenous OSBP in HeLa cells.
|
80% (Fig. 1B), showing that the mechanism of 25-HC-induced inhibition of cholesterol biosynthesis is also conserved in HeLa cells.
|
Previous studies showed that sterol binding specificity of OSBP correlated with the ability of these compounds to suppress the activity of HMG-CoA reductase (Taylor et al. 1984), suggesting that OSBP is a potential mediator of the effects of oxysterols on the transcriptional regulation of cellular cholesterol homeostasis. To examine this possibility, we used 21-nt duplex siRNAs to selectively knock down the endogenous level of OSBP. HeLa cells were transfected with each of five candidate siRNAs targeted against OSBP (siRNA1-5), and endogenous OSBP protein levels were analyzed by Western blotting 80 h after siRNA transfection (see Experimental procedures). Among five candidate siRNAs, siRNA1 showed the strongest knock down effect, reducing the OSBP protein level by
90% (Fig. 2A, lanes 5, 6), whereas siRNA2 did not affect OSBP expression (Fig. 2A, lanes 9, 10). Similar knock down effects by OSBP siRNAs were also observed when cells were treated with 25-HC (Fig. 2A, lanes 7, 8, 11, 12). We therefore used siRNA1 as the most potent siRNA against OSBP and siRNA2 as the control siRNA, and hereafter refer to siRNA1 and siRNA2 as OSBP siRNA and control siRNA, respectively. In the cells undergoing OSBP siRNA transfection, endogenous OSBP levels were reduced to
10% of control siRNA even 48 h after the transfection (data not shown). We next examined cholesterol biosynthesis with or without 25-HC under siRNA treatment conditions. In the cells treated with control siRNA, 25-HC inhibited the expressions of HMG-CoA reductase and squalene epoxidase (Fig. 2B, control siRNA), though the inhibition efficiency was weaker than under non-transfection conditions (Fig. 1B). In the cells with strongly reduced OSBP levels, the expressions of HMG-CoA reductase and squalene epoxidase were also reduced by 25-HC treatment (Fig. 2B, OSBP siRNA), suggesting that inhibition of the transcription of cholesterol biosynthesis genes by 25-HC is not mediated by OSBP in HeLa cells.
LPC treatment inhibited 25-HC-induced suppression of cholesterol biosynthesis and did not affect the subcellular localization of OSBP in HUVECs
Takabe et al. (2004) performed large-scale gene expression analysis using human umbilical vein endothelial cells (HUVECs) exposed to oxidized LDL and lipid oxidation products such as LPC, 4-hydroxy-2-nonenal (4HNE), 7-ketocholesterol, 22(R)-hydroxycholesterol (22R-HC), and 25-HC contained in oxidized LDL. In the present GeneChip analysis using HUVECs (Fig. 3), we found that 25-HC suppressed the expressions of genes controlled by the SREBP/SREBP cleavage-activating protein (SCAP) regulatory pathway, such as LDL-receptor (0.24 ± 0.02-fold), HMG-CoA reductase (0.27 ± 0.04-fold), HMG-CoA synthase (0.18 ± 0.04-fold), and squalene epoxidase (0.39 ± 0.03-fold). LPC is known to cause the efflux of cellular cholesterol into the medium, and to increase cholesterol synthesis by increasing the expression of HMG-CoA reductase at both the gene and protein levels (Muir et al. 1996). We also found that LPC increased the expressions of these SREBP-regulated genes, such as LDL-receptor (3.42 ± 1.53-fold), HMG-CoA reductase (1.60 ± 0.58-fold), HMG-CoA synthase (1.40 ± 0.29-fold), and squalene epoxidase (1.52 ± 0.11-fold). These findings led us to examine whether LPC could inhibit 25-HC-induced suppression of SREBP-regulated genes in HUVECs. We treated HUVECs with 25-HC and LPC simultaneously, and analyzed the mRNA level of LDL-receptor by quantitative real-time PCR. In 25-HC treated HUVECs, expression of the LDL-receptor mRNA level was strongly reduced by
90% (Fig. 4, lane 2), and the reduced expression was markedly recovered by LPC treatment (Fig. 4, lanes 35). In 25-HC and LPC (20 µM) cotreated cells, the expression was increased more than 20-fold compared to that in 25-HC treated cells (Fig. 4, lane 4), and the induction of LDL-receptor expression by LPC showed a peak at 30 µM LPC treatment (Fig. 4, lane 5).
|
|
|
| Discussion |
|---|
|
|
|---|
It has been demonstrated that endogenous OSBP in CHO cells grown in lipoprotein-depleted serum was predominantly in the Golgi apparatus, but LDL supplementation of CHO cells caused the redistribution of OSBP to the cytoplasm (Storey et al. 1998). These results indicate that OSBP translocates from the cytoplasm to the Golgi apparatus when the cellular cholesterol level becomes low, suggesting that binding of OSBP to the Golgi apparatus up-regulates cholesterol synthesis. On the other hand, 25-HC treatment also causes translocation of OSBP to the Golgi apparatus while 25-HC suppresses the SREBP-regulated genes. This apparent discrepancy may be explained as follows. 25-HC treatment suppresses genes for cholesterol biosynthesis and the LDL receptor, which causes decrease in the intracellular cholesterol level. The cells respond to this cholesterol decrease and cause OSBP to be translocated to the Golgi apparatus to up-regulate cholesterol biosynthesis.
What is the mechanism by which 25-HC down-regulates cholesterol synthesis?
Adams et al. (2004) demonstrated that 25-HC and cholesterol inhibit cholesterol synthesis by different mechanisms, both involving the proteins that control SREBPs. They showed that cholesterol enters cultured CHO cells and elicits a conformational change in SCAP by directly binding to it. This change causes SCAP to bind to Insigs, which are endoplasmic reticulum (ER) retention proteins that abrogate movement of the SCAP/SREBP complex to the Golgi apparatus where SREBPs are normally processed to their active forms. 25-HC is more potent than cholesterol in eliciting SCAP binding to Insigs, but 25-HC does not cause a conformational change in SCAP. Moreover, 25-HC does not bind to SCAP, implying that 25-HC acts indirectly through a putative 25-HC sensor protein that elicits SCAP-Insig binding. As mentioned above, we suggested that OSBP is not involved in 25-HC-mediated regulation of cholesterol metabolism or SREBP processing. OSBP is the founding member of a superfamily that includes more than 10 OSBP-related proteins (ORPs) in mammalian genomes (Jaworski et al. 2001; Lehto et al. 2001). It is possible that the true 25-HC sensor is not OSBP but rather one of the other ORPs. Indeed, it was shown that like OSBP, ORP4-L binds 25-HC with high affinity and specificity (Wang et al. 2002). Alternatively, OSBP and a certain ORP(s) function as redundant acceptors of 25-HC-induced suppression of SREBP-regulated genes. Further knock down analyses are required to clarify these possibilities.
OSBP is evolutionarily conserved in various species including D. melanogaster and C. elegans (Alphey et al. 1998; Jaworski et al. 2001; Lehto et al. 2001; Fukuzawa & Williams 2002), neither of which possess the cholesterol biosynthesis pathway. This suggests that OSBP plays roles in fundamental cell function other than cholesterol metabolism in these lower organisms as well as in higher animals. Indeed, recent studies revealed that OSBP is involved in vesicle transport (Wyles et al. 2002) and signal transduction (Wang et al. 2005). Wyles et al. (2002) have shown that OSBP interacts with vesicle-associated membrane protein-associated protein-A (VAP-A), a syntaxin-like ER protein implicated in vesicle transport, and modifies vesicle export from the ER. It is possible that OSBP is involved in cholesterol metabolism indirectly by regulating sterol-containing vesicle transport between the ER and the Golgi apparatus. On the other hand, Wang et al. (2005) demonstrated that OSBP functions as a cholesterol binding scaffolding protein coordinating the activity of two phosphatases to control the extracellular signal-regulated kinase (ERK) signaling. According to their data, OSBP forms a complex with a member of the protein tyrosine phosphatase (PC12, Br7, Sl) family (PTPPBS, Augustine et al. 2000), the serine/threonine phosphatase PP2A and cholesterol. The complex disassembled and the level of phosphorylated ERK rises when cell cholesterol was lowered. ERK is known to phosphorylate SREBP-2, and the phosphorylation enhances the transcriptional activity of SREBP-2 (Kotzka et al. 2004). Thus, OSBP may be involved indirectly in regulation of cholesterol metabolism.
In conclusion, we demonstrated with the siRNA technique that OSBP is not directly involved in 25-HC-induced down-regulation of sterol-regulated genes. A major question that remains to be answered is what molecule(s) serve as a target of 25-HC in the SREBP processing in cells.
| Experimental procedures |
|---|
|
|
|---|
25-hydroxycholesterol (25-HC), 22(R)-hydroxycholesterol (22R-HC), and
-palmitoyl-lysophosphatidylcholine (LPC) were purchased from Sigma (St. Louis, MO, USA). 7-ketocholesterol was from Steraloids, Inc. (Newport, RI, USA). 4HNE was from Cayman Chemical Co. (Ann Arbor, MI, USA). All chemicals were dissolved in ethanol, which was diluted with Dulbecco's modified Eagle medium (DMEM, Sigma) or endothelial cell growth factor-containing medium 2 (EGM-2; Clonetics, San Diego, CA, USA), resulting in a final ethanol concentration of 0.01%. Control cells received comparable volumes of ethanol. siRNAs were synthesized with a SilencerTM siRNA Construction Kit (Ambion, Austin, TX, USA). The OSBP-specific siRNA sequences were from positions 23692389 (siRNA1: 5'-aauacugggaguguaaagaaa-3'), 18101830 (siRNA2: 5'-aagacaggagacaaguguaau-3'), 358378 (siRNA3: 5'-uacagaucaaaggcagaaaug-3'), 610630 (siRNA4: 5'-aagacugagcugcagaauacc-3'), and 12701290 (siRNA5: 5'-aagaacugcauuggaaaagaa-3').
Preparation of polyclonal antibody
A peptide corresponding to the N-terminal domain of human OSBP (NH2-AATELRGVVGPGPA-COOH) was synthesized. The synthetic peptide plus an N-terminal cysteine was coupled to keyhole limpet hemocyanin, emulsified in Freund's adjuvant, and injected into the backs of two New Zealand white rabbits. The rabbit sera were used for immunoblotting and immunofluorescence in 1 : 4000 dilution.
Cell culture and transfection
HeLa cells were maintained in DMEM supplemented with 10% fetal calf serum and 100 units/mL penicillin, 100 mg/mL streptomycin, 2 mM L-glutamine. The resulting siRNAs were transfected into HeLa cells using LipofectAMINE 2000 reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer's protocol. The final concentration of siRNA was 10 nM. The cells were then incubated in the identical medium with 25-HC (6.2 µM) or solvent (ethanol) for 8 h before analysis. Human umbilical vein endothelial cells (HUVECs) were grown in EGM-2 with 2% fetal bovine serum (FBS) at 37 °C in a 5% CO2 atmosphere, and all experiments were conducted in 4 passages. The cells were cultured on plates coated with gel made of collagen types 1 (Iwaki, Tokyo, Japan). After 24 h, cells were washed and switched to EGM-2 with 0.5% FBS. After 16 h, 25-HC (0 or 10 µM) and/or LPC (0, 10, 20, 30 µM) were added and the cells were incubated for another 2 or 4 h.
Quantitative real-time PCR
Total RNA from cells was extracted using ISOGEN (Nippongene, Toyama, Japan) and reverse-transcribed using the SuperScript first-strand synthesis system for RT-PCR (Invitrogen). Oligonucleotide primers for PCR were designed using Primer Express Software (Applied Biosystems, Foster City, CA, USA). The sequences of the oligonucleotides used in PCR reaction were as follows. HMG-CoA reductase-forward acctttccagagcaagcacatt; HMG-CoA reductase-reverse aggacctaaaattgccattcca; squalene epoxidase-forward attcatcatgagtctccggaaag; squalene epoxidase-reverse ccatcacaacatcatcttcctctaa; LDLR-forward tttctgaaatcgccgtgttactg; LDLR-reverse acatcttcacgcgggagtct; GAPDH-forward gccaaggtcatccatgacaact; GAPDH-reverse gaggggccatccacagtctt. PCR reactions were performed using an ABI Prism 7000 sequence detection system (Applied Biosystems). The transcript number of human GAPDH was quantified, and each sample was normalized on the basis of GAPDH content.
Western blotting
HeLa cells were extracted and washed with ice-cold SET buffer (0.25 M sucrose, 1 mM EDTA, 10 mM Tris-HCl, pH 7.4) containing a protease inhibitor mixture. They were homogenized in SET buffer and then centrifuged at 1000 g for 20 min at 4 °C. The resultant supernatants were used as total protein lysate. The protein concentrations of samples were determined by BCA assay (Pierce, Rockford, IL, USA). Protein samples were separated by SDS-PAGE and transferred to nitrocellulose membranes using the Bio-Rad protein transfer system. The membranes were blocked with Tris-buffered saline containing 5% (w/v) skimmed milk and 0.05% (v/v) Tween 20, incubated with anti-OSBP polyclonal antibody, and then treated with anti-rabbit IgG-horseradish peroxidase. Proteins bound to the antibodies were visualized with an enhanced chemiluminescence kit (ECL, Amersham, Arlington Heights, IL, USA).
Immunofluorescence
HeLa cells and HUVECs were fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.5% Triton X-100 for 15 min, and then blocked with 3% bovine serum albumin in PBS for 30 min at room temperature. The cells were then incubated with the anti-OSBP polyclonal antibody and anti-p230 monoclonal antibody (BD Transduction Laboratories, Franklin Lakes, NJ, USA) overnight at 4 °C, washed 4 times with PBS, incubated again with an Alexa Fluor 488 goat anti-rabbit IgG (H + L) antibody and an Alexa Fluor 594 goat anti-mouse IgG(H + L) antibody, DAPI for 1 h at room temperature, washed thoroughly with PBS, embedded, and then visualized using a fluorescent microscope (LEICA DM IRE2).
Microarray analysis
An oligonucleotide microarray analysis was performed by using the GeneChip Human Genome Focus Array (Affymetrix Inc., Santa Clara, CA, USA). Fold change value was calculated as previously described (Takabe et al. 2004).
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: harai{at}mol.f.u-tokyo.ac.jp
| References |
|---|
|
|
|---|
Alphey, L., Jimenez, J. & Glover, D. (1998) A drosophila homologue of oxysterol binding protein (OSBP)-implications for the role of OSBP. Biochim. Biophys. Acta 1395, 159164.[Medline]
Augustine, K.A., Silbiger, S.M., Bucay, N., et al. (2000) Protein tyrosine phosphatase (PC12, Br7, Sl) family: expression characterization in the adult human and mouse. Anat. Rec. 258, 221234.[CrossRef][Medline]
Bakos, J.T., Johnson, B.H. & Thompson, E.B. (1993) Oxysterol-induced cell death in human leukemic T-cells correlates with oxysterol binding protein occupancy and is independent of glucocorticoid-induced apoptosis. J. Steroid Biochem. Mol. Biol. 46, 415426.[CrossRef][Medline]
Bjorkhem, I., Andersson, O., Diczfalusy, U., et al. (1994) Atherosclerosis and sterol 27-hydroxylase: evidence for a role of this enzyme in elimination of cholesterol from human macrophages. Proc. Natl. Acad. Sci. USA
91, 85928596.
Brown, M.S. & Goldstein, J.L. (1974) Suppression of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity and inhibition of growth of human fibroblasts by 7-ketocholesterol. J. Biol. Chem.
249, 73067314.
Brown, M.S. & Goldstein, J.L. (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331340.[CrossRef][Medline]
Fukuzawa, M. & Williams, J.G. (2002) OSBPa, a predicted oxysterol binding protein of Dictyostelium, is required for regulated entry into culmination. FEBS Lett. 527, 3742.[CrossRef][Medline]
Hanley, K., Ng, D.C., He, S.S., et al. (2000) Oxysterols induce differentiation in human keratinocytes and increase Ap-1-dependent involucrin transcription. J. Invest. Dermatol. 114, 545553.[CrossRef][Medline]
Jaworski, C.J., Moreira, E., Li, A., Lee, R. & Rodriguez, I.R. (2001) A family of 12 human genes containing oxysterol-binding domains. Genomics 78, 185196.[CrossRef][Medline]
Kandutsch, A.A. & Chen, H.W. (1974) Inhibition of sterol synthesis in cultured mouse cells by cholesterol derivatives oxygenated in the side chain. J. Biol. Chem.
249, 60576061.
Kolsch, H., Lutjohann, D., Tulke, A., Bjorkhem, I. & Rao, M.L. (1999) The neurotoxic effect of 24-hydroxycholesterol on SH-SY5Y human neuroblastoma cells. Brain Res. 818, 171175.[CrossRef][Medline]
Kotzka, J., Lehr, S., Roth, G., Avci, H., Knebel, B. & Muller-Wieland, D. (2004) Insulin-activated Erk-mitogen-activated protein kinases phosphorylate sterol regulatory element-binding protein-2 at serine residues 432 and 455 in vivo. J. Biol. Chem.
279, 2240422411.
Lagace, T.A., Byers, D.M., Cook, H.W. & Ridgway, N.D. (1997) Altered regulation of cholesterol and cholesteryl ester synthesis in Chinese-hamster ovary cells overexpressing the oxysterol-binding protein is dependent on the pleckstrin homology domain. Biochem. J. 326, 205213.
Lehmann, J.M., Kliewer, S.A., Moore, L.B., et al. (1997) Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem.
272, 31373140.
Lehto, M., Laitinen, S., Chinetti, G., et al. (2001) The OSBP-related protein family in humans. J. Lipid Res.
42, 12031213.
Levine, T.P. & Munro, S. (1998) The pleckstrin homology domain of oxysterol-binding protein recognises a determinant specific to Golgi membranes. Curr. Biol. 8, 729739.[CrossRef][Medline]
Morin, R.J. & Peng, S.K. (1989) The role of cholesterol oxidation products in the pathogens is of atherosclerosis. Ann. Clin. Lab. Sci. 19, 225237.[Abstract]
Muir, L.V., Born, E., Mathur, S.N. & Field, F.J. (1996) Lysophosphatidylcholine increases 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene expression in CaCo-2 cells. Gastroenterology 110, 10681076.[CrossRef][Medline]
Peet, D.J., Turley, S.D., Ma, W., et al. (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693704.[CrossRef][Medline]
Peng, S.K. & Morin, R.J. (1987) Effects on membrane function by cholesterol oxidation derivatives in cultured aortic smooth muscle cells. Artery 14, 8599.[Medline]
Rawson, R.B. (2003) The SREBP pathwayinsights from Insigs and insects. Nat. Rev. Mol. Cell. Biol. 4, 631640.[CrossRef][Medline]
Ridgway, N.D. & Lagace, T.A. (1995) Brefeldin-A renders Chinese-hamster ovary cells insensitive to transcriptional suppression by 25-hydroxycholesterol. J. Biol. Chem.
270, 80238031.
Ridgway, N.D., Dawson, P.A., Ho, Y.K., Brown, M.S. & Goldstein, J.L. (1992) Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding. J. Cell Biol.
116, 307319.
Ridgway, N.D., Lagace, T.A., Cook, H.W. & Byers, D.M. (1998) Differential effects of sphingomyelin hydrolysis and cholesterol transport on oxysterol-binding protein phosphorylation and Golgi localization. J. Biol. Chem.
273, 3162131628.
Rusinol, A.E., Yang, L., Thewke, D., Panini, S.R., Kramer, M.F. & Sinensky, M.S. (2000) Isolation of a somatic cell mutant resistant to the induction of apoptosis by oxidized low density lipoprotein. J. Biol. Chem.
275, 72967303.
Storey, M.K., Byers, D.M., Cook, H.W. & Ridgway, N.D. (1998) Cholesterol regulates oxysterol binding protein (OSBP) phosphorylation and Golgi localization in Chinese hamster ovary cells: correlation with stimulation of sphingomyelin synthesis by 25-hydroxycholesterol. Biochem. J. 336, 247256.
Takabe, W., Kanai, Y., Chairoungdua, A., et al. (2004) Lysophosphatidylcholine enhances cytokine production of endothelial cells via induction of L-Type amino acid transporter 1 and cell surface antigen 4F2. Arterioscler. Thromb. Vasc. Biol.
24, 16401645.
Taylor, F.R., Saucier, S.E., Shown, E.P., Parish, E.J. & Kandutsch, A.A. (1984) Correlation between oxysterol binding to a cytosolic binding protein and potency in the repression of hydroxymethylglutaryl coenzyme A reductase. J. Biol. Chem.
259, 1238212387.
Thompson, E.B. & Ayala-Torres, S. (1999) Oxysterols and apoptosis: evidence for gene regulation outside the cholesterol pathway. Crit. Rev. Biochem. Mol. Biol. 34, 2532.[CrossRef][Medline]
Wang, C., Jebailey, L. & Ridgway, N.D. (2002) Oxysterol-binding-protein (OSBP)-related protein 4 binds 25-hydroxycholesterol and interacts with vimentin intermediate filaments. Biochem. J. 361, 461472.[CrossRef][Medline]
Wang, P.Y., Weng, J. & Anderson, R.G. (2005) OSBP is a cholesterol-regulated scaffolding protein in control of ERK1/2 activation. Science
307, 14721476.
Wolf, G. (1999) The role of oxysterols in cholesterol homeostasis. Nutr. Rev. 57, 196198.[Medline]
Wyles, J.P., McMaster, C.R. & Ridgway, N.D. (2002) Vesicle-associated membrane protein-associated protein-A (VAP-A) interacts with the oxysterol-binding protein to modify export from the endoplasmic reticulum. J. Biol. Chem.
277, 2990829918.
Received: 19 April 2005
Accepted: 5 May 2005
This article has been cited by other articles:
![]() |
K. Bowden and N. D. Ridgway OSBP Negatively Regulates ABCA1 Protein Stability J. Biol. Chem., June 27, 2008; 283(26): 18210 - 18217. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yan, M. Lehto, L. Rasilainen, J. Metso, C. Ehnholm, S. Yla-Herttuala, M. Jauhiainen, and V. M. Olkkonen Oxysterol Binding Protein Induces Upregulation of SREBP-1c and Enhances Hepatic Lipogenesis Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 1108 - 1114. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Perry and N. D. Ridgway Oxysterol-binding Protein and Vesicle-associated Membrane Protein-associated Protein Are Required for Sterol-dependent Activation of the Ceramide Transport Protein Mol. Biol. Cell, June 1, 2006; 17(6): 2604 - 2616. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |