GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2006) 11, 83-93. doi:10.1111/j.1365-2443.2005.00914.x
© 2006 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiraishi, H.
Right arrow Articles by Komano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiraishi, H.
Right arrow Articles by Komano, H.

Reconstitution of {gamma}-secretase by truncated presenilin (PS) fragments revealed that PS C-terminal transmembrane domain is critical for formation of {gamma}-secretase complex

Hirohisa Shiraishi1,2,a, Toshihiro Marutani1, Hua-Qin Wang3, Yasuhiro Maeda4, Yukihisa Kurono4, Akihiko Takashima5, Wataru Araki6, Masaki Nishimura3, Katsuhiko Yanagisawa1 and Hiroto Komano1,*

1 Department of Alzheimer's Disease Research, National Institute for Longevity Sciences, 36-3 Gengo, Morioka, Obu, Aichi 474-8522, Japan
2 Organization for Pharmaceutical Safety and Research of Japan, Chiyoda-ku, Tokyo, Japan
3 Molecular Neuroscience Research Center, Shiga University of Medical Science, Otsu, Shiga 520-2192, Japan
4 Faculty of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi 467-8603, Japan
5 Brain Science Institute, RIKEN, Wako, Saitama 350-0198, Japan
6 Department of Demyelinating Disease and Aging, National Institute of Neuroscience, Tokyo 187-8502, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The presenilin (PS) complex, including PS, nicastrin (NCT), APH-1 and PEN-2, is essential for {gamma}-secretase activity. Previously, the PS C-terminal tail was shown to be essential for {gamma}-secretase activity. Here, to further understand the precise mechanism underlying the activation of {gamma}-secretase regulated by PS cofactors, we focused on the role of the PS1 C-terminal region including transmembrane domain (TM) 8 in {gamma}-secretase activity. For this purpose, we co-expressed C-terminally truncated PS1 (PS1{Delta}C) completely lacking {gamma}-secretase activity and the PS1 C-terminal short fragment in PS-null cells, because the successful reconstitution of {gamma}-secretase activity in PS-null cells by the co-expression of PS1{Delta}C and the PS1 C-terminal short fragment would allow us to investigate the role of the PS1 C-terminal region in {gamma}-secretase activity. We found that the exogenous expression of the PS1 C-terminal short fragment with NCT and APH-1 completely rescued a defect of the {gamma}-secretase activity of PS1{Delta}C in PS-null cells. With this reconstitution system, we demonstrate that both TM8 and the PS1 C-terminal seven-amino-acid-residue tail are involved in the formation of the active {gamma}-secretase complex via the assembly of PS1 with NCT and APH-1.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Amyloid ß-protein (Aß) is the major component of amyloid plaques that are a characteristic feature of the neuropathology of Alzheimer's disease (AD) (Selkoe 2001). Presenilin (PS1 and PS2) is an integral membrane protein that constitutes {gamma}-secretase complex, required for the intramembranous proteolytic cleavage of ß-amyloid precursor protein (APP) and the resulting production of Aß (for review, see Selkoe 2001). Aß has two major C-terminal variants, the Aß that ends at residue 40 (Aß40) and the Aß that ends at residue 42 (Aß42). Significantly, all AD-associated mutations in PS genes increase the relative production of Aß42 which is more amyloidogenic than Aß40, although the exact mechanism is not known (for review, see Selkoe 2001).

Recent accumulating evidence has also revealed that PS mediates not only {gamma}-secretase activity (De Strooper et al. 1998), but it is also required for several intramembranous cleavages, including the cleavages of notch, CD44, ErbB-4, alcadein (Araki et al. 2004) and cadherin (for review, see De Strooper 2003). These results suggest that PS-mediated intramembranous cleavage plays a critical role in several biological functions. PS has a putative eighth transmembrane domain (Li & Greenwald 1998), and full-length PS is endoproteolytically processed into two fragments, the N-terminal fragment (NTF) and the C-terminal fragment (CTF) between transmembrane domain (TM) 6 and TM7 (Thinakaran et al. 1996). The cellular level of processed PS is tightly limited (Ratovitski et al. 1997; Thinakaran et al. 1997), and the processed PS resides in a high-molecular-weight complex that includes mature glycosylated NCT, APH-1 and PEN-2 (for review, see De Strooper 2003). Several lines of evidence clearly established that NCT, APH-1 and PEN-2 (collectively named PS cofactors in this study) are required for PS endoproteolysis and the formation of the active {gamma}-secretase complex (Francis et al. 2002; Edbauer et al. 2003; Kimberly et al. 2003; Takasugi et al. 2003). However, it remains to be elucidated how PS cofactors regulate {gamma}-secretase activity and PS endoproteolysis.

PS contains two conserved, essential aspartate residues in adjacent TM6 and TM7 that may define a novel aspartyl protease active site (Wolfe et al. 1999; Steiner et al. 2000; Li et al. 2000b; Weihofen et al. 2002). However, the precise catalytic mechanism underlying the formation of the {gamma}-secretase complex, including the roles of TMs and PS cofactors in {gamma}-secretase activity, is not completely understood. Previously, it was shown that a short C-terminal tail of PS is required for PS endoproteolysis and/or {gamma}-secretase activity (Tomita et al. 1999; Shirotani et al. 2000). Here, to gain deep insights into the mechanism underlying the formation of active {gamma}-secretase, we focused on the role of the PS1 C-terminal region including TM8 in {gamma}-secretase activity. For this purpose, we co-expressed C-terminally truncated PS1 (PS1{Delta}C) completely lacking {gamma}-secretase activity and the PS1 C-terminal short fragment in PS-null cells. Previously, it was shown that the co-expression of PS1 NTF and CTF restored {gamma}-secretase activity in PS-null cells (Laudon et al. 2004; Shiraishi et al. 2004). However, it was not known whether the exogenous expression of PS1 C-terminal short fragment can rescue a defect in the {gamma}-secretase activity of PS1{Delta}C. In this study, we found that the exogenous expression of the PS1 C-terminal short fragment with NCT and APH-1 completely rescued a defect of the {gamma}-secretase activity of PS1{Delta}C in PS-null cells. With this reconstitution system, we demonstrate that both TM8 and the PS1 C-terminal seven-amino-acid-residue tail are involved in the formation of the active {gamma}-secretase complex via the assembly of PS1 with NCT and APH-1.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
To clarify the role of the PS1 C-terminal region including C-terminal TM8 in {gamma}-secretase activity, we constructed C-terminally truncated PS1 (PS1{Delta}C) and the PS1 C-terminal short fragment. As shown in Fig. 1A, PS1{Delta}C66 lacks PS1 C-terminal 66 amino acid residues including TM8, and PS1{Delta}C37, which was truncated downstream of TM8, lacks C-terminal 37 amino acid residues including the PALP sequence (Tomita et al. 2001). We also constructed cDNA encoding the PS1 C-terminal short fragment starting at methionine. C68 and C37 correspond to the fragments of the first methionine plus PS1 C-terminal 68 and 37 amino acid residues, respectively. PS1{Delta}C66 and PS1{Delta}C37 exhibited the complete loss of Aß generation and PS endoproteolysis in PS-null cells, as observed in the PS1 mutant with other short C-terminal truncations (Bergman et al. 2004) (Fig. 1B).


Figure 1
View larger version (36K):
[in this window]
[in a new window]
  		Figure 1  Schematic diagram of C-terminally truncated forms of PS1 (PS1{Delta}C) and PS1 C-terminal fragments expressed in (A) PS-null cells, and (B) a defect in Aß generation and endoproteolysis of PS1{Delta}C. (A) A schematic diagram of C-terminally truncated forms of PS1 used in this study is shown. The last 37 ({Delta}C37) or 66 ({Delta}C66) amino acid residues of PS1 were deleted. PS1 C-terminal fragments starting at Met (M) encoded by the cDNAs used in this study are also shown. C37, Met plus the PS1 C-terminal 37 amino acid residues; C68, Met plus the PS1 C-terminal 68 amino acid residues. Boxes with numbers illustrate putative transmembrane domains (TM). D1 and D2, two aspartates essential for {gamma}-secretase activity; PALP, the PALP sequence (56); FL, full-length; arrowhead, the site of endoproteolytic processing; number denotes the position of an amino acid residue at the C-terminus. (B) APP695 and the full-length (FL) PS1 or PS1{Delta}C were retrovirally expressed in PS-null cells (2 x 105); Aß40 and Aß42 secreted from cells during a 48-h culture were quantified by ELISA (the upper panel). u.d., Aß was not detected (< 10 pM). Values are means ± SD of two independent dishes (n = 2). CHAPSO-solubilized lysates (10 µg) were immunoblotted with the anti-PS1 NTF antibody (the middle panel). Soluble APP secreted from cells were immunoblotted with the anti-APP antibody, 22C11 (the bottom panel).

 
We first investigated whether the co-expression of PS1{Delta}C66 and PS1 cofactors restore Aß generation in PS-null cells (Fig. 2A, left 5 lanes). As shown in Fig. 2A (lanes 1–5), no Aß generation was observed, suggesting that PS1{Delta}C66 failed to form the active {gamma}-secretase complex with PS cofactors. However, the exogenous expression of C68 with the APH-1b and NCT completely rescued a defect in the {gamma}-secretase activity of PS1{Delta}C66, although the expression of C68 without PS cofactors did not affect {gamma}-secretase activity (Fig. 2A, lanes 6–8). The endogenous level of PEN-2 was found to be slightly increased in the co-expression of PS{Delta}C66, C68, APH-1b and NCT, but the endogenous level of PEN-2 was not as high as that of PS null cells expressing full-length PS (Fig. 2B). Therefore, the exogenous expression of PEN-2 was expected to further enhance the reconstituted {gamma}-secretase activity. However, a further increase in {gamma}-secretase activity was not observed when PEN-2 was additionally co-expressed with C68, APH-1b and NCT (Fig. 2A, lane 9). The limiting factors for {gamma}-secretase activity in this reconstitution system were found to be both APH-1 and NCT as shown in Fig. 2C. The rescue in a defect in PS1{Delta}C66 endoproteolysis was also observed by the co-expression of C68, APH-1b and NCT (Fig. 2A, lane 8), and PS1{Delta}C66 endoproteolysis was further stimulated by the expression of PEN-2 with C68, APH-1b and NCT (Fig. 2A, lane 9). Previously, the C-terminal short tail of PS was shown to be required for PS endoproteolysis and PS stabilization (Tomita et al. 1999; Shirotani et al. 2000). Therefore, we next investigated whether the expression of C68 lacking the last seven amino acid residues (C68{Delta}C7) with PS cofactors also rescues the defects in {gamma}-secretase activity and PS1{Delta}C66 endoproteolysis. The result showed that the co-expression of C68{Delta}C7 and PS cofactors did not restore {gamma}-secretase activity and endoproteolysis (Fig. 2A, lanes 10 and 11), indicating that the rescue by the co-expression of C68 and PS cofactors is completely dependent on the presence of the C-terminal seven-amino-acid-residue tail (Fig. 2, lanes 10 and 11). It was also noted that the extent of Aß generation from the reconstituted {gamma}-secretase induced by the co-expression of PS1{Delta}C66, C68 and PS cofactors was higher than that from the co-expression of PS1 FL and PS cofactors.


Figure 2
View larger version (41K):
[in this window]
[in a new window]
  		Figure 2  The expression of C68 with PS cofactors rescued defects in {gamma}-secretase activity and endoproteolysis of PS1{Delta}C66. (A) After APP695 and the indicated exogenous PS cofactors were retrovirally expressed with PS1{Delta}C66 and C68 or C68{Delta}C7 in PS-null cells, Aß secreted from these cells during a 48-h culture was quantified by ELISA, and CHAPSO-solubilized lysate (10 µg) was immunoblotted with the anti-PS1 NTF antibody (for the detection of PS1 FL, PS1{Delta}C66 and PS1 NTF), anti-PS1 loop monoclonal antibody (for the detection of PS1 CTF and CTF{Delta}C66), anti-APH-1b antibody, anti-FLAG antibody (for the detection of PEN-2), anti-NCT antibody and the anti-PS1C-20 antibody (for the detection of C68 or C68{Delta}C7). C-fragment, C-terminal short fragment; –, mock transfection (pMX). Values are means ± SD of two independent dishes (n = 2). Data are representative of three independent experiments. (B) The same lysates prepared from the PS-null cells retrovirally expressing the indicated truncated PS and PS cofactors as described in Figure 2A were immunoblotted with anti-PEN-2 antibody for the detection of endogenous PEN-2. (C) After APP695 and the indicated exogenous PS cofactors (–, mock transfection) were retrovirally expressed with PS1{Delta}C66 in PS-null cells, Aß secreted from these cells during a 48-h culture was quantified by ELISA. The Aß levels were expressed as relative to Aß40 levels obtained from PS-null cells expressing PS1{Delta}C66 with NCT and APH-1b.

 
To further investigate the effects of the co-expression of PS1{Delta}C66 and C68 on the assembly of the active {gamma}-secretase complex, we performed the co-immunoprecipitation experiment using an anti-PS1 NTF antibody (Fig. 3). As shown in Fig. 3A, APH-1b and NCT failed to co-immunoprecipitate with PS1{Delta}C66 (Fig. 3A, lanes 1–4), but they were co-immunoprecipitated when C68 was co-expressed (Fig. 3A, lanes 5 and 6); however, PEN-2 co-immunoprecipitated with PS1{Delta}C66 even when exogenous C68 was not expressed (Fig. 3, lanes 4 and 6). It is also noted that the level of mature NCT in the complex reconstituted with PS1{Delta}C66 and C68 was lower than that when PS1 FL with cofactors are expressed (Fig. 3, lanes 1 and 2; lanes 5 and 6). We also confirmed that C68 has the domain(s) for the binding of NCT and APH-1 by co-immunoprecipitation in the cells expressing C68 in the absence of the PS1{Delta}C66 (Supplementary Fig. S1).


Figure 3
View larger version (52K):
[in this window]
[in a new window]
  		Figure 3  The expression of C68 rescued a defect in the assembly of PS1{Delta}C66 with APH-1 and NCT. (A) After APP695 and the indicated exogenous PS cofactors were retrovirally expressed with PS1{Delta}C66 and C68 or C68{Delta}C7 in PS-null cells, CHAPSO-solubilized lysate (1 mg) was immunoprecipitated (IP) with the anti-PS1 NTF antibody (H-70) and then immunoblotted with the anti-PS1 NTF antibody (Chemicon International, Inc.), anti-APH-1b antibody, anti-FLAG antibody, anti-NCT antibody and anti-PS1C-20 antibody. n-IgG, normal IgG (control for the anti-PS1NTF antibody). (B) The CHAPSO-solubilized lysate (1 mg) used in lanes 6 and 8 of A was immunoprecipitated (IP) with the anti-NCT antibody and then immunoblotted with the anti-NCT antibody, anti-PS1C-20 antibody (for the detection of C68 or C68{Delta}C7) and the anti-PS1 NTF antibody. n-IgG, normal IgG (control for the anti-NCT antibody). Data are representative of two independent experiments.

 
In addition, when C68{Delta}C7 was expressed, no assembly of PS1{Delta}C66 with PS cofactors was observed (Fig. 3A, lanes 7 and 8). We also found that the level of C68{Delta}C7 bound to PS1{Delta}C66 was lower than that of C68 bound to PS1{Delta}C66 (Fig. 3A, bottom panel). The co-immunoprecipitation experiment using the anti-NCT antibody also demonstrated that the smaller amount of C68{Delta}C7 co-immunoprecipitates with NCT than that of C68 (Fig. 3B). This result indicates that the assembly of C68, not only with PS1{Delta}C66, but also with NCT, requires the presence of the C-terminal seven-amino-acid-residue tail. This result agrees with a result of a recent study showing that PS1 C-terminus binds to NCT (Kaether et al. 2004). Taken together, the rescue of the defects in {gamma}-secretase activity and PS1{Delta}C66 endoproteolysis by the expression of C68 with PS cofactors is accompanied by the rescue of a defect in the assembly of PS1{Delta}C66 with APH-1b and NCT.

We next determined the role of TM8 in {gamma}-secretase activity with this reconstitution system of {gamma}-secretase activity. For this purpose, we co-expressed PS1{Delta}C66 and C37 that lacks TM8 in PS-null cells (Figs 1A and 4A). As shown in Fig. 4A, the co-expression of C37 and PS cofactors did not rescue the defects in {gamma}-secretase activity and PS1{Delta}C66 endoproteolysis. This result suggests that the TM8 region of C68 is necessary for the functional rescue of inactive PS1{Delta}C66. However, we cannot exclude the possibility that C37 does not have an ability to rescue a defect in {gamma}-secretase activity. Therefore, we next determined whether C37 has an ability to rescue inactive PS1{Delta}C, or whether TM8 is necessary for the functional rescue of inactive PS1{Delta}C in PS-null cells. For this purpose, we investigated whether the co-expression of C37 and PS1{Delta}C37 truncated downstream of TM8 (Figs 1A and 4B) restores {gamma}-secretase activity in PS-null cells. As shown in Fig. 4B, the defects in {gamma}-secretase activity and PS1{Delta}C37 endoproteolysis were completely rescued by the expression of C37 with APH-1b and NCT, although they were not rescued by the expression of exogenous PS cofactors without C37 (Fig. 4B, lanes 2–9). These results indicate that TM8 is necessary for the rescue of {gamma}-secretase activity and PS1 endoproteolysis by the co-expression of PS1{Delta}C and the PS1 C-terminal fragment with PS cofactors in PS-null cells. The rescue by the co-expression of C37 and PS cofactors was also completely dependent on the presence of the C-terminal seven-amino-acid-residue tail (Fig. 4, lanes 10 and 11). It is also noted that the level of C37 is higher when APH-1 and NCT were co-expresssed, compared with that when APH-1 was not expressed (Fig. 4A, lanes 2–5 and Fig. 4B, lanes 6–9). Thus, APH-1 is likely to stabilize the C37 fragment, although, at present, the exact reason for this is not known. We next determined whether TM8 is involved in the assembly of the active {gamma}-secretase complex. As shown in Fig. 5, APH-1b and NCT were co-immunoprecipitated using the anti-PS1 NTF antibody when PS1{Delta}C37 and C37 were co-expressed, although the anti-PS1 antibody did not co-immunoprecipitate APH-1b and NCT when PS1{Delta}C66 and C37 were co-expressed. PEN-2 was also co-immunoprecipitated in both cases (Fig. 5, lanes 2 and 4). Interestingly, C37 was also co-immunoprecipitated with PS1{Delta}C37, PS1 CTF{Delta}C37, NCT, APH-1, and PEN-2, indicating that all truncated PS fragments, including CTF{Delta}C37, constitute the active {gamma}-secretase complex (Fig. 5). These results indicate that TM8 is involved in the PS1 complex assembly with NCT and APH-1b, and in PS endoproteolysis. Although C68 has the domain(s) for the binding of NCT and APH-1 (Supplementary Fig. S1), at present, we failed to determine by co-immunoprecipitaiton whether C37 has such domains, because C37 was unstable in the absence of PS1{Delta}C37 (data not shown). However, a previous study using a chimeric protein of CD4 TM domain followed by PS1 C-terminal fragment corresponding to the exact C37 region in our study (Kaether et al. 2004), strongly suggested that the C37 region has the domain(s) for the binding of NCT and APH-1. All results are summarized in Table 1.


Figure 4
View larger version (50K):
[in this window]
[in a new window]
  		Figure 4  The rescue of a defect in {gamma}-secretase activty of PS1{Delta}C by the expression of PS1 C-terminal fragment with PS cofactors requires the PS1 TM8 region. After APP695 and the indicated exogenous PS cofactors were retrovirally expressed with (A) PS1{Delta}C66 and C37 or (B) PS1{Delta}C37 and C37 in PS null cells, Aß secreted from these cells during a 48-h culture was quantified by ELISA, and CHAPSO-solubilized lysate (10 µg) was immunoblotted with the anti-PS1 NTF antibody (for detection of PS1 FL and PS1 {Delta}C37), anti-PS1 loop antibody (for detection of PS1 CTF and PS1 CTF{Delta}C37), anti-APH-1b antibody, anti-FLAG antibody (for the detection of PEN-2), and the PS-C3 antibody (for detection of C37; note: this antibody does not immunoreact with C37{Delta}C7). –, mock transfection (pMX). Values are means ± SD of two independent dishes (n = 2). Data are representative of three independent experiments. The difference in Aß level from PS1 FL between A and B is due to the difference in virus titer used for transfection.

 

Figure 5
View larger version (40K):
[in this window]
[in a new window]
  		Figure 5  The assembly of the {gamma}-secretase complex requires the PS1 TM8 region. After APP695 and the indicated exogenous PS cofactors were retrovirally expressed with PS1{Delta}C66 and C37 or with PS1{Delta}C37 and C37 in PS-null cells, CHAPSO-solubilized lysate (1 mg) was immunoprecipitated (IP) with the anti-PS1 NTF antibody (H-70) and then immunoblotted (IB) with the anti-PS1 NTF antibody (Chemicon International, Inc.; for detection of PS1{Delta}C37, PS1{Delta}C66 and PS1 NTF), anti-PS1 loop monoclonal antibody (for detection of PS1 CTF{Delta}C37), anti-APH-1b antibody, anti-FLAG antibody, anti-NCT antibody and PS-C3 antibody (for detection of C37). CHAPSO-solubilized lysate (10 µg) was also immunoblotted with the same antibodies (the bottom four panels). Data are representative of two independent experiments. Note: PS1 NTF and PS1 CTF{Delta}C66 in lanes 1 and 2 were not detected, because the expression of PS1{Delta}C66 with C37 and PS cofactors did not cause the endoproteolysis of PS1{Delta}C66.

 

View this table:
[in this window]
[in a new window]
  		Table 1 Summary of functional rescue of C68 and C37 for inactive PS1{Delta}C in PS-null cells
 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
Although several lines of evidence have established the notion that PEN-2, APH-1 and NCT, in addition to PS, are required for the formation of the active {gamma}-secretase complex (Francis et al. 2002; Edbauer et al. 2003; Kimberly et al. 2003; Takasugi et al. 2003), it remains unclarified how these three PS cofactors activate {gamma}-secretase. To gain deep insights into the mechanism underlying the formation of the active {gamma}-secretase complex, we reconstituted {gamma}-secretase activity in PS-null cells by the co-expression of C-terminal truncated PS1 and the PS1 C-terminal short fragment. Using this reconstitution system, we found that both PS1 TM8 and the PS1 C-terminal last seven-amino-acid-residue tail are critical for {gamma}-secretase activity and the assembly of the PS1 complex with APH-1 and NCT.

The PS C-terminal tail includes a hydrophobic stretch, which is a potential domain for the interaction with some proteins such as PDZ-domain-containing proteins (Saras et al. 1997; Tomita et al. 1999). Previously, it was pointed out that the PS C-terminal tail is important for PS endoproteolysis and PS stabilization (Tomita et al. 1999; Shirotani et al. 2000). Recently, it has also been shown that a short deletion of the C-terminal region from PS1 causes marked impairments in PS1 endoproteolysis and {gamma}-secretase activity in PS-null cells (Bergman et al. 2004), indicating that the PS1 C-terminal region is critical for {gamma}-secretase activity. However, it is not precisely known whether the PS C-terminal region is a functional domain for the formation of active {gamma}-secretase or whether a short deletion at the C-terminus causes a conformational change leading to a loss of {gamma}-secretase activity. The successful reconstitution of {gamma}-secretase activity in PS-null cells by the co-expression of C-terminally truncated PS1 and the PS1 C-terminal short fragment demonstrated that the PS1 C-terminal region has a distinct functional domain for the formation of active {gamma}-secretase, and enabled us to investigate its role in {gamma}-secretase activity.

PS1{Delta}C66 has two aspartate residues in TM6 and TM7, which are essential for {gamma}-secretase activity, but PS1{Delta}C66 lacks the entire C-terminal region, including TM8 and the region immediately downstream from TM8. PS1{Delta}C66 exhibited the complete loss of {gamma}-secretase activity and endoproteolysis in PS-null cells; however, we found that the exogenous expression of a C-terminal fragment starting from TM8, that is, C68, completely rescued these defects when APH-1 and NCT were co-expressed. The limiting factors for {gamma}-secretase activity in this reconstitution system were found to be APH-1 and NCT, not PEN-2 (Fig. 2C), and the restored endogenous expression level of PEN-2 is sufficient to reconstitute the {gamma}-secretase activity of inactive PS1{Delta}C66. Indeed, this interpretation was supported by our result showing that PS1{Delta}C66 had a marked defect in the binding of NCT and APH-1, but PS1{Delta}C66 did not have a significant defect in the binding of PEN-2. In addition, the rescue of {gamma}-secretase activity was completely accompanied by a rescue of the defect in the assembly of PS1{Delta}C66 with APH-1 and NCT. It was also noted that these rescues were completely dependent on the presence of the C-terminal last seven-amino-acid-residue tail of C68. This result is completely consistent with the previous result showing that the extreme C-terminus of PS1 is essential for the assembly of active {gamma}-secretase (Bergman et al. 2004). From these results, we concluded that the active {gamma}-secretase complex is reconstituted by the exogenous co-expression of PS1{Delta}C66, C68 and PS cofactors APH-1 and NCT.

Recently, it has been shown that the PS1 C-terminus is involved in the interaction with NCT and APH-1 (Bergman et al. 2004). We also showed that the association of C68{Delta}C7 with PS1{Delta}C66 and NCT was lower than that of C68 (Fig. 3B). Therefore, the failure of C68 lacking the C-terminal seven-amino acid residues (C68{Delta}C7) to rescue the formation of the active {gamma}-secretase complex was likely to be caused by the lower association of C68{Delta}C7 with PS1{Delta}C66 and NCT, and possibly with APH-1, than that of C68 (Fig. 3B).

PS endoproteolysis is not always associated with {gamma}-secretase activity, because mutant PS1 {Delta}exon 9 is not endocleaved (Thinakaran et al. 1996). However, this mutant PS1 has {gamma}-secretase activity (Wolfe et al. 1999). Therefore, the necessity of PS endoproteolysis for {gamma}-secretase activity has not been firmly established. Our result also showed that the reconstituted {gamma}-secretase activity induced by the truncated PS fragments is not associated with the extent of PS endoproteolysis although the stimulation of PS{Delta}C endoproteolysis by the expression of exogenous PEN-2 was observed in this reconstitution system (Figs 2A, 3A, and 4B). In addition, the reconstituted {gamma}-secretase activity by the truncated PS fragments was dependent on APH-1 level, while {gamma}-secretase activity from FL PS1 is not dependent on the APH-1 level (Supplementary Fig. S2). At present, we do not know the exact reason for the difference in the exogenous PS cofactors required for the stimulation of {gamma}-secretase activity between the expression of PS FL and that of the truncated PS fragments. One possible explanation is that PS FL requires PS endoproteolysis for the conformational change from an inactive form to an active form, and this step is the limiting step for the activation of PS FL; however, the truncated PS fragments might not require PS endoproteolysis for forming the active complex, probably because the complex of the truncated PS fragments has a lower structural integrity than that of the PS FL. Instead, the truncated PS fragments required APH-1 and NCT rather than the stimulation of PS endoproteolysis by PEN-2 expression for the proper conformation and/or the proper trafficking of the complex for reconstituted {gamma}-secretase activity. The difference in the structural integrity could also generate the difference in {gamma}-secretase activity between the PS complex and the complex reconstituted by the truncated PS fragments, as observed in this study.

As previously reported (Herreman et al. 2003; Nyabi et al. 2003), the maturation of NCT is separable from {gamma}-secretase activity, strongly suggesting that the difference in the extent of maturation of NCT in the PS complex does not affect {gamma}-secretase activity. Indeed, our result showed that the {gamma}-secretase activity reconstituted with PS1{Delta}C66 and C68 was not associated with the full maturation of NCT. Although, at present, the exact mechanism for the poor maturation of NCT in the reconstituted truncated PS complex is unknown, we speculate that the intracellular site, where the assembly of truncated PS fragments with PS cofactors occurs, may be slightly different from the case of wild-type (wt) PS, because PS that lacks the C-terminal portion does not reside in the ER as previously reported (Kaether et al. 2004), whereas full-length PS resides in the ER. The assembly of full-length wt PS with PS cofactors is likely to occur in the ER (Capell et al. 2005; Niimura et al. 2005), which is followed by the transport of the complex into the Golgi compartment, where the terminal sugar modification of NCT occurs. However, if the truncated PS fragments and the over-expressed immature NCT exist in the distal/post-Golgi compartment, they form the active {gamma}-secretase complex; the gylcosylation of NCT in the complex could be less than that in the wt PS complex.

To determine whether the TM8 of C68 is required for the rescue of a defect in the {gamma}-secretase activity of PS1{Delta}C66, we investigated whether the C37 fragment, which is immediately downstream of TM8 and therefore lacks TM8, can similarly rescue a defect in the {gamma}-secretase activity of PS1{Delta}C66. The result showed a failure of the rescue; however, the expression of C37 with APH-1 and NCT rescued a defect in the {gamma}-secretase activity of PS1{Delta}C37 that has TM8, but lacks the C-terminal region immediately downstream of TM8. These results clearly demonstrate that TM8 is involved in the formation of an active {gamma}-secretase. Indeed, C37 expression did not rescue a defect in the assembly of PS1{Delta}C66 with NCT and APH-1, but it significantly rescued a defect in the assembly of PS1{Delta}C37 with NCT and APH-1, indicating that TM8 is involved in the assembly of PS1{Delta}C37 with NCT and APH-1. Thus, we concluded that TM8 is also required for the formation of an active PS1 complex with NCT and APH-1 (Table 1).

Previously, it was shown that the TM of NCT is involved in the assembly of an active {gamma}-secretase complex, and that the cytoplasmic domain of NCT is dispensable for {gamma}-secretase complex formation (Capell et al. 2003). It was also shown that the GXXXG motif in the TM of APH-1 is critical for the assembly of the {gamma}-secretase complex (Lee et al. 2004), strongly suggesting that the TM of APH-1 is involved in the assembly of this complex. Taken together with our results, the TM8 of PS1 is likely to interact with NCT or APH-1 or both through their transmembrane. In addition, our data also demonstrate that the PS1 C-terminal seven-amino-acid-residue tail is critical for the assembly of the {gamma}-secretase complex in the reconstitution system (Table 1). A previous study has shown that the PS1 C-terminus probably binds to the TM of NCT (Kaether et al. 2004). Therefore, both the C-terminus and PS1 TM8 appear to bind to the TM of NCT. Although C68 and C37 are likely to have the domains for the interaction of NCT and APH-1 (Supplementary Fig. S1; Kaether et al. 2004), how the TM8 in concert with C-terminus interact with NCT and APH-1 to form the active PS complex remains to be determined in future studies. The formation of an intermediate subcomplex of APH-1 and NCT as previously shown (LaVoie et al. 2003) also could be a prerequisite for the interaction of PS TM8 and the C-terminus with APH-1/NCT.

Because the proposed catalytic aspartate residues are embedded in TM6 and TM7, it remains to be clarified how hydrolysis that is required for {gamma}-secretase activity occurs within the hydrophobic environment. Interestingly, recent studies have shown the possibility that PS has a ninth TM in the C-terminal region (Henricson et al. 2005; Laudon et al. 2005). If this is the case, the C37 in our study is supposed to harbor the novel TM9. Although, at present, the precise roles of the TM8 and possibly also TM9 are unknown, one possible role is that the C-terminal TM(s) contribute to the formation of the catalytic space between TM6 and TM7 within the hydrophobic environment of the lipid bilayer, because these TM(s) are found to be necessary for {gamma}-secretase activity and the association with APH-1/NCT, that are the essential cofactors for {gamma}-secretase activity.

In this study, we established the reconstitution of {gamma}-secretase activity by truncated PS fragments and PS cofactors. With this reconstitution system, we demonstrated that both PS1 TM8 and the PS1 C-terminal last-seven-amino-acid-residue tail are critical for {gamma}-secretase activity and the assembly of the PS1 complex with APH-1 and NCT. More precise studies of how TM8 and the C-terminal tail are involved in the assembly of the {gamma}-secretase complex may help clarify the regulation of {gamma}-secretase activity.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Antibodies, reagents and cell lines

The monoclonal antibody 6E10 specific to human Aß1-17 was purchased from Senetek (St. Louis, MO, USA). The other Aß antibodies have all been characterized previously (Asami-Odaka et al. 1995). The anti-APP N-terminal antibody 22C11 was purchased from Sigma (St. Louis, MO, USA). A rat anti-PS1 antibody (for NTF of PS1) and a mouse anti-PS1 loop monoclonal antibody were purchased from Chemicon International, Inc. (Temecula, CA, USA). A goat anti-PS1 C-20 antibody (for PS1 C-terminal 20 amino acid residues) and a rabbit anti-PS1 H-70 antibody (for PS1 N-terminal 70 amino acid residues) were purchased from Santa Cruz Biotechnology, Inc. A rabbit PS-C3 antibody was prepared against the synthetic peptide corresponding to the C-terminal 15 amino acid residues of PS1. An anti-FLAG antibody was purchased from Sigma. A rabbit anti-human APH-1b antibody was prepared against the synthetic peptide corresponding to the C-terminal 17 amino acid residues of APH-1b. An anti-nicastrin antibody was purchased from Sigma. A rabbit anti-PEN-2 antibody (for the detection of the endogenous PEN-2) was purchased from Zymed Laboratory Inc. PS1/PS2 double-deficient murine fibroblasts (PS-null cells) and wild-type murine fibroblasts immortalized with a large T antigen were maintained as previously described (Herreman et al. 2000; Sai et al. 2002).

Plasmids and retrovirus-mediated gene expression

cDNAs encoding PS1{Delta}C were generated from pMX-PS1 by the PCR method. The primer sequences used for the PCR were as follows: a sense primer: 5'-TGCAGAATTCATGACAGAGTTACCTGCA-3'; and anti-sense primers: 5'-CATGCTCGAGTCATTTCTTGAAAATGGCAAGGAG-3' (PS1C{Delta}37: the last 37 amino acids deletion), and 5'-CATGCTCGAGTCAACTGGCTGTTGCTGAGGCTTT-3' (PS1{Delta}C66: the last 66 amino acids deletion). The PCR products were digested with EcoRI and XhoI inserted into pMX (Onishi et al. 1996). cDNA encoding PS1 C-terminal 37 (C37: residues 431–467) or 68 (C68: residues 400–467) amino acid residues starting at Met, which was added by the EcoRI site followed by Kozak consensus sequence at the 5' end and the XhoI site at the 3' end was generated by the PCR method using the following primers: sense primers, 5'-TGCAGAATTCCACCATGGCATTGCCAGCTCTTCCA-3' (C37) and 5'-TGCAGAATTCCACCATGGCCAGTGGAGACTGGAAC-3' (C68); and an anti-sense primer, 5'-CATGCTCGAGCTAGATATAAAATTGATGG-3'. The resultant cDNAs were inserted into pMX at EcoRI and XhoI. cDNAs encoding C37{Delta}C7 and C68{Delta}C7 were generated by the PCR method using the following primers: a sense primer for C37 or C68; and an anti-sense primer: 5'-CATGCTCGAGCTATAATTGGTCCATAAAAGGCTG-3'. The resultant cDNAs were inserted into pMX at EcoRI and XhoI.

pMX-F-PEN-2 is a BamHI-SalI fragment carrying the sequence encoding the N-terminal FLAG-tagged PEN-2 and Kozak consensus sequence (CCACC) at the 5' end of FLAG-PEN-2 inserted into the BamHI and SalI sites of pMX as previously described (Shiraishi et al. 2004). pMX-NCT, pMX-PS1, and pMX-APP695 were constructed as previously described (Komano et al. 2002). APH-1b (Francis et al. 2002) was generated from the cDNA library prepared from HEK293 cells using a sense primer, GCGAATTCTTTCCGCGGTGGCCATGACT and anti-sense primer, GCAGATCTGAAGTGCTGGTTCCCTGAGG. The PCR product was digested with EcoRI and inserted into pMX at the EcoRI site.

All resulting constructs were verified by DNA sequencing. Retrovirus-mediated gene expression in cells was carried out as previously reported (Onishi et al. 1996; Komano et al. 2002). The infection efficiency was nearly 100% in this study, as estimated in a control experiment using pMX-GFP (retroviral vector carrying GFP).

Aß detection and co-immunoprecipitation techniques

Aß level was determined by ELISA as previously described (Asami-Odaka et al. 1995). The capture antibody used was BNT77. The detector antibodies used were horseradish peroxidase (HRP)-conjugated BA27 (for Aß40) and HRP-conjugated BC05 (for Aß42). ELISA data were statistically analyzed by ANOVA using StatView-J.4.11 (Abacus Concepts, Inc., Berkeley, CA, USA). Cultured cells were lyzed in 1% CHAPSO buffer [1% CHAPSO, 150 mM NaCl, 10 mM Tris/HCl (pH 7.5), 2 mM EDTA, a protease inhibitor cocktail]. CHAPSO-solubilized proteins were co-immunoprecipitated with PS1 by incubating with the anti-PS1 NTF antibody and 100 µL of 20% protein-G Sepharose (Pharmacia) slurry with rotation at 4 °C overnight, as previously described (Sudoh et al. 1998; Li et al. 2000a). The immunoprecipitates were solubilized in SDS sample buffer (0.0625 M Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, and 8 M urea) and subjected to SDS-PAGE.


   Acknowledgements
 
This study was supported by the Program for the Promotion of Fundamental Studies in Health Sciences of the Organization for Pharmaceutical Safety and Research; by a Grant-in-Aid for Scientific Research on Priority Areas (C)-Advanced Brain Science Project (to K.Y.); by a Grant-in-Aid 15659023 and 16390029 from the Ministry of Education, Culture, Sports, Sciences and Technology; by a grant from the Takeda Medical Research Foundation; by a Grant for Dementia and Bone Fracture from the Ministry of Health, Labor and Welfare, Japan. We thank Dr B. De Strooper (Katholieke Universiteit Leuven and Flanders Interuniversity, Herestraat, Belgium) for providing PS1/PS2 double-deficient fibroblasts and wild-type fibroblasts.


   Footnotes
 
Communicated by: Yoshinori Ohsumi

aPresent address: Department of Physiology & Biophysics, Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033, USA. Back

* Correspondence: E-mail: hkomano{at}nils.go.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Araki, Y., Miyagi, N., Kato, N., et al. (2004) Coordinated metabolism of Alcadein and amyloid ß-protein precursor regulates FE65-dependent gene transactivation. J. Biol. Chem. 279, 24343–24354.[Abstract/Free Full Text]

Asami-Odaka, A., Ishibashi, Y., Kikuchi, T., Kitada, C. & Suzuki, N. (1995) Long amyloid ß-protein secreted from wild-type human neuroblastoma IMR-32 cells. Biochemistry 34, 10272–10278.[CrossRef][Medline]

Bergman, A., Laudon, H., Winblad, B., Lundkvist, J. & Naslund, J. (2004) The extreme C terminus of presenilin 1 is essential for {gamma}-secretase complex assembly and activity. J.Biol. Chem. 279, 45564–45572.[Abstract/Free Full Text]

Capell, A., Beher, D., Prokop, S., et al. (2005) {gamma}-secretase complex assembly within the early secretory pathway. J. Biol. Chem. 280, 6471–6478.[Abstract/Free Full Text]

Capell, A., Kaether, C., Edbauer, D., et al. (2003) Nicastrin interacts with {gamma}-secretase complex components via the N-terminal part of its transmembrane domain. J. Biol. Chem. 278, 52519–52523.[Abstract/Free Full Text]

Strooper, B. (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active {gamma}-Secretase complex. Neuron 38, 9–12.[CrossRef][Medline]

Strooper, B., Saftig, P., Craessaerts, K., et al. (1998) Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391, 387–390.[CrossRef][Medline]

Edbauer, D., Winkler, E., Regula, J.T., Pesold, B., Steiner, H. & Haass, C. (2003) Reconstitution of {gamma}-secretase activity. Nature Cell Biol. 5, 486–488.[CrossRef][Medline]

Francis, R., McGrath, G., Zhang, J., et al. (2002) aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev. Cell 3, 85–97.[CrossRef][Medline]

Henricson, A., Kall, L. & Sonnhammer, E.L. (2005) A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence. FEBS J. 272, 2727–2737.[CrossRef][Medline]

Herreman, A., Serneels, L., Annaert, W., Collen, D., Schoonjans, L. & Strooper, B. (2000) Total inactivation of {gamma}-secretase activity in presenilin-deficient embryonic stem cells. Nature Cell Biol. 2, 461–462.[CrossRef][Medline]

Herreman, A., Gassen, G., Bentahir, M., et al. (2003) {gamma}-Secretase activity requires the presenilin-dependent trafficking of nicastrin through the Golgi apparatus but not its complex glycosylation. J. Cell Sci. 116, 1127–1136.[Abstract/Free Full Text]

Kaether, C., Capell, A., Edbauer, D., et al. (2004) The presenilin C-terminus is required for ER-retention, nicastrin-binding and gamma-secretase activity. EMBO J. 23, 4738–4748.[CrossRef][Medline]

Kimberly, W.T., LaVoie, M.J., Ostaszewski, B.L., Ye, W., Wolfe, M.S. & Selkoe, D.J. (2003) {gamma}-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proc. Natl. Acad. Sci. USA 100, 6382–6387.[Abstract/Free Full Text]

Komano, H., Shiraishi, H., Kawamura, Y., et al. (2002) A new functional screening system for identification of regulators for the generation of amyloid ß-protein. J. Biol. Chem. 277, 39627–39633.[Abstract/Free Full Text]

Laudon, H., Hassson, E.M., Melen, K., et al. (2005) A nine transmembrane domain topology for presenilin 1. J. Biol. Chem. 280, 35352–35360.[Abstract/Free Full Text]

Laudon, H., Mathews, P.M., Karlstrom, H., et al. (2004) Co-expressed presenilin 1 NTF and CTF form functional {gamma}-secretase complexes in cells devoid of full-length protein. J. Neurochem. 89, 44–53.[CrossRef][Medline]

LaVoie, M.J., Fraering, P.C., Ostaszewski, B.L., et al. (2003) Assembly of the {gamma}-secretase complex involves early formation of an intermediate subcomplex of Aph-1 and nicastrin. J. Biol. Chem. 278, 37213–37222.[Abstract/Free Full Text]

Lee, S.F., Shah, S., Yu, C., et al. (2004) A conserved GXXXG motif in APH-1 is critical for assembly and activity of the {gamma}-secretase complex. J. Biol. Chem. 279, 4144–4152.[Abstract/Free Full Text]

Li, X. & Greenwald, I. (1998) Additional evidence for an eight-transmembrane-domain topology for Caenorhabditis elegans and human presenilins. Proc. Natl. Acad. Sci. USA 95, 7109–7114.[Abstract/Free Full Text]

Li, Y.M., Lai, M.T., Xu, M., et al. (2000a) Presenilin 1 is linked with {gamma}-secretase activity in the detergent solubilized state. Proc. Natl. Acad. Sci. USA 97, 6138–6143.[Abstract/Free Full Text]

Li, Y.M., Xu, M., Lai, M.T., et al. (2000b) Photoactivated {gamma}-secretase inhibitors directed to the active site covalently label presenilin 1. Nature 405, 689–694.[CrossRef][Medline]

Niimura, M., Isoo, N., Takasugi, N., et al. (2005) Aph-1 contributes to the stabilization and trafficking of the {gamma}-secretase complex through mechanisms involving inter–and intramolecular interactions. J. Biol. Chem. 280, 12967–12975.[Abstract/Free Full Text]

Nyabi, O., Bentahir, M., Horre, K., et al. (2003) Presenilins mutated at Asp-257 or Asp-385 restore Pen-2 expression and Nicastrin glycosylation but remain catalytically inactive in the absence of wild type Presenilin. J. Biol. Chem. 278, 43430–43436.[Abstract/Free Full Text]

Onishi, M., Kinoshita, S., Morikawa, Y., et al. (1996) Applications of retrovirus-mediated expression cloning. Exp. Hematol. 24, 324–329.[Medline]

Ratovitski, T., Slunt, H.H., Thinakaran, G., Price, D.L., Sisodia, S.S. & Borchelt, D.R. (1997) Endoproteolytic processing and stabilization of wild-type and mutant presenilin. J. Biol. Chem. 272, 24536–24541.[Abstract/Free Full Text]

Sai, X., Kawamura, Y., Kokame, K., et al. (2002) Endoplasmic reticulum stess-inducible protein, Herp, enhances presenilin-mediated generation of amyloid ß-protein. J. Biol. Chem. 277, 12915–12920.[Abstract/Free Full Text]

Saras, J., Engstrom, U., Gonez, L.J. & Heldin, C.H. (1997) Characterization of the interactions between PDZ domains of the protein-tyrosine phosphatase PTPL1 and the carboxyl-terminal tail of Fas. J. Biol. Chem. 272, 20979–20981.[Abstract/Free Full Text]

Selkoe, D.J. (2001) Alzheimer's disease: genes, proteins, and therapy. Physiol. Rev. 81, 741–766.[Abstract/Free Full Text]

Shiraishi, H., Sai, X., Wang, H.Q., et al. (2004) PEN-2 enhances gamma-cleavage after presenilin heterodimer formation. J. Neurochem. 90, 1402–1413.[CrossRef][Medline]

Shirotani, K., Takahashi, K., Araki, W., Maruyama, K. & Tabira, T. (2000) Mutational analysis of intrinsic regions of presenilin 2 that determine its endoproteolytic cleavage and pathological function. J. Biol. Chem. 275, 3681–3686.[Abstract/Free Full Text]

Steiner, H., Kostka, M., Romig, H., et al. (2000) Glycine 384 is required for presenilin-1 function and is conserved in bacterial polytopic aspartyl proteases. Nature Cell Biol. 2, 848–851.[CrossRef][Medline]

Sudoh, S., Kawamura, Y., Sato, S., et al. (1998) Presenilin 1 mutations linked to familial Alzheimer's disease increase the intracellular levels of amyloid ß-protein 1–42 and its N-terminally truncated variant(s) which are generated at distinct sites. J. Neurochem. 71, 1535–1543.[Medline]

Takasugi, N., Tomita, T., Hayashi, I., et al. (2003) The role of presenilin cofactors in the {gamma}-secretase complex. Nature 422, 438–441.[CrossRef][Medline]

Thinakaran, G., Borchelt, D.R., Lee, M.K., et al. (1996) Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17, 181–190.[CrossRef][Medline]

Thinakaran, G., Harris, C.L., Ratovitski, T., et al. (1997) Evidence that levels of presenilins (PS1 and PS2) are coordinately regulated by competition for limiting cellular factors. J. Biol. Chem. 272, 28415–28422.[Abstract/Free Full Text]

Tomita, T., Takikawa, R., Koyama, A., et al. (1999) C terminus of presenilin is required for overproduction of amyloidogenic Aß42 through stabilization and endoproteolysis of presenilin. J. Neurosci. 19, 10627–10634.[Abstract/Free Full Text]

Tomita, T., Watabiki, T., Takikawa, R., et al. (2001) The first proline of PALP motif at the C terminus of presenilins is obligatory for stabilization, complex formation, and gamma-secretase activities of presenilins. J. Biol. Chem. 276, 33273–33281.[Abstract/Free Full Text]

Weihofen, A., Binns, K., Lemberg, M.K., Ashman, K. & Martoglio, B. (2002) Identification of signal peptide peptidase, a presenilin-type aspartic protease. Science 296, 2215–2218.[Abstract/Free Full Text]

Wolfe, M.S., Xia, W., Ostaszewski, B.L., Diehl, T.S., Kimberly, W.T. & Selkoe, D.J. (1999) Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and {gamma}-secretase activity. Nature 398, 513–517.[CrossRef][Medline]

Received: 2 August 2005
Accepted: 3 October 2005





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shiraishi, H.
Right arrow Articles by Komano, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shiraishi, H.
Right arrow Articles by Komano, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS