GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2006) 11, 1253-1265. doi:10.1111/j.1365-2443.2006.01021.x
© 2006 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oguro, A.
Right arrow Articles by Atomi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oguro, A.
Right arrow Articles by Atomi, Y.

The molecular chaperone HSP47 rapidly senses gravitational changes in myoblasts

Asami Oguro1, Takashi Sakurai1, Yoshinobu Fujita1, Sachiko Lee1, Hiroshi Kubota2, Kazuhiro Nagata2 and Yoriko Atomi1,*

1 Department of Life Sciences, The Graduate School of Arts and Sciences, The University of Tokyo, Meguro-ku, Tokyo 153-8902, Japan
2 Department of Molecular and Cellular Biology, Institute for Frontier, Medical Sciences, Kyoto University, Sakyo-ku, Kyoto 606-8397, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 Statistical analysis
 References
 
Skeletal muscle unloading induced by spaceflight or bed rest leads to muscle atrophy. It is unclear how muscle atrophy is caused and how muscles respond to microgravity. We addressed the response of collagen and its chaperone system to gravitational forces. We show here that expression of HSP47, a collagen-specific molecular chaperone, responds to gravitational changes, including microgravity and hypergravity in vitro and in vivo. By using the method hindlimb suspension of rats, which mimics microgravity conditions, we demonstrated that the expression of Hsp47 mRNA decreased within 1 day and the mRNA levels of collagen types I and IV were subsequently reduced. In contrast, hypergravity stimulated HSP47 expression. HSP47 and collagen types I and IV were localized intracellularly in the endoplasmic reticulum and/or Golgi apparatus of myoblasts, as expected. Intriguingly, Hsp47 mRNA levels in cultured myoblasts increased significantly with hypergravity treatment at 40G for 2 h, and decreased with microgravity treatment at almost 0G for 1–2 h. Collagen mRNA levels were also altered, although changes were slower and less pronounced compared with those for HSP47. The gravity-regulated HSP47 may play a role in the maintenance of the extracellular matrix by modulating collagen production at the primary stage of adaptation.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 Statistical analysis
 References
 
A decrease in gravitational load leads to soleus muscle atrophy. Space flight and bed rest are known to have the same effect on skeletal muscle, particularly on the soleus muscle, which is composed mainly of slow-twitch fibers (Booth 1982; Booth & Gollnick 1983; Desplanches 1997). In contrast, reloading to normal gravity conditions leads to hypertrophy, indicating that the skeletal muscle is highly adaptable to changes in environmental conditions, including gravity. However, it remains unclear how skeletal muscle adapts to physical stress, including changes in gravitational load.

The extracellular matrix (ECM) in muscle tissues, including tendons and ligaments, has been thought to play important roles in the transmission of force and in cellular signal transduction (Ingber & Folkman 1989). Collagen and proteoglycans are abundant in the ECM of muscles and fibrous structures of the tendon and bone (Tomono et al. 2002), and polymers of these proteins are essential for cell survival and tension maintenance in the muscle. Although many studies have investigated the roles of dystrophin during muscular atrophy (Smith et al. 2005), only a few reports address the role of the ECM, particularly the basal lamina, in muscle atrophy, because of its insolubility (Hand et al. 2000).

Collagen is the most abundant ECM protein in mammals. Twenty-seven types of collagen have been reported (Myllyharju & Kivirikko 2004), and collagen types I and IV are the major components of the connective tissues and basal lamina, respectively (Timpl et al. 1981; Mayne & Burgeson 1987). HSP47 is a collagen-specific molecular chaperone (Nagata 1996) that assists in the molecular maturation of procollagen in the endoplasmic reticulum (ER) (Nagai et al. 2000; Tasab et al. 2000). Hsp47 gene disruption resulted in embryonic lethality in mice with molecular abnormalities in procollagen (Nagai et al. 2000). Recent studies of HSP47-knockout mice and cultured cells revealed that HSP47 is essential for the molecular maturation of collagen type VI as well as type I (Marutani et al. 2004; Matsuoka et al. 2004; Ishida et al. 2006). HSP47 binds to procollagen and preferentially recognizes its triple-helical form (Tasab et al. 2000). Correlation of HSP47 and collagen expression is evident in many tissues, including those in pathophysiologic conditions (Moriyama et al. 1997; Kuroda et al. 1998; Sunamoto et al. 1998; Razzaque & Taguchi 1999; Naitoh et al. 2001).

Recently, skeletal muscle atrophy was investigated further by proteomic technologies (Isfort et al. 2000; Isfort et al. 2002a,b) and DNA microarray analysis (Nikawa et al. 2004). A recent impressive finding is that the Hsp47 gene showed a 60-fold decrease in expression following a 16-day spaceflight in the space shuttle Columbia (Nikawa et al. 2004). Nikawa and colleagues also reported a significant reduction of the collagen type I receptor, fibronectin 1, and procollagen type III {alpha}1 and type IV {alpha}1 chains, which constitute the ECM. These data suggest that ECM components may be required for response or adaptation to gravitational conditions. At present, however, it remains unclear whether these responses are directly provided by changes in gravitational conditions or by other conditions during space flights.

We have reported that the levels of HSP70, HSP90, HSP27, {alpha}B-crystallin, and p20 decreased during the hindlimb suspension (HS) experiment (Fujita et al. 2004; Sakurai et al. 2005). Here we examined expression levels of HSP47 and collagen types I and IV after changes in gravitational conditions using rats and cultured cells, and found that the levels of these proteins change in response to gravity. The level of Hsp47, in particular, changed rapidly in cultured myoblasts, within 1–2 h after hypergravity (HG) or microgravity (MG) experiments. We discuss the role of HSP47 in the adaptation to changes in gravitational conditions, particularly focusing on the maintenance of muscle ECM, including the basal lamina, against gravity.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 Statistical analysis
 References
 
Rapid reduction of the Hsp47 mRNA level precedes a decrease in collagen types I and IV mRNA levels in rat skeletal muscle during HS treatment

Rat HS experiments provide an animal model for disease atrophy, particularly of the anti-gravitational, slow-twitch soleus muscle tissues. We utilized this system to analyze the roles of collagen and its molecular chaperone, HSP47, in the maintenance of muscle tissues against gravitational forces. Table 1 shows the body weight and soleus muscle weight on the first and last days of the HS and the HG treatments. The absolute and relative weights of the soleus muscles, as well as the body weights of rats treated by HS for 10 days, were significantly lower than those of controls. In contrast, the absolute and relative weights of the soleus muscles, and the body weights of rats treated with HG for 10 days were significantly higher than those of controls.


View this table:
[in this window]
[in a new window]
  		Table 1  Changes in soleus muscle weights after HS and HG treatments of mice
 
As determined by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, the level of Hsp47 mRNA was significantly reduced on day 1 of HS, and the reduction continued progressively until day 10 of HS (Fig. 1A). The Hsp47 mRNA level was restored after the first day of release from HS. The levels of collagen types I and IV mRNAs also decreased after HS, although the onset of the decrease was on day 5 of HS, significantly later than that of Hsp47 mRNA (Fig. 1A). These results indicate that the Hsp47 mRNA level rapidly decreases during HS treatment prior to a decrease in collagen mRNA levels and that this change is reversible when rats are returned to normal conditions.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
  		Figure 1  Changes in HSP47, collagen type I, and type IV mRNA expression levels in the soleus muscle after HS and recovery. (A) RT-PCR analysis of HSP47, collagen type I, collagen type IV, and GAPDH transcripts (left). The relative amounts of HSP47, type I collagen, and type IV collagen mRNA were determined by semiquantitative RT-PCR and normalized against that of GAPDH. D1, D2, D3, D5, and D10 denote 1, 2, 3, 5, and 10 days of HS, respectively (right). R1, recovery for 1 day from 10 days HS. C, control. Means ± SEM from three independent experiments are shown. *P < 0.05; **P < 0.01; ***P < 0.001. (B) Changes in HSP47 protein content in the soleus muscle during gravitational stimulation and after release. (Left) Western blot analysis of HSP47 and HSC70 (control) during HS for 5 and 10 days and recovery for 5 days after 10 days HS. HSP47 levels during HS experiments were quantified by Western blot analysis (n = 6). (Right) Western blot analysis of HSP47 protein content in the soleus muscle during HG by centrifugation at 3G for 5 and 10 days and recovery for 5 days HG. HSP47 levels during HG experiments were quantified by Western blot analysis (n = 6). *P < 0.05; **P < 0.01. (C) Changes in types I and type IV collagen protein content in the soleus muscle during gravitational stimulation and after release. Western blot analysis of collagens during HS for 5 and 10 days HS (top). Western blot analysis of collagens during HG by centrifugation at 3G for 5 and 10 days HG (bottom).

 
HSP47 protein content in muscle tissues decreases with HS and increases with HG

We next carried out Western blot analysis of HSP47 using a specific antibody to examine changes in the HSP47 protein level in the rat soleus muscle after HS or HG treatments. The levels of HSP47 in the soleus muscle after 10 days of HS and HG treatment or 5-day recovery were determined (Fig. 1B) using purified human HSP47 as a standard (Fig. S1). The HSP47 content in the HS-treated group on days 5 and 10 was significantly lower than that in the control group. The HSP47 content in the HS-treated group was restored after 5 days of recovery under normal conditions (Fig. 1B, left). On the contrary, the hypertrophied soleus muscle in the HG treatment group exhibited a significant increase in HSP47 content at days 5 and 10 of HG, and by recovery for 5 days under normal conditions (Fig. 1B, right). In contrast, HSC70 exhibited no significant changes throughout the experimental period (Fig. 1B). Collagen types I and IV also decreased after HS, and increased after HG (Fig. 1C). These results indicate that the changes in HSP47 levels by HS occur at the protein level as well as the mRNA level, and that HSP47 expression increases in response to HG at the protein level.

Distribution of HSP47 and collagen types I and IV in the rat soleus muscle and rat myoblasts

Muscle tissue is composed mainly of muscle fibers, muscle cells, and surrounding ECM, including the basal lamina. To determine where HSP47 and collagen types I and IV are expressed in rat soleus muscle tissues, myotubes, and myoblasts. We examined the distribution of these proteins by immunohistochemical analysis. We first confirmed the presence of myotubes and basal lamina in rat soleus muscle cross sections (Fig. S2A-a,b) with the presence of nuclei around the intrabasal lamina in myotubes (Fig. S2A-c). Immunofluorescence analysis using anti-HSP47 and anti-type IV collagen antibodies revealed that cells expressing HSP47 and type IV collagen co-localize at the periphery of myotubes in muscle tissues. Co-localization of HSP47 with the ER marker GRP78 (Fig. S2C) suggests that HSP47 localizes in the ER of cells expressing collagen in myotubes. The cells in myotubes may express HSP47 to efficiently produce collagen type IV, which is an important component of the basal lamina surrounding myotubes.

Immunofluorescence analysis of HSP47 in myotubes developed from primary culture of muscle cells confirmed that myotubes developed in vitro contain a significant level of HSP47 (Fig. 2A). These results support the view that muscle cells in muscle tissues express HSP47 and collagen to maintain the basal lamina of myotubes, and suggest that the changes in HSP47 levels in muscle tissues by HS and HG treatment of rats occur in muscle cells. To determine whether myoblasts express HSP47 and collagen, cultured L6E9 myoblasts were examined by immunofluorescence microscopy. Staining with anti-HSP47 and anti-type IV collagen antibodies indicated that HSP47 and type IV collagen co-localize primarily with an ER-Golgi pattern in L6 cells (Fig. 2B). Similarly, the majority of type I collagen appeared to co-localize with HSP47 in L6 cells (Fig. 2C). To determine whether these proteins localize in the ER, the Golgi apparatus, or both, costaining of these proteins with GM130 (Golgi marker) or PDI (ER marker) was carried out. HSP47 signals merged well with those of PDI, but not with GM130, in L6 cells, confirming that HSP47 localized in the ER of myoblasts (Fig. S3A,B), as shown in fibroblasts. Type I collagen staining was present both in the ER and Golgi apparatus, although signals were stronger in the Golgi apparatus (Fig. S3C,D). Type IV collagen also localized both in the ER and the Golgi apparatus, although stronger signals were detected in the ER in contrast to the result of type I collagen (Fig. S3E,F). The slightly different staining pattern between collagen types I and IV may be the result of a difference in time retained in the ER. Given that HSP47 is a collagen-specific molecular chaperone, these results suggest that the HSP47 in the ER of myoblasts contributes to the biosynthesis of collagen types I and IV.


Figure 2
View larger version (43K):
[in this window]
[in a new window]
  		Figure 2  Immunostaining of HSP47, type I collagen, and type IV collagen in rat myoblasts. (A) Localization of HSP47 in rat primary culture. The same field-of-view was analyzed by phase-contrast microscopy (a), HSP47 immunostaining (b), and DAPI staining with HSP47 (c). Green and blue signals indicate HSP47 and DAPI staining, respectively. Arrow indicates HSP47 in a differentiating myotube. Bar = 25 µm. (B) Costaining of HSP47 and type IV collagen in L6 cells. Bar = 20 µm. (C) Costaining of HSP47 and type I collagen in L6 cells. Bar = 20 µm.

 
Altered HSP47 content in cultured myoblasts in response to gravity

The response of HSP47 to gravitational conditions in muscle tissues and the abundance of HSP47 in myoblasts allowed us to assume that HSP47 in cultured myoblasts may also respond to changes in gravity. To analyze whether HSP47 expression is altered in response to gravity in myoblasts, L6 cells were exposed to HG by centrifugation or MG using 2D-clinorotation under culture conditions. Under conditions of HG at 40G for 2 h (Fig. 3A-b), L6 cells showed extension of the cell periphery and a flattened appearance compared with untreated controls. In contrast, after exposing cells to MG using 2D-clinorotation at almost 0G for 2 h, the L6 cell shape was unchanged throughout the experimental period (Fig. 3A-c). As no damage of cells was observed under the HG and MG conditions, we extracted proteins from these cells, and the level of HSP47 was examined by Western blotting. The HSP47 content in myoblasts was significantly decreased in MG-treated cells and increased in HG-treated cells relative to controls (Fig. 3B and Fig. S4). In contrast, the content of types I and IV collagen and HSF1 was not affected by gravitational conditions. These results suggested that myoblasts can sense gravitational changes at the cellular level and alter the expression of HSP47 through a specific pathway.


Figure 3
View larger version (76K):
[in this window]
[in a new window]
  		Figure 3  Changes in HSP47 protein content in cultured L6 cells following HG and MG treatments. (A) Phase contrast images of L6 cells cultured under normal conditions (a), HG induced by centrifugation at 40G for 2 h (b), or MG using 2D-clinorotation at almost 0G for 2 h (c). (B) Western blot analysis of HSP47, types I and IV collagen, HSC70, and HSF1 in L6 cells after HG (40G) and MG (0G) treatments for 6 h.

 
Stimulation of Hsp47, type I collagen, and type IV collagen mRNA expression in cultured myoblasts by HG treatment

To determine whether the response of myoblasts to gravitational changes occurs at the mRNA level, RT-PCR analysis was performed using L6 cells exposed to HG at 40G for 2 h (Fig. 4A). The Hsp47 mRNA level in L6 cells increased remarkably with HG treatment when compared with controls. In contrast, the expression of types I and IV collagen mRNAs in myoblasts exhibited no significant changes under these conditions. To test the effect of various gravitational conditions, L6 cells were treated with different degrees of HG for 2 h (Fig. 4B). The results of RT-PCR analysis showed that the level of HSP47 mRNA increased prominently at 40G, but not at 20G or 80G (Fig. 4B, top). Meanwhile, the expression of types I and IV collagen mRNAs was significantly increased at 80G (Fig. 4B, middle and bottom). To analyze the time course of the changes in mRNA levels under HG, L6 cells were treated at 40G for different periods of time, from 0.5 to 6 h (Fig. 4C). The Hsp47 mRNA levels increased significantly at 2 and 4 h (Fig. 4C, top). A significant increase in mRNA level was also observed for types I and IV collagen at 4 h (Fig. 4B, middle and bottom), although the degree of increase was less than for Hsp47 mRNA.


Figure 4
View larger version (16K):
[in this window]
[in a new window]
  		Figure 4  Stimulation of HSP47, type I collagen, and type IV collagen mRNA expression in cultured L6 cells following HG treatment. (A) Agarose gel electrophoresis of PCR-amplified transcripts of HSP47, collagen type I, type IV, and GAPDH mRNA of L6 cells untreated or treated with HG at 40G for 2 h. (B) L6 cells were treated with different degrees of HG for 2 h, and indicated mRNA levels were analyzed by semiquantitative RT-PCR and normalized against GAPDH mRNA (n = 3). (C) Time course of changes in mRNA levels. Cells were treated by HG at 40G for the indicated periods and analyzed by semiquantitative RT-PCR (n = 3).

 
We further analyzed the increase in mRNA levels by HG treatments by real-time quantitative RT-PCR (Fig. 5). By exposing L6 cells to 40G for 2 h, the expression of Hsp47 mRNA in myoblasts was increased twofold compared with the control level (Fig. 5A), confirming the significant increase in Hsp47 mRNA in response to HG. The type I collagen mRNA level in myoblasts showed no significant change under the same conditions (Fig. 5B), consistent with the semiquantative RT-PCR results. Although we examined mRNA levels of HSP70, a cytosolic chaperone stimulated by heat and related stress, TGFß1, a transforming growth factor known to stimulate the synthesis of mRNA encoding colligin, and a rat homolog of HSP47, no significant changes were detected after HG under the same conditions (Fig. 5C,D). We also examined mRNA levels of {alpha}B-crystallin and HSP70, cytosolic chaperones stimulated by heat and related stress, and Grp78, an ER chaperone stimulated by ER stress; however, no significant changes were detected after HG under the same conditions used (Fig. 5E,F). These results suggest that HSP47 expression was regulated by gravitational conditions through a pathway independent of heat shock, TGFß induced, and ER stress. Taken together, these results indicate that the Hsp47 mRNA level is altered in response to HG, and suggest that HSP47 expression is more sensitive to gravitational changes than collagen expression.


Figure 5
View larger version (19K):
[in this window]
[in a new window]
  		Figure 5  Real-time quantitative RT-PCR analysis of mRNA levels after HG at 40G for 2 h. Indicated mRNA levels were determined using specific primers of HSP47 (A), type I collagen (B), HSP70 (C), TGFß (D), {alpha}B-crystallin (E), and Grp78 (F), and normalized against the actin mRNA level. *P < 0.05; **P < 0.01; ***P < 0.001.

 
Rapid reduction of Hsp47, type I collagen, and type IV collagen mRNA levels in myoblasts cultured under MG conditions

We next examined the effect of MG on the levels of Hsp47 and types I and IV collagen mRNAs in cultured myoblasts. L6 cells were treated by MG from 0.5 to 6 h, and changes in Hsp47 mRNA levels were analyzed by semiquantative RT-PCR. At 0.5, 1, 2, 4, and 6 h of MG, Hsp47 mRNA was significantly decreased (Fig. 6, top). In the same experiments, the level of type I collagen mRNA was decreased at 0.5, 1, 2, 4, and 6 h (Fig. 6, middle), whereas the level of type IV collagen mRNA was decreased at 0.5, 1, and 2 h (Fig. 6, bottom). However, the changes in collagen mRNA levels were much smaller than the changes in Hsp47 mRNA levels. Taken together with the results for HG-treated L6 cells, these data demonstrate that myoblasts sense changes in gravity at the cellular level and alter the level of Hsp47 mRNA within 1–2 h.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
  		Figure 6  The time course of changes in HSP47, type I collagen, and type IV collagen mRNA levels in MG-treated L6 cells. Cells were treated by MG at almost 0G. Indicated mRNA levels were determined by semiquantitative RT-PCR and normalized against GAPDH mRNA (n = 3). *P < 0.05; **P < 0.01; ***P < 0.001.

 
Changes in TGFß1 and TNF{alpha} mRNA expression in myoblasts cultured under MG conditions

TGFß is known to induce Hsp47 expression (Sasaki et al. 2002; Pan & Halper 2003), and TNF{alpha} down-regulates HSF1 expression (Schett et al. 2003). We examined the effect of MG on the levels of TGFß1 and TNF{alpha} mRNAs in cultured myoblasts by semiquantative RT-PCR. At 1 h of MG treatment, the expression of TGFß mRNA in myoblasts was significantly decreased (Fig. 7). Expression of TNF{alpha} mRNA was increased at 0.5, 1 and 2 h of MG.


Figure 7
View larger version (11K):
[in this window]
[in a new window]
  		Figure 7  The time course of changes in TGFß, TNF{alpha} and HSP70 mRNA levels in MG-treated L6 cells. Indicated mRNA levels were determined by semiquantitative RT-PCR and normalized against GAPDH mRNA (n = 3). *P < 0.05; **P < 0.01.

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 Statistical analysis
 References
 
Gravity is essential for the biologic events of organisms on the earth (Ingber & Folkman 1989; Vandenburgh et al. 1991). Mechanical stress, including gravity and pressure shear stress, induces various adaptive reactions that may play important roles in cell survival and growth (Ingber & Folkman 1989; Tanaka et al. 2003). As unloading from gravity leads to atrophy in skeletal muscle (Booth & Seider 1979), maintenance of the skeletal muscle is highly dependent on environmental conditions including gravity.

We found in the present study that the expression of the collagen-specific chaperone HSP47 in the rat soleus muscle is significantly decreased by HS treatment and increased by HG treatment (Fig. 1). These observations suggest that the level of HSP47 is maintained to produce collagen effectively in the soleus muscle. Consistent with this view, muscle tissue contains significant levels of collagen type IV (Fig. S2) and the expression of this collagen in the skeletal muscle was previously reported (McDonald et al. 1995). Moreover, the basement membrane in HSP47-knockout mouse embryos lacked type IV collagen and fractured at a late stage of development (Marutani et al. 2004). Thus, the observed changes in the HSP47 level under HS and HG probably contribute to the maintenance of the basal lamina surrounding myotubes against gravity through the modulation of type IV collagen synthesis.

HSP47 in muscle tissues may also play a role in type I collagen production in the ECM in the connective tissues supporting myotubes. In agreement with the idea that ECM plays an important role against gravitational load, the genes encoding the collagen type I receptor, fibronectin 1, and procollagen types I and IV were reported to be down-regulated concomitantly with that of the Hsp47 gene by 60-fold after a 16-day spaceflight (Nikawa et al. 2004).

Myoblasts express significant levels of HSP47 and collagen types I and IV (Fig. 2). HSP47 localized in the ER, and these types of collagen distributed in the ER and Golgi apparatus of L6 myoblasts (Fig. S3). HSP47 can be purified from a myoblast cell line (Vaillancourt & Cates 1991), and the collagen types can be detected by Western blotting of extracts of myoblast cell lines (Albrecht & Tidball 1997; Obreo et al. 2004). Furthermore, we detected HSP47 in myotubes developed from primary culture. Thus, the HSP47 and type IV collagen observed in soleus muscle tissue were most likely to be expressed by the myoblasts attached to the basal lamina.

HSP47 levels also change in cultured L6 myoblasts by gravity (Fig. 3). Intriguingly, the level of Hsp47 mRNA in L6 increased by HG treatment at 40G in 2 h (Fig. 4) and decreased by MG treatment at almost 0G in 0.5 h (Fig. 6), indicating a very rapid response to HG. In addition, mRNA levels of collagen types I and IV changed after HG and MG treatments to a lesser degree than that of Hsp47 mRNA. Stronger or sustained treatment was required to induce an increase in collagen mRNAs. Although the cytoskeleton and focal adhesion may sense gravity in the cell (Ingber 1999), this ability is hidden when cells formed a primitive organ (Clarke et al. 2001; Tanaka et al. 2003; Hirasaka et al. 2005). This situation seems to be different from our observations, because we observed an up-regulation of Hsp47 mRNA in both muscle tissues and cultured myoblasts. Although degradation of the rat myosin heavy chain is enhanced during spaceflight in an ubiquitin-proteasome pathway-dependent manner (Ikemoto et al. 2001), this system is unlikely to affect the up-regulation of HSP47 under HG conditions. Thus, these previous observations appear to be different from our findings on HSP47.

HSP70 and Hsp47 genes have been reported to be decreased in rat osteoblasts following a 4–5-day spaceflight, along with a reduced amount of TGF-ß that induces HSP47 expression (Kumei et al. 2003), although the time of MG treatment was much longer than our experiments on cultured myoblasts. We previously reported that the levels of HSP70, HSP90, HSP27, and {alpha}B-crystallin decreased in several days during the HS experiment that mimics MG conditions (Fujita et al. 2004; Sakurai et al. 2005). Thus, it is possible that HSF1, a common transcription factor controlling Hsp47 and other heat shock protein genes, plays a role in the slow response to reduced gravity. Consistent with this notion, continuous up-regulation of TNF{alpha}, an inhibitor of HSF1 expresssion (Schett et al. 2003), was observed by MG treatment of myoblasts form 0.5 to 2 h (Fig. 7).

The {alpha}B-crystallin and HSP70 genes that contain HSF1-dependent elements in their promoters exhibited no significant changes by HG treatment of myoblasts at 40G for 2 h, whereas Hsp47 was up-regulated (Fig. 5). Thus, HSF1-dependent induction seems to be unrelated or insufficient for the rapid induction of Hsp47 under HG. In addition, unlike Hsp47, the level of hsp70 exhibited no significant difference by MG treatment for 2 h (Fig. 7). Intriguingly, a transient strong reduction of TGFß mRNA expression was observed at 1 h of MG treatment. This may partly contribute to the rapid reduction of Hsp47 mRNA under MG conditions, although TGFß appears to be unrelated to the rapid induction of Hsp47 by HG at 40G. As induction of TNF{alpha} was observed at a very early stage (0.5 h) of MG treatment, an HSF1-dependent element dependent on TNF{alpha} and other highly sensitive TGFß-response element independent of HSF1 on the Hsp47 promoter are both required for the rapid response. Alternatively, it might be possible that HSP47 expression was affected by TNF{alpha} through a pathway independent of HSF1 at the early stage of MG treatment.

In conclusion, the Hsp47 gene is a rapid sensor of gravitational changes. Through the effective production of collagen, the rapid response of HSP47 plays an essential role in the protection of skeletal muscle tissues against gravitational load. The system reported here may be useful to elucidate the initial adaptive events to varying gravity conditions that occur in the cell.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
Statistical analysis
 References
 
Animals

Adult male Wistar rats weighing 200–260 g and at 6–7 weeks of age for the HS experiments and weighing 130–140 g and at 4–5 weeks of age for the HG experiments were obtained from Saitama Experimental Animal Supply Co., Ltd. (Saitama, Japan). Becuase the cage attached to the centrifugation apparatus was small (see succeeding discussions), younger rats were used for the HG experiments. All animals were provided with standard rat chow and water freely, and were housed at 22–24 °C with a 12 : 12-h light-dark cycle. The rats were randomly assigned to groups designated HS treated, HG treated, and control. HS was performed as previously described (Sakurai et al. 2005). Briefly, the hindlimbs were suspended via a stainless steel fishing leader and a suspending wire, which allowed the rat free movement in all directions using the forelimbs. In all HS groups, the hindlimbs of the rats were allowed to hang free. After 5 or 10 days of HS treatment, the rats were sacrificed, and the soleus muscles were removed and weighed. For recovery experiments, rats were released from HS after 10 days of HS treatment and fed for 5 days. The tissues were immediately frozen in liquid nitrogen and stored until analysis. HG was performed as previously described (Yuwaki & Okuno 2003). Briefly, four cages (23.7 cm x 12 cm x 12.7 cm) were attached to crossing axes with a 124-cm radius. Rats were exposed to 3 G (G = 9.8 m/s2) by centrifugation (45 r.p.m.). At 3 G, rats could walk and gain access to food and water freely.

Purification of HSP47

HSP47 was purified by the method of Saga et al. (1987), with slight modifications. Human HSP47 was expressed in Escherichia coli and subjected to type I collagen-Sepharose column chromatography. Elution of HSP47 was performed with a buffer containing 50 mM MES, pH 5.8, 150 mM NaCl, 1% NP-40, and 10% glycerol. Immediately after elution, the HSP47 solution was neutralized by adding 1 M Tris-HCl (pH 8.0) and stored in the presence of 20% glycerol at 4 °C. Protein concentration was determined using a Bradford Protein Assay kit (Bio-Rad, Hercules, CA) with bovine serum albumin as a standard.

Antibodies

Rabbit polyclonal antibodies to type I collagen (LSL, Tokyo, Japan), type IV collagen (Chemicon, Temecula, CA), GRP78 (StressGen, Victria, Canada), HSF1 (StressGen), and monoclonal antibodies against HSP47 (StressGen) and Hsc70 (Santa Cruz Bioscience, Santa Cruz, CA) were purchased from the sources listed. Horseradish peroxidase-conjugated rat anti-rabbit IgG and anti-mouse IgG were obtained from Amersham Biosciences (Piscataway, NJ).

Immunoblot analysis

Muscle samples were crushed in liquid nitrogen and solubilized in a low-salt buffer containing 20 mM KCl, 2 mM sodium phosphate, pH 6.8, 2 mM Ethyleneglycotetraacetic acid, and protease inhibitors (2 µg/mL leupeptin, 2 µg/mL aprotinin, 1 mM phenylmethylsulfonyl fluoride, and 0.1 mM diisopropyl fluorophosphate). After centrifugation at 17 000 x g at 4 °C for 15 min, supernatants (soluble fractions) were recovered. Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed as previously described (Sakurai et al. 2005) using 12% gels. Proteins were blotted onto polyvinylidene fluoride (PVDF) membranes, incubated with primary antibodies, and subsequently incubated with horseradish peroxidase-conjugated secondary antibodies. Specific binding of antibodies was visualized by enhanced chemiluminescence (ECL, Amersham Biosciences). Developed immunoblots were scanned by a CCD camera (Atto, Tokyo, Japan), and band intensities were quantified using the NIH image program.

Primary culture

Primary cultures of thigh muscles were prepared from newborn rats according to Pinset et al. (1988). Briefly, newborn rats were decapitated, and the thigh muscles were dissected free of skin and cartilage. Pooled muscles from eight to ten embryos were minced and digested 5 times for 5 min in 5 mL of enzymatic solution (0.1% trypsin and 0.05% collagenase in PBS). After each digestion, the tissue fragments were recovered by centrifugation (800 x g for 10 min), and the action of enzymes was stopped by the addition of 1 mL of fetal bovine serum (FBS). Cells finally recovered were plated on collagen-coated dishes at a density of 5–8 x 104 per 35-mm dish.

Cell culture

Rat L6E9 myoblasts (a generous gift from T. Endo, Chiba University, Japan) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS. For microscopic assays, the cells were cultured on glass cover slips in culture dishes. Cultured L6 cells were centrifuged for HG experiments or treated using a 2D-clinorotation apparatus (Japan Aerospace Exploration Agency, JAXA, Tsukuba, Japan) for MG experiments according to the method of Tanaka et al. (2003). L6 cells (5 x 103/flask) were seeded into 25-cm2 culture flasks at approximately 30% confluence and filled with DMEM in the presence of 10% FBS. The rate and cycle of rotation were controlled by the computer to randomize the gravity vector both in magnitude and direction, and then the dynamic stimulation of gravity to cells was cancelled in any direction. Control cells were incubated in parallel under the same conditions except for the rotation.

Immunofluorescence microscopy

Sections (5 µm) of tissues were prepared using a cryostat (CM 3000, Jung, Leica, Bensheim, Germany). Sections were fixed with 4% paraformaldehyde for 10 min and washed 3 times with Tris-buffered saline (TBS-T: TBS + Tween 20) for 10 min. Sections were incubated with primary antibodies at a dilution of 1 : 50 in 5% skim milk/TBS-T for 1 h at room temperature. After three washes with TBS-T, sections were incubated with fluorescein isothiocyanate-conjugated anti-mouse IgG or rhodamine-conjugated anti-rabbit IgG (Amersham Biosciences) as secondary antibodies (1 : 100) for 1 h. Images were taken using a TCS SP2 confocal microscope (Leica, Bensheim Germany).

Cultured cells were washed briefly with warmed PBS at 37 °C and fixed in prewarmed 4% paraformaldehyde in PBS. After several washes with PBS, cells were permeabilized with PBS containing 0.1% Triton X-100 for 15 min at room temperature. Following washes, cells were blocked with 0.2% normal goat serum in PBS. Immunofluorescence staining of permeabilized cells was performed as described previously, except that anti-IgG conjugated with Alexa 488 or Alexa 546 (Invitrogen) were used as secondary antibodies. Images were taken using an LSM 410 or LSM META 510 confocal microscope (Carl Zeiss, Oberkochen, Germany).

Semiquantitative RT-PCR

Total mRNA from skeletal muscle and myoblasts was isolated using the RNeasy kit (Qiagen). After DNase treatment, cDNAs were obtained by reverse transcription of 2 µg of total RNA (Ready-to-Go T-primed First-Stranded Kit; Amersham Biosciences). Oligonucleotide primers were synthesized as follows (5' to 3'): AAGATGGTAGACAACCGTGG (Hsp47 sense), GTCTCGCATCTTGTCTCCCTT (Hsp47 anti-sense), ACCTCAAGATGTGCCACTCTGAC (type I collagen sense), AATCGACTGTTGCCTTCGCC (type I collagen anti-sense), TCGGCCATTCCTTCGTGATG (type IV collagen sense), TCTCGCTTCTCTCTATGGTG (type IV collagen anti-sense), ACCAACTACTGCTTCAGCTC (TGFß1 sense), TGTTGGTTGTAGAGGGCAAG (TGFß1 anti-sense), AAATGGGCTCCCTCTCATCA (TNF{alpha} sense), AGCCTTGTCCCTTGAAGAGA (TNF{alpha} anti-sense), ACCACAGTCCATGCCATCAC (GAPDH sense), TCCACCACCCTGTTGCTGTA (GAPDH anti-sense). PCR amplification of HSP47 cDNA was performed by 30 cycles of 94 °C for 40 s (denaturation), 63 °C for 40 s (annealing), and 72 °C for 60 s (extension). For type I collagen cDNA, reaction conditions were 28 cycles of 94 °C for 30 s, 60 °C for 30 s. For type IV collagen cDNA, reaction conditions were 28 cycles of 94 °C for 60 s, 60 °C for 60 s, and 72 °C 120 s. For TGFß cDNA, PCR conditions were 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s. For IL1ß and TNF{alpha} cDNA, PCR conditions were 42 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s. For GAPDH cDNA, PCR conditions were 26 cycles of 94 °C for 40 s, 63 °C for 40 s, and 72 °C for 60 s. PCR products were analyzed by 1.5% agarose gel electrophoresis.

Real-time quantitative RT-PCR

Primers were synthesized as follows (5' to 3'): AGACGAGTTGTAGAGTCCAAGAGT (HSP47 sense), ACCCATGTGTCTCAGGAACCT (HSP47 anti-sense), CCCACCGGCCCTACTG (type I collagen sense), GACCAGCTTCACCCTTAGCA (type I collagen anti-sense), AGGTGCAGGTGAACTACAAGGG (HSP70 sense), CTCGGCGATCTCCTTCATCTT (HSP70 anti-sense), TTGCCCTCTACAACCAACACAA (TGFß sense), TAGTAGACGATGGGCAGTGGC (TGFß anti-sense), TTGGAGTCTGACCTCTTCTCTACAG ({alpha}B-crystallin sense), AGGGTGGCCGAAGGTAGAA ({alpha}B-crystallin anti-sense), TGACTGACACCACTCTTGAACAAA (GRP78 sense), GGCTCTAACTGCCCTTCTGCT (GRP78 anti-sense), CGAGGCCCAGAGCAAGAG (actin sense), TTGGTGACAATGCCGTGTTCAATG (actin anti-sense). RT-PCR was performed by 50 cycles of 95 °C for 30 s, 95 °C for 5 s, and 60 °C for 20 s using the syber green II kits (Takara, Tokyo, Japan), and fluorescent signals from PCR products were monitored throughout the reaction period using the Smart cycler system (Takara).


   Statistical analysis
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Statistical analysis
References
 
All data were presented as mean ± SEM, and differences between groups were analyzed by student's test using an ANOVA program (STATVIEW, SAS Institute Inc., Cary, NC).


   Acknowledgements
 
We thank Dr Makoto Okuno for use of a centrifuge for HG experiments and Dr Nobuyuki Nukina for use of a confocal microscope. A clinorotation apparatus was kindly provided by JAXA during the MG experiments. We also thank Drs Muneo Takaoki, Junichiro Gyotoku, Naoko Ohta-Murakami, Akira Higashibata, Noriaki Ishioka, and Yasuhiro Matsuoka for kind technical advice and Drs Richard I. Morimoto and General Matsumoto for helpful comments to the manuscript. We are grateful to Akira Kitamura and Yoshihito Ishida for assistance in the immunofluorescence experiments.


   Footnotes
 
Communicated by: Keiji Tanaka

* Correspondence: E-mail: atomi{at}idaten.c.u-tokyo.ac.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 Statistical analysis
 References
 
Albrecht, D.E. & Tidball, J.G. (1997) Platelet-derived growth factor-stimulated secretion of basement membrane proteins by skeletal muscle occurs by tyrosine kinase-dependent and -independent pathways. J. Biol. Chem. 272, 2236–2244.[Abstract/Free Full Text]

Booth, F.W. & Seider, M.J. (1979) Early change in skeletal muscle protein synthesis after limb immobilization of rats. J. Appl. Physiol. 47, 974–977.[Abstract/Free Full Text]

Booth, F.W. (1982) Effect of limb immobilization on skeletal muscle. J. Appl. Physiol. 52, 1113–1118.[Abstract/Free Full Text]

Booth, F.W. & Gollnick, P.D. (1983) Effects of disuse on the structure and function of skeletal muscle. Med. Sci. Sports Exerc. 15, 415–420.

Clarke, M.S., Vanderburg, C.R. & Feeback, D.L. (2001) The effect of acute microgravity on mechanically-induced membrane damage and membrane-membrane fusion events. J. Gravit. Physiol. 8, 37–47.[Medline]

Desplanches, D. (1997) Structural and functional adaptations of skeletal muscle to weightlessness. Int. J. Sports Med. 18 (Suppl. 4), S259–S264.[Medline]

Fujita, Y., Ohto, E., Katayama, E. & Atomi, Y. (2004) {alpha}B-Crystallin-coated MAP microtubule resists nocodazole and calcium-induced disassembly. J. Cell Sci. 117, 1719–1726.[Abstract/Free Full Text]

Hand, D., Dias, D. & Haynes, L.W. (2000) Stabilization of collagen-tailed acetylcholinesterase in muscle cells through extracellular anchorage by transglutaminase-catalyzed cross-linking. Mol. Cell. Biochem. 204, 65–76.[CrossRef][Medline]

Hirasaka, K., Nikawa, T., Yuge, L., Ishihara, I., Higashibata, A., Ishioka, N., Okubo, A., Miyashita, T., Suzue, N., Ogawa, T., Oarada, M. & Kishi, K. (2005) Clinorotation prevents differentiation of rat myoblastic L6 cells in association with reduced NF-kappa B signaling. Biochim. Biophys. Acta 1743, 130–140.[Medline]

Ikemoto, M., Nikawa, T., Takeda, S., Watanabe, C., Kitano, T., Baldwin, K.M., Izumi, R., Nonaka, I., Towatari, T., Teshima, S., Rokutan, K. & Kishi, K. (2001) Space shuttle flight (STS-90) enhances degradation of rat myosin heavy chain in association with activation of ubiquitin-proteasome pathway. FASEB J. 15, 1279–1281.[Free Full Text]

Ingber, D. (1999) How cells (might) sense microgravity. FASEB J. 13 (Suppl.), S3–S15.[Medline]

Ingber, D.E. & Folkman, J. (1989) Mechanochemical switching between growth and differentiation during fibroblast growth factor-stimulated angiogenesis in vitro role of extracellular matrix. J. Cell Biol. 109, 317–330.[Abstract/Free Full Text]

Isfort, R.J., Hinkle, R.T., Jones, M.B., Wang, F., Greis, K.D., Sun, Y., Keough, T.W., Anderson, N.L. & Sheldon, R.J. (2000) Proteomic analysis of the atrophying rat soleus muscle following denervation. Electrophoresis 21, 2228–2234.[CrossRef][Medline]

Isfort, R.J., Wang, F., Greis, K.D., Sun, Y., Keough, T.W., Bodine, S.C. & Anderson, N.L. (2002a) Proteomic analysis of rat soleus and tibialis anterior muscle following immobilization. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 769, 323–332.[Medline]

Isfort, R.J., Wang, F., Greis, K.D., Sun, Y., Keough, T.W., Farrar, R.P., Bodine, S.C. & Anderson, N.L. (2002b) Proteomic analysis of rat soleus muscle undergoing hindlimb suspension-induced atrophy and reweighting hypertrophy. Proteomics 2, 543–550.[CrossRef][Medline]

Ishida, Y., Kubota, H., Yamamoto, A., Kitamura, A., Bachinger, H.P. & Nagata, K. (2006) Type I collagen in Hsp47-null cells is aggregated in endoplasmic reticulum and deficient in N-propeptide processing and fibrillogenesis. Mol. Biol. Cell 17, 2346–2355.[Abstract/Free Full Text]

Kumei, Y., Morita, S., Shimokawa, H., Ohya, K., Akiyama, H., Hirano, M., Sams, C.F. & Whitson, P.A. (2003) Inhibition of HSP70 and a collagen-specific molecular chaperone (HSP47) expression in rat osteoblasts by microgravity. Ann. N. Y. Acad. Sci. 1010, 476–480.[CrossRef][Medline]

Kuroda, K., Tsukifuji, R. & Shinkai, H. (1998) Increased expression of heat-shock protein 47 is associated with overproduction of type I procollagen in systemic sclerosis skin fibroblasts. J. Invest. Dermatol. 111, 1023–1028.[CrossRef][Medline]

Marutani, T., Yamamoto, A., Nagai, N., Kubota, H. & Nagata, K. (2004) Accumulation of type IV collagen in dilated ER leads to apoptosis in Hsp47-knockout mouse embryos via induction of CHOP. J. Cell Sci. 117, 5913–5922.[Abstract/Free Full Text]

Matsuoka, Y., Kubota, H., Adachi, E., Nagai, N., Marutani, T., Hosokawa, N. & Nagata, K. (2004) Insufficient folding of type IV collagen and formation of abnormal basement membrane-like structure in embryoid bodies derived from Hsp47-null embryonic stem cells. Mol. Biol. Cell 15, 4467–4475.[Abstract/Free Full Text]

Mayne, R. & Burgeson, R.E. (eds) (1987) Structure and Function of Collagen Types. San Diego: Academic Press.

McDonald, K.A., Lakonishok, M. & Horwitz, A.F. (1995) Alpha v and alpha 3 integrin subunits are associated with myofibrils during myofibrillogenesis. J. Cell Sci. 108 (7), 2573–2581.[Abstract]

Moriyama, T., Kawada, N., Akagi, Y., Ando, A., Horio, M., Yamauchi, A., Nagata, K., Imai, E. & Hori, M. (1997) TCV-116 inhibits interstitial fibrosis and HSP47 mRNA in rat obstructive nephropathy. Kidney Int.Suppl. 63, S232–S235.

Myllyharju, J. & Kivirikko, K.I. (2004) Collagens, modifying enzymes and their mutations in humans, flies and worms. Trends Genet. 20, 33–43.[CrossRef][Medline]

Nagai, N., Hosokawa, M., Itohara, S., Adachi, E., Matsushita, T., Hosokawa, N. & Nagata, K. (2000) Embryonic lethality of molecular chaperone hsp47 knockout mice is associated with defects in collagen biosynthesis. J. Cell Biol. 150, 1499–1506.[Abstract/Free Full Text]

Nagata, K. (1996) Hsp47: a collagen-specific molecular chaperone. Trends Biochem. Sci. 21, 22–26.[Medline]

Naitoh, M., Hosokawa, N., Kubota, H., Tanaka, T., Shirane, H., Sawada, M., Nishimura, Y. & Nagata, K. (2001) Upregulation of HSP47 and collagen type III in the dermal fibrotic disease, keloid. Biochem. Biophys. Res. Commun. 280, 1316–1322.[CrossRef][Medline]

Nikawa, T., Ishidoh, K., Hirasaka, K., Ishihara, I., Ikemoto, M., Kano, M., Kominami, E., Nonaka, I., Ogawa, T., Adams, G.R., Baldwin, K.M., Yasui, N., Kishi, K. & Takeda, S. (2004) Skeletal muscle gene expression in space-flown rats. FASEB J. 18, 522–524.[Abstract/Free Full Text]

Obreo, J., Diez-Marques, L., Lamas, S., Duwell, A., Eleno, N., Bernabeu, C., Pandiella, A., Lopez-Novoa, J.M. & Rodriguez-Barbero, A. (2004) Endoglin expression regulates basal and TGF-ß1-induced extracellular matrix synthesis in cultured L6E9 myoblasts. Cell. Physiol. Biochem. 14, 301–310.[CrossRef][Medline]

Pan, H. & Halper, J. (2003) Regulation of heat shock protein 47 and type I procollagen expression in avian tendon cells. Cell Tissue. Res. 311, 373–382.[Medline]

Pinset, C., Montarras, D., Chenevert, J., Minty, A., Barton, P., Laurent, C. & Gros, F. (1988) Control of myogenesis in the mouse myogenic C2 cell line by medium composition and by insulin: characterization of permissive and inducible C2 myoblasts. Differentiation 38, 28–34.[CrossRef][Medline]

Razzaque, M.S. & Taguchi, T. (1999) The possible role of colligin/HSP47, a collagen-binding protein, in the pathogenesis of human and experimental fibrotic diseases. Histol. Histopathol. 14, 1199–1212.[Medline]

Saga, S., Nagata, K., Chen, W.T. & Yamada, K.M. (1987) pH-dependent function, purification, and intracellular location of a major collagen-binding glycoprotein. J. Cell Biol. 105, 517–527.[Abstract/Free Full Text]

Sakurai, T., Fujita, Y., Ohto, E., Oguro, A. & Atomi, Y. (2005) The decrease of the cytoskeleton tubulin follows the decrease of the associating molecular chaperone alphaB-crystallin in unloaded soleus muscle atrophy without stretch. FASEB J. 19, 1199–1201.[Abstract/Free Full Text]

Sasaki, H., Sato, T., Yamauchi, N., Okamoto, T., Kobayashi, D., Iyama, S., Kato, J., Matsunaga, T., Takimoto, R., Takayama, T., Kogawa, K., Watanabe, N. & Niitsu, Y. (2002) Induction of heat shock protein 47 synthesis by TGF-ß and IL-1ß via enhancement of the heat shock element binding activity of heat shock transcription factor 1. J. Immunol. 168, 5178–5183.[Abstract/Free Full Text]

Schett, G., Steiner, C.W., Xu, Q., Smolen, J.S. & Steiner, G. (2003) TNF{alpha} mediates susceptibility to heat-induced apoptosis by protein phosphatase-mediated inhibition of the HSF1/hsp70 stress response. Cell Death Differ. 10, 1126–1136.[CrossRef][Medline]

Smith, S.M., Wastney, M.E., O’Brien, K.O., Morukov, B.V., Larina, I.M., Abrams, S.A., Davis-Street, J.E., Oganov, V. & Shackelford, L.C. (2005) Bone markers, calcium metabolism, and calcium kinetics during extended-duration space flight on the mir space station. J. Bone Miner. Res. 20, 208–218.[CrossRef][Medline]

Sunamoto, M., Kuze, K., Iehara, N., Takeoka, H., Nagata, K., Kita, T. & Doi, T. (1998) Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression. Int. J. Exp. Pathol. 79, 133–140.[CrossRef][Medline]

Tanaka, M., Asashima, M. & Atomi, Y. (2003) Proliferation and differentiation of Xenopus A6 cells under hypergravity as revealed by time-lapse imaging. In Vitro Cell. Dev. Biol. Anim. 39, 71–79.[CrossRef][Medline]

Tasab, M., Batten, M.R. & Bulleid, N.J. (2000) Hsp47: a molecular chaperone that interacts with and stabilizes correctly-folded procollagen. EMBO J. 19, 2204–2211.[CrossRef][Medline]

Timpl, R., Wiedemann, H., van Delden, V., Furthmayr, H. & Kuhn, K. (1981) A network model for the organization of type IV collagen molecules in basement membranes. Eur. J. Biochem. 120, 203–211.[Medline]

Tomono, Y., Naito, I., Ando, K., Yonezawa, T., Sado, Y., Hirakawa, S., Arata, J., Okigaki, T. & Ninomiya, Y. (2002) Epitope-defined monoclonal antibodies against multiplexin collagens demonstrate that type XV and XVIII collagens are expressed in specialized basement membranes. Cell Struct. Funct. 27, 9–20.[CrossRef][Medline]

Vaillancourt, J.P. & Cates, G.A. (1991) Purification and reconstitution of a collagen-binding heat-shock glycoprotein from L6 myoblasts. Biochem. J. 274 (3), 793–798.[Medline]

Vandenburgh, H.H., Hatfaludy, S., Karlisch, P. & Shansky, J. (1991) Mechanically induced alterations in cultured skeletal muscle growth. J. Biomech. 24, 91–99.[CrossRef][Medline]

Yuwaki, K. & Okuno, M. (2003) Changes in food intake and growth rate in mice under hypergravity. Biol. Sci. Space 17, 219–220.[Medline]

Received: 18 March 2006
Accepted: 3 August 2006





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oguro, A.
Right arrow Articles by Atomi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oguro, A.
Right arrow Articles by Atomi, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS