GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2005) 10, 793-801. doi:10.1111/j.1365-2443.2005.00879.x
© 2005 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishimura, T.
Right arrow Articles by Arai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishimura, T.
Right arrow Articles by Arai, H.

Inhibition of cholesterol biosynthesis by 25-hydroxycholesterol is independent of OSBP

Taki Nishimura1, Takao Inoue1, Norihito Shibata2, Azusa Sekine3, Wakako Takabe3, Noriko Noguchi3 and Hiroyuki Arai1,*

1 Graduate School of Pharmaceutical Sciences, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
2 Laboratory of Cellular Biochemistry, RIKEN, 2-1, Hirosawa, Wako-shi, Saitama 351-0198, Japan
3 Laboratory for Systems Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
25-hydroxycholesterol (25-HC) is a potent suppressor of cholesterol synthesis gene transcription in cultured cells. A high affinity binding protein for 25-HC, oxysterol-binding protein (OSBP), has been identified from tissue cytosol. OSBP translocates from the cytosol to the Golgi apparatus membranes after addition of 25-HC to cell cultures and is thought to mediate 25-HC action on cholesterol metabolism through association to the Golgi apparatus. However, direct evidence to prove this hypothesis was lacking. In this study, we knocked down expression of OSBP by using duplex siRNAs specific for OSBP to examine the relationship between OSBP and 25-HC-induced inhibition of cholesterol synthesis gene transcription. We found that decreasing OSBP expression by ~90% did not affect 25-HC-induced inhibition of transcription of 3-hydoxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and squalene epoxidase to any extent. Exogenous lysophosphatidylcholine (LPC), which is known to cause the efflux of cellular cholesterol into the medium and to increase cholesterol synthesis, was found to rescue the 25-HC-induced down-regulation of sterol regulated genes, while LPC did not affect 25-HC-induced association of OSBP with the Golgi apparatus. These results suggest that inhibition of cholesterol biosynthesis genes by 25-HC is OSBP-independent.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Oxysterols are 27-carbon oxygenated cholesterol derivatives emerging from sterol oxidation or metabolic pathways involved in the formation of sterols, steroids, and bile acids. Oxysterols have been shown to possess potent regulatory functions in a wide range of biologic mechanisms, including cholesterol homeostasis (Wolf 1999), apoptosis (Bakos et al. 1993; Thompson & Ayala-Torres 1999; Rusinol et al. 2000), calcium uptake (Kolsch et al. 1999), atherosclerotic plaque formation (Peng & Morin 1987; Morin & Peng 1989), and cell differentiation (Hanley et al. 2000). Several oxysterols occur naturally, including 25-hydroxycholesterol (cholest-5-ene-3ß, 25-diol), 24-hydroxycholesterol (cholest-5-ene-3ß, 24-diol), and 27-hydroxycholesterol (cholest-5-ene-3ß, 27-diol) (Bjorkhem et al. 1994). Of these three oxysterols, 25-hydroxycholesterol (25-HC) is the most potent suppressor of cholesterol synthesis gene transcription when assayed in vitro (Brown & Goldstein 1974; Kandutsch & Chen 1974; Lehman et al. 1997; Peet et al. 1998). 25-HC suppresses the cleavage of sterol regulatory element-binding proteins (SREBPs) (Brown & Goldstein 1997), which control enzyme levels in cholesterol synthesis, such as 3-hydoxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and HMG-CoA synthase, as well as the synthesis of low density lipoprotein (LDL)-receptor, which mediate endocytosis of cholesterol-rich LDL particles (Rawson 2003). SREBPs are synthesized as inactive precursors in the membrane compartment of the cell. When intracellular cholesterol levels decline, SREBPs are cleaved to release amino-terminal fragments that translocate into the nucleus and activate the transcription of target genes involved in cholesterol synthesis and supply (Brown & Goldstein 1997). This activation in turn restores intracellular cholesterol levels.

Oxysterol binding protein (OSBP) is a cytosolic protein that binds 25-HC with high affinity and translocates from the cytosol to Golgi apparatus membranes after addition of 25-HC to cell cultures (Ridgway et al. 1992). This membrane interaction is attributed to the N-terminal pleckstrin homology (PH) domain in the protein, which most probably associates with phosphatidylinositol-4, 5-bisphosphate or a related phosphatidylinositide on Golgi membranes (Lagace et al. 1997; Levine & Munro 1998). The C-terminal part of the protein is responsible for oxysterol binding and when this is removed, the remainder of the protein localizes spontaneously to the Golgi apparatus (Ridgway et al. 1992). OSBP over-expression experiments using Chinese hamster ovary (CHO) cells have shown that OSBP plays a role in the regulation of cellular cholesterol homeostasis via its translocation to the Golgi complex (Lagace et al. 1997; Ridgway et al. 1998; Storey et al. 1998). However, it is not clear whether OSBP is involved in 25-HC-mediated regulation of cholesterol metabolism or, more precisely, in the inhibition of cholesterol biosynthesis by translocation of OSBP via 25-HC.

In this study, we knocked down expression of OSBP by using duplex small interfering RNAs (siRNAs) specific for OSBP to examine the relationship between OSBP and 25-HC-induced inhibition of cholesterol biosynthesis.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
25-HC promotes the translocation of OSBP from cytosol to the Golgi apparatus and inhibits cholesterol biosynthesis in HeLa cells

When 25-HC is added to CHO cells, OSBP translocates from a cytosolic or vesicular compartment to the Golgi apparatus and cholesterol biosynthesis is strongly inhibited (Ridgway et al. 1992; Wolf 1999). To address whether this phenomenon is also observed in other cell types, we analyzed the subcellular localization of endogenous OSBP and cholesterol biosynthesis gene in HeLa cells treated with 25-HC. We first raised rabbit polyclonal antibodies against human OSBP by using part of its N-terminal region (see Experimental procedures). The purified OSBP polyclonal antibody (anti-OSBP pAb) detected a doublet endogenous protein of ~97 kDa in HeLa cell lysate, and these immuno-reactive bands were significantly reduced in OSBP siRNA-treated cell lysate (Fig. 2A, described below), indicating that this pAb specifically recognized endogenous OSBP in HeLa cells.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2  Effect of OSBP knock down on the 25-HC-induced suppression of expression of HMG-CoA reductase and squalene epoxidase genes. HeLa cells were transfected with the indicated siRNAs against OSBP. At 72 h after transfection, the cells were incubated in the identical medium containing 25-HC (6.2 µM) (lanes 3, 4, 7, 8, 11, 12) or solvent (ethanol) (lanes 1, 2, 5, 6, 9, 10) for 8 h. (A) The total cell lysate was subjected to immunoblotting analysis to detect OSBP. OSBP expression was reduced in the cells transfected with OSBP siRNA1, whereas the expression was not affected in the cells transfected with siRNA2. (B) The level of HMG-CoA reductase ({square}) and squalene epoxidase ({blacksquare}) mRNA were measured using quantitative real-time RT-PCR and normalized by the quantity of GAPDH mRNA.

 
Immunofluorescence analysis using the anti-OSBP pAb showed that endogenous OSBP was primarily localized to multiple small vesicle-like structures distributed throughout the cytoplasm and to a juxta-nuclear Golgi apparatus in control HeLa cells (Fig. 1A,a–c). When HeLa cells were treated with 25-HC, the vesicle-like localization of OSBP was significantly reduced and OSBP was predominantly localized at the Golgi apparatus (Fig. 1A,d–f), indicating that 25-HC promotes translocation of OSBP to the Golgi apparatus in HeLa cells. As shown in Fig. 1A, clear Golgi localization of OSBP was observed even under control conditions, in which cells were treated with only vehicle ethanol. In CHO cells, endogenous OSBP was also primarily localized at the Golgi apparatus, although the proportion of OSBP at the Golgi membrane was less than that in HeLa cells (data not shown). Next, we examined the effects of 25-HC on the transcription of cholesterol biosynthesis genes in HeLa cells. The gene expressions of HMG-CoA reductase and squalene epoxidase, which are SREBP-regulated enzymes of cholesterol biosynthesis, were measured by quantitative real-time PCR. By 25-HC treatment, the expressions of HMG-CoA reductase and squalene epoxidase were reduced by ~80% (Fig. 1B), showing that the mechanism of 25-HC-induced inhibition of cholesterol biosynthesis is also conserved in HeLa cells.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1  Effect of 25-HC in HeLa cells. (A) Effect of 25-HC on the distribution of OSBP in HeLa cells. HeLa cells were cultured in DMEM with 10% (v/v) FCS. Cells were then incubated in the identical medium containing 25-HC (6.2 µM) or solvent (ethanol) for 8 h. The cells were processed for indirect immunofluorescence using anti-OSBP polyclonal antibody (a, d) or TGN marker p230 (b, e). OSBP (green) and p230 (red) images from the same fields were merged (c, f) Bars, 10 µM. (B) Effect of 25-HC on HMG-CoA reductase and squalene epoxidase gene expressions in HeLa cells. The level of HMG-CoA reductase ({square}) and squalene epoxidase ({blacksquare}) mRNAs were measured using quantitative real-time RT-PCR and normalized by the quantity of GAPDH mRNA.

 
Knock down of OSBP did not affect 25-HC-induced suppression of cholesterol biosynthesis

Previous studies showed that sterol binding specificity of OSBP correlated with the ability of these compounds to suppress the activity of HMG-CoA reductase (Taylor et al. 1984), suggesting that OSBP is a potential mediator of the effects of oxysterols on the transcriptional regulation of cellular cholesterol homeostasis. To examine this possibility, we used 21-nt duplex siRNAs to selectively knock down the endogenous level of OSBP. HeLa cells were transfected with each of five candidate siRNAs targeted against OSBP (siRNA1-5), and endogenous OSBP protein levels were analyzed by Western blotting 80 h after siRNA transfection (see Experimental procedures). Among five candidate siRNAs, siRNA1 showed the strongest knock down effect, reducing the OSBP protein level by ~90% (Fig. 2A, lanes 5, 6), whereas siRNA2 did not affect OSBP expression (Fig. 2A, lanes 9, 10). Similar knock down effects by OSBP siRNAs were also observed when cells were treated with 25-HC (Fig. 2A, lanes 7, 8, 11, 12). We therefore used siRNA1 as the most potent siRNA against OSBP and siRNA2 as the control siRNA, and hereafter refer to siRNA1 and siRNA2 as OSBP siRNA and control siRNA, respectively. In the cells undergoing OSBP siRNA transfection, endogenous OSBP levels were reduced to ~10% of control siRNA even 48 h after the transfection (data not shown). We next examined cholesterol biosynthesis with or without 25-HC under siRNA treatment conditions. In the cells treated with control siRNA, 25-HC inhibited the expressions of HMG-CoA reductase and squalene epoxidase (Fig. 2B, control siRNA), though the inhibition efficiency was weaker than under non-transfection conditions (Fig. 1B). In the cells with strongly reduced OSBP levels, the expressions of HMG-CoA reductase and squalene epoxidase were also reduced by 25-HC treatment (Fig. 2B, OSBP siRNA), suggesting that inhibition of the transcription of cholesterol biosynthesis genes by 25-HC is not mediated by OSBP in HeLa cells.

LPC treatment inhibited 25-HC-induced suppression of cholesterol biosynthesis and did not affect the subcellular localization of OSBP in HUVECs

Takabe et al. (2004) performed large-scale gene expression analysis using human umbilical vein endothelial cells (HUVECs) exposed to oxidized LDL and lipid oxidation products such as LPC, 4-hydroxy-2-nonenal (4HNE), 7-ketocholesterol, 22(R)-hydroxycholesterol (22R-HC), and 25-HC contained in oxidized LDL. In the present GeneChip analysis using HUVECs (Fig. 3), we found that 25-HC suppressed the expressions of genes controlled by the SREBP/SREBP cleavage-activating protein (SCAP) regulatory pathway, such as LDL-receptor (0.24 ± 0.02-fold), HMG-CoA reductase (0.27 ± 0.04-fold), HMG-CoA synthase (0.18 ± 0.04-fold), and squalene epoxidase (0.39 ± 0.03-fold). LPC is known to cause the efflux of cellular cholesterol into the medium, and to increase cholesterol synthesis by increasing the expression of HMG-CoA reductase at both the gene and protein levels (Muir et al. 1996). We also found that LPC increased the expressions of these SREBP-regulated genes, such as LDL-receptor (3.42 ± 1.53-fold), HMG-CoA reductase (1.60 ± 0.58-fold), HMG-CoA synthase (1.40 ± 0.29-fold), and squalene epoxidase (1.52 ± 0.11-fold). These findings led us to examine whether LPC could inhibit 25-HC-induced suppression of SREBP-regulated genes in HUVECs. We treated HUVECs with 25-HC and LPC simultaneously, and analyzed the mRNA level of LDL-receptor by quantitative real-time PCR. In 25-HC treated HUVECs, expression of the LDL-receptor mRNA level was strongly reduced by ~90% (Fig. 4, lane 2), and the reduced expression was markedly recovered by LPC treatment (Fig. 4, lanes 3–5). In 25-HC and LPC (20 µM) cotreated cells, the expression was increased more than 20-fold compared to that in 25-HC treated cells (Fig. 4, lane 4), and the induction of LDL-receptor expression by LPC showed a peak at 30 µM LPC treatment (Fig. 4, lane 5).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3  Cluster analysis of gene expression in response to oxysterols and LPC. HUVECs were grown in EGM-2 with 2% FBS at 37 °C in a 5% CO2 atmosphere. HUVECs were treated with 200 g/L oxidized LDL (OxLDL), 10 mol/L 7-ketocholesterol (7-keto), 10 mol/L 22(R)-hydroxycholesterol (22R-HC), 10 mol/L 25-HC, 30 mol/L LPC, or 5 mol/L 4HNE for the indicated time. The control cells were cultured in EGM-2 containing 0.01% EtOH in the absence of oxidation products. Shown are genes that were up-regulated by LPC and down-regulated by oxysterols. CYP51, cytochrome P450, 51 (lanosterol 14-alpha-demethylase); LDLR, low density lipoprotein receptor; INSIG1, insulin induced gene 1; IDI1, isopentenyl-diphosphate delta isomerase; SQLE, squalene epoxidase; HMGCS1, HMG-CoA synthase 1 (soluble); HMGCR, HMG-CoA reductase; SC4MOL, sterol-C4-methyl oxidase-like; SCD, stearoyl-CoA desaturase (delta-9-desaturase).

 


View larger version (10K):
[in this window]
[in a new window]
 
Figure 4  Effect of LPC on the 25-HC-induced suppression of LDL receptor gene expression in HUVECs. HUVECs were cultured in EGM-2 with 2% (v/v) FBS. Cells were then washed and switched to EGM-2 with 0.5% (v/v) FBS. At 16 h later, 25-HC and LPC were added to the medium, resulting in final concentrations as indicated. The level of LDL receptor mRNA in HUVECs was measured using quantitative real-time RT-PCR and normalized by the quantity of GAPDH mRNA. The data shown are means vs. solvent treated values.

 
We next examined the subcellular localization of OSBP in HUVECs under 25-HC and/or LPC treatment conditions. As observed in HeLa cells, endogenous OSBP was primarily localized to multiple small vesicle-like structures in the cytoplasm and to the Golgi membranes in control HUVECs (Fig. 5, EtOH). When HUVECs were treated with 25-HC, the vesicle-like localization of OSBP was reduced, and OSBP was predominantly localized at the Golgi apparatus (Fig. 5, 25-HC). The Golgi localization of OSBP was not affected by additional LPC treatment (Fig. 5, 25-HC + LPC), while the expression of LDL receptor mRNA level was strikingly increased (Figs 3 and 4). These observations suggest that the Golgi localization of OSBP does not necessarily correlate with inhibition of SREBP-regulated genes.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5  Effect of LPC on 25-HC-induced OSBP translocation in HUVECs. HUVECs were cultured in EGM-2 with 2% (v/v) FBS. Cells were then washed and incubated in EGM-2 containing 0.5% (v/v) FBS. At 16 h, 25-HC (10 µM) and LPC (30 µM) were added. The cells were processed for indirect immunofluorescence using anti-OSBP polyclonal antibody (a, d, g, j, m, p) and TGN marker p230 (b, e, h, k, n, q). OSBP (green) and p230 (red) images from the same fields were merged (c, f, i, l, o, r) Bars, 10 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The idea that OSBP functions as a receptor involved in the 25-HC-mediated suppression of SREBP-regulated genes comes from the following observations; (1) OSBP displays high affinity for one of the most potent inhibitors, 25-HC; (2) the apparent relative binding affinities of several oxysterols correlates with their potency in cell cultures; (3) steroids which do not repress HMG-CoA reductase in cultured cells do not bind to OSBP; and (4) the kinetics of association and dissociation of 25-HC with OSBP in intact cells is commensurate with the timing of the cellular response. OSBP undergoes translocation from a cytoplasmic/vesicular compartment to the Golgi apparatus in the presence of 25-HC (Ridgway et al. 1992). Brefeldin A, which disrupts association of OSBP with the Golgi apparatus, causes inhibition of 25-HC-mediated suppression of SREBP-regulated genes such as HMG-CoA reductase, HMG-CoA synthase and LDL receptor (Ridgway & Lagace 1995). These results also support the hypothesis that OSBP is involved in 25-HC-mediated suppression of mRNAs for sterol-regulated genes. However, direct evidence to prove this hypothesis was lacking. In fact, several experimental data indicate that suppression of mRNA for SREBP-regulated genes by 25-HC is OSBP-independent. For example, in some cases, where the binding affinity of a sterol is considerably lower than its inhibitory potency in cells, although it is possible that such a sterol is metabolized to more active derivatives in cells. In this study, we showed that knocking down OSBP by using duplex siRNAs does not affect 25-HC-mediated suppression of SREBP-regulated genes such as HMG-CoA reductase and squalene epoxidase to any extent. Lagace et al. (1997) demonstrated that cells over-expressing OSBP by 25-fold displayed approximately 50% increase in mRNAs for three SREBP-regulated genes, LDL receptor, HMG-CoA reductase and HMG-CoA synthase compared with mock transfected controls, but similar degree of suppression of these genes were observed when these cells were treated with 25-HC. These results indicate that 25-HC action on SREBP-regulated genes is independent of the expression level of OSBP. Moreover, we showed that LPC recovers the 25-HC-mediated suppression of LDL receptor mRNA, while LPC does not affect the 25-HC-induced translocation of OSBP from cytoplasm to the Golgi apparatus, indicating that translocation of OSBP to the Golgi apparatus membranes induced by 25-HC treatment does not necessarily correlate with the 25-HC-mediated suppression of SREBP-regulated genes.

It has been demonstrated that endogenous OSBP in CHO cells grown in lipoprotein-depleted serum was predominantly in the Golgi apparatus, but LDL supplementation of CHO cells caused the redistribution of OSBP to the cytoplasm (Storey et al. 1998). These results indicate that OSBP translocates from the cytoplasm to the Golgi apparatus when the cellular cholesterol level becomes low, suggesting that binding of OSBP to the Golgi apparatus up-regulates cholesterol synthesis. On the other hand, 25-HC treatment also causes translocation of OSBP to the Golgi apparatus while 25-HC suppresses the SREBP-regulated genes. This apparent discrepancy may be explained as follows. 25-HC treatment suppresses genes for cholesterol biosynthesis and the LDL receptor, which causes decrease in the intracellular cholesterol level. The cells respond to this cholesterol decrease and cause OSBP to be translocated to the Golgi apparatus to up-regulate cholesterol biosynthesis.

What is the mechanism by which 25-HC down-regulates cholesterol synthesis?

Adams et al. (2004) demonstrated that 25-HC and cholesterol inhibit cholesterol synthesis by different mechanisms, both involving the proteins that control SREBPs. They showed that cholesterol enters cultured CHO cells and elicits a conformational change in SCAP by directly binding to it. This change causes SCAP to bind to Insigs, which are endoplasmic reticulum (ER) retention proteins that abrogate movement of the SCAP/SREBP complex to the Golgi apparatus where SREBPs are normally processed to their active forms. 25-HC is more potent than cholesterol in eliciting SCAP binding to Insigs, but 25-HC does not cause a conformational change in SCAP. Moreover, 25-HC does not bind to SCAP, implying that 25-HC acts indirectly through a putative 25-HC sensor protein that elicits SCAP-Insig binding. As mentioned above, we suggested that OSBP is not involved in 25-HC-mediated regulation of cholesterol metabolism or SREBP processing. OSBP is the founding member of a superfamily that includes more than 10 OSBP-related proteins (ORPs) in mammalian genomes (Jaworski et al. 2001; Lehto et al. 2001). It is possible that the true 25-HC sensor is not OSBP but rather one of the other ORPs. Indeed, it was shown that like OSBP, ORP4-L binds 25-HC with high affinity and specificity (Wang et al. 2002). Alternatively, OSBP and a certain ORP(s) function as redundant acceptors of 25-HC-induced suppression of SREBP-regulated genes. Further knock down analyses are required to clarify these possibilities.

OSBP is evolutionarily conserved in various species including D. melanogaster and C. elegans (Alphey et al. 1998; Jaworski et al. 2001; Lehto et al. 2001; Fukuzawa & Williams 2002), neither of which possess the cholesterol biosynthesis pathway. This suggests that OSBP plays roles in fundamental cell function other than cholesterol metabolism in these lower organisms as well as in higher animals. Indeed, recent studies revealed that OSBP is involved in vesicle transport (Wyles et al. 2002) and signal transduction (Wang et al. 2005). Wyles et al. (2002) have shown that OSBP interacts with vesicle-associated membrane protein-associated protein-A (VAP-A), a syntaxin-like ER protein implicated in vesicle transport, and modifies vesicle export from the ER. It is possible that OSBP is involved in cholesterol metabolism indirectly by regulating sterol-containing vesicle transport between the ER and the Golgi apparatus. On the other hand, Wang et al. (2005) demonstrated that OSBP functions as a cholesterol binding scaffolding protein coordinating the activity of two phosphatases to control the extracellular signal-regulated kinase (ERK) signaling. According to their data, OSBP forms a complex with a member of the protein tyrosine phosphatase (PC12, Br7, Sl) family (PTPPBS, Augustine et al. 2000), the serine/threonine phosphatase PP2A and cholesterol. The complex disassembled and the level of phosphorylated ERK rises when cell cholesterol was lowered. ERK is known to phosphorylate SREBP-2, and the phosphorylation enhances the transcriptional activity of SREBP-2 (Kotzka et al. 2004). Thus, OSBP may be involved indirectly in regulation of cholesterol metabolism.

In conclusion, we demonstrated with the siRNA technique that OSBP is not directly involved in 25-HC-induced down-regulation of sterol-regulated genes. A major question that remains to be answered is what molecule(s) serve as a target of 25-HC in the SREBP processing in cells.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Reagents

25-hydroxycholesterol (25-HC), 22(R)-hydroxycholesterol (22R-HC), and {alpha}-palmitoyl-lysophosphatidylcholine (LPC) were purchased from Sigma (St. Louis, MO, USA). 7-ketocholesterol was from Steraloids, Inc. (Newport, RI, USA). 4HNE was from Cayman Chemical Co. (Ann Arbor, MI, USA). All chemicals were dissolved in ethanol, which was diluted with Dulbecco's modified Eagle medium (DMEM, Sigma) or endothelial cell growth factor-containing medium 2 (EGM-2; Clonetics, San Diego, CA, USA), resulting in a final ethanol concentration of 0.01%. Control cells received comparable volumes of ethanol. siRNAs were synthesized with a SilencerTM siRNA Construction Kit (Ambion, Austin, TX, USA). The OSBP-specific siRNA sequences were from positions 2369–2389 (siRNA1: 5'-aauacugggaguguaaagaaa-3'), 1810–1830 (siRNA2: 5'-aagacaggagacaaguguaau-3'), 358–378 (siRNA3: 5'-uacagaucaaaggcagaaaug-3'), 610–630 (siRNA4: 5'-aagacugagcugcagaauacc-3'), and 1270–1290 (siRNA5: 5'-aagaacugcauuggaaaagaa-3').

Preparation of polyclonal antibody

A peptide corresponding to the N-terminal domain of human OSBP (NH2-AATELRGVVGPGPA-COOH) was synthesized. The synthetic peptide plus an N-terminal cysteine was coupled to keyhole limpet hemocyanin, emulsified in Freund's adjuvant, and injected into the backs of two New Zealand white rabbits. The rabbit sera were used for immunoblotting and immunofluorescence in 1 : 4000 dilution.

Cell culture and transfection

HeLa cells were maintained in DMEM supplemented with 10% fetal calf serum and 100 units/mL penicillin, 100 mg/mL streptomycin, 2 mM L-glutamine. The resulting siRNAs were transfected into HeLa cells using LipofectAMINE 2000 reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer's protocol. The final concentration of siRNA was 10 nM. The cells were then incubated in the identical medium with 25-HC (6.2 µM) or solvent (ethanol) for 8 h before analysis. Human umbilical vein endothelial cells (HUVECs) were grown in EGM-2 with 2% fetal bovine serum (FBS) at 37 °C in a 5% CO2 atmosphere, and all experiments were conducted in 4 passages. The cells were cultured on plates coated with gel made of collagen types 1 (Iwaki, Tokyo, Japan). After 24 h, cells were washed and switched to EGM-2 with 0.5% FBS. After 16 h, 25-HC (0 or 10 µM) and/or LPC (0, 10, 20, 30 µM) were added and the cells were incubated for another 2 or 4 h.

Quantitative real-time PCR

Total RNA from cells was extracted using ISOGEN (Nippongene, Toyama, Japan) and reverse-transcribed using the SuperScript first-strand synthesis system for RT-PCR (Invitrogen). Oligonucleotide primers for PCR were designed using Primer Express Software (Applied Biosystems, Foster City, CA, USA). The sequences of the oligonucleotides used in PCR reaction were as follows. HMG-CoA reductase-forward acctttccagagcaagcacatt; HMG-CoA reductase-reverse aggacctaaaattgccattcca; squalene epoxidase-forward attcatcatgagtctccggaaag; squalene epoxidase-reverse ccatcacaacatcatcttcctctaa; LDLR-forward tttctgaaatcgccgtgttactg; LDLR-reverse acatcttcacgcgggagtct; GAPDH-forward gccaaggtcatccatgacaact; GAPDH-reverse gaggggccatccacagtctt. PCR reactions were performed using an ABI Prism 7000 sequence detection system (Applied Biosystems). The transcript number of human GAPDH was quantified, and each sample was normalized on the basis of GAPDH content.

Western blotting

HeLa cells were extracted and washed with ice-cold SET buffer (0.25 M sucrose, 1 mM EDTA, 10 mM Tris-HCl, pH 7.4) containing a protease inhibitor mixture. They were homogenized in SET buffer and then centrifuged at 1000 g for 20 min at 4 °C. The resultant supernatants were used as total protein lysate. The protein concentrations of samples were determined by BCA assay (Pierce, Rockford, IL, USA). Protein samples were separated by SDS-PAGE and transferred to nitrocellulose membranes using the Bio-Rad protein transfer system. The membranes were blocked with Tris-buffered saline containing 5% (w/v) skimmed milk and 0.05% (v/v) Tween 20, incubated with anti-OSBP polyclonal antibody, and then treated with anti-rabbit IgG-horseradish peroxidase. Proteins bound to the antibodies were visualized with an enhanced chemiluminescence kit (ECL, Amersham, Arlington Heights, IL, USA).

Immunofluorescence

HeLa cells and HUVECs were fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.5% Triton X-100 for 15 min, and then blocked with 3% bovine serum albumin in PBS for 30 min at room temperature. The cells were then incubated with the anti-OSBP polyclonal antibody and anti-p230 monoclonal antibody (BD Transduction Laboratories, Franklin Lakes, NJ, USA) overnight at 4 °C, washed 4 times with PBS, incubated again with an Alexa Fluor 488 goat anti-rabbit IgG (H + L) antibody and an Alexa Fluor 594 goat anti-mouse IgG(H + L) antibody, DAPI for 1 h at room temperature, washed thoroughly with PBS, embedded, and then visualized using a fluorescent microscope (LEICA DM IRE2).

Microarray analysis

An oligonucleotide microarray analysis was performed by using the GeneChip Human Genome Focus Array (Affymetrix Inc., Santa Clara, CA, USA). Fold change value was calculated as previously described (Takabe et al. 2004).


    Acknowledgements
 
We thank Dr. Shogo Yamamoto, Research Center for Advanced Science and Technology, University of Tokyo for his help of rearrangement of DNA microarray data.


    Footnotes
 
Communicated by: Kohei Miyazono

* Correspondence: E-mail: harai{at}mol.f.u-tokyo.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Adams, C.M., Reitz, J., De Brabander, J.K., et al. (2004) Cholesterol and 25-Hydroxycholesterol inhibit activation of SREBPs by different mechanisms, both involving SCAP and Insigs. J. Biol. Chem. 270, 52772–52780.

Alphey, L., Jimenez, J. & Glover, D. (1998) A drosophila homologue of oxysterol binding protein (OSBP)-implications for the role of OSBP. Biochim. Biophys. Acta 1395, 159–164.[Medline]

Augustine, K.A., Silbiger, S.M., Bucay, N., et al. (2000) Protein tyrosine phosphatase (PC12, Br7, Sl) family: expression characterization in the adult human and mouse. Anat. Rec. 258, 221–234.[CrossRef][Medline]

Bakos, J.T., Johnson, B.H. & Thompson, E.B. (1993) Oxysterol-induced cell death in human leukemic T-cells correlates with oxysterol binding protein occupancy and is independent of glucocorticoid-induced apoptosis. J. Steroid Biochem. Mol. Biol. 46, 415–426.[CrossRef][Medline]

Bjorkhem, I., Andersson, O., Diczfalusy, U., et al. (1994) Atherosclerosis and sterol 27-hydroxylase: evidence for a role of this enzyme in elimination of cholesterol from human macrophages. Proc. Natl. Acad. Sci. USA 91, 8592–8596.[Abstract/Free Full Text]

Brown, M.S. & Goldstein, J.L. (1974) Suppression of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity and inhibition of growth of human fibroblasts by 7-ketocholesterol. J. Biol. Chem. 249, 7306–7314.[Abstract/Free Full Text]

Brown, M.S. & Goldstein, J.L. (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331–340.[CrossRef][Medline]

Fukuzawa, M. & Williams, J.G. (2002) OSBPa, a predicted oxysterol binding protein of Dictyostelium, is required for regulated entry into culmination. FEBS Lett. 527, 37–42.[CrossRef][Medline]

Hanley, K., Ng, D.C., He, S.S., et al. (2000) Oxysterols induce differentiation in human keratinocytes and increase Ap-1-dependent involucrin transcription. J. Invest. Dermatol. 114, 545–553.[CrossRef][Medline]

Jaworski, C.J., Moreira, E., Li, A., Lee, R. & Rodriguez, I.R. (2001) A family of 12 human genes containing oxysterol-binding domains. Genomics 78, 185–196.[CrossRef][Medline]

Kandutsch, A.A. & Chen, H.W. (1974) Inhibition of sterol synthesis in cultured mouse cells by cholesterol derivatives oxygenated in the side chain. J. Biol. Chem. 249, 6057–6061.[Abstract/Free Full Text]

Kolsch, H., Lutjohann, D., Tulke, A., Bjorkhem, I. & Rao, M.L. (1999) The neurotoxic effect of 24-hydroxycholesterol on SH-SY5Y human neuroblastoma cells. Brain Res. 818, 171–175.[CrossRef][Medline]

Kotzka, J., Lehr, S., Roth, G., Avci, H., Knebel, B. & Muller-Wieland, D. (2004) Insulin-activated Erk-mitogen-activated protein kinases phosphorylate sterol regulatory element-binding protein-2 at serine residues 432 and 455 in vivo. J. Biol. Chem. 279, 22404–22411.[Abstract/Free Full Text]

Lagace, T.A., Byers, D.M., Cook, H.W. & Ridgway, N.D. (1997) Altered regulation of cholesterol and cholesteryl ester synthesis in Chinese-hamster ovary cells overexpressing the oxysterol-binding protein is dependent on the pleckstrin homology domain. Biochem. J. 326, 205–213.

Lehmann, J.M., Kliewer, S.A., Moore, L.B., et al. (1997) Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 272, 3137–3140.[Abstract/Free Full Text]

Lehto, M., Laitinen, S., Chinetti, G., et al. (2001) The OSBP-related protein family in humans. J. Lipid Res. 42, 1203–1213.[Abstract/Free Full Text]

Levine, T.P. & Munro, S. (1998) The pleckstrin homology domain of oxysterol-binding protein recognises a determinant specific to Golgi membranes. Curr. Biol. 8, 729–739.[CrossRef][Medline]

Morin, R.J. & Peng, S.K. (1989) The role of cholesterol oxidation products in the pathogens is of atherosclerosis. Ann. Clin. Lab. Sci. 19, 225–237.[Abstract]

Muir, L.V., Born, E., Mathur, S.N. & Field, F.J. (1996) Lysophosphatidylcholine increases 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene expression in CaCo-2 cells. Gastroenterology 110, 1068–1076.[CrossRef][Medline]

Peet, D.J., Turley, S.D., Ma, W., et al. (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693–704.[CrossRef][Medline]

Peng, S.K. & Morin, R.J. (1987) Effects on membrane function by cholesterol oxidation derivatives in cultured aortic smooth muscle cells. Artery 14, 85–99.[Medline]

Rawson, R.B. (2003) The SREBP pathway—insights from Insigs and insects. Nat. Rev. Mol. Cell. Biol. 4, 631–640.[CrossRef][Medline]

Ridgway, N.D. & Lagace, T.A. (1995) Brefeldin-A renders Chinese-hamster ovary cells insensitive to transcriptional suppression by 25-hydroxycholesterol. J. Biol. Chem. 270, 8023–8031.[Abstract/Free Full Text]

Ridgway, N.D., Dawson, P.A., Ho, Y.K., Brown, M.S. & Goldstein, J.L. (1992) Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding. J. Cell Biol. 116, 307–319.[Abstract/Free Full Text]

Ridgway, N.D., Lagace, T.A., Cook, H.W. & Byers, D.M. (1998) Differential effects of sphingomyelin hydrolysis and cholesterol transport on oxysterol-binding protein phosphorylation and Golgi localization. J. Biol. Chem. 273, 31621–31628.[Abstract/Free Full Text]

Rusinol, A.E., Yang, L., Thewke, D., Panini, S.R., Kramer, M.F. & Sinensky, M.S. (2000) Isolation of a somatic cell mutant resistant to the induction of apoptosis by oxidized low density lipoprotein. J. Biol. Chem. 275, 7296–7303.[Abstract/Free Full Text]

Storey, M.K., Byers, D.M., Cook, H.W. & Ridgway, N.D. (1998) Cholesterol regulates oxysterol binding protein (OSBP) phosphorylation and Golgi localization in Chinese hamster ovary cells: correlation with stimulation of sphingomyelin synthesis by 25-hydroxycholesterol. Biochem. J. 336, 247–256.

Takabe, W., Kanai, Y., Chairoungdua, A., et al. (2004) Lysophosphatidylcholine enhances cytokine production of endothelial cells via induction of L-Type amino acid transporter 1 and cell surface antigen 4F2. Arterioscler. Thromb. Vasc. Biol. 24, 1640–1645.[Abstract/Free Full Text]

Taylor, F.R., Saucier, S.E., Shown, E.P., Parish, E.J. & Kandutsch, A.A. (1984) Correlation between oxysterol binding to a cytosolic binding protein and potency in the repression of hydroxymethylglutaryl coenzyme A reductase. J. Biol. Chem. 259, 12382–12387.[Abstract/Free Full Text]

Thompson, E.B. & Ayala-Torres, S. (1999) Oxysterols and apoptosis: evidence for gene regulation outside the cholesterol pathway. Crit. Rev. Biochem. Mol. Biol. 34, 25–32.[CrossRef][Medline]

Wang, C., Jebailey, L. & Ridgway, N.D. (2002) Oxysterol-binding-protein (OSBP)-related protein 4 binds 25-hydroxycholesterol and interacts with vimentin intermediate filaments. Biochem. J. 361, 461–472.[CrossRef][Medline]

Wang, P.Y., Weng, J. & Anderson, R.G. (2005) OSBP is a cholesterol-regulated scaffolding protein in control of ERK1/2 activation. Science 307, 1472–1476.[Abstract/Free Full Text]

Wolf, G. (1999) The role of oxysterols in cholesterol homeostasis. Nutr. Rev. 57, 196–198.[Medline]

Wyles, J.P., McMaster, C.R. & Ridgway, N.D. (2002) Vesicle-associated membrane protein-associated protein-A (VAP-A) interacts with the oxysterol-binding protein to modify export from the endoplasmic reticulum. J. Biol. Chem. 277, 29908–29918.[Abstract/Free Full Text]

Received: 19 April 2005
Accepted: 5 May 2005




This article has been cited by other articles:


Home page
J. Virol.Home page
Y. Amako, A. Sarkeshik, H. Hotta, J. Yates III, and A. Siddiqui
Role of Oxysterol Binding Protein in Hepatitis C Virus infection
J. Virol., September 15, 2009; 83(18): 9237 - 9246.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Bowden and N. D. Ridgway
OSBP Negatively Regulates ABCA1 Protein Stability
J. Biol. Chem., June 27, 2008; 283(26): 18210 - 18217.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Yan, M. Lehto, L. Rasilainen, J. Metso, C. Ehnholm, S. Yla-Herttuala, M. Jauhiainen, and V. M. Olkkonen
Oxysterol Binding Protein Induces Upregulation of SREBP-1c and Enhances Hepatic Lipogenesis
Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 1108 - 1114.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. J. Perry and N. D. Ridgway
Oxysterol-binding Protein and Vesicle-associated Membrane Protein-associated Protein Are Required for Sterol-dependent Activation of the Ceramide Transport Protein
Mol. Biol. Cell, June 1, 2006; 17(6): 2604 - 2616.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishimura, T.
Right arrow Articles by Arai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishimura, T.
Right arrow Articles by Arai, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS