GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2006) 11, 1337-1352. doi:10.1111/j.1365-2443.2006.01024.x
© 2006 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charrier, E.
Right arrow Articles by Kolattukudy, P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Charrier, E.
Right arrow Articles by Kolattukudy, P.

Transient alterations in granule cell proliferation, apoptosis and migration in postnatal developing cerebellum of CRMP1–/– mice

Emmanuelle Charrier1,a, Bedrich Mosinger2,a, Claire Meissirel1, Michèle Aguera1, Véronique Rogemond1, Sophie Reibel1, Paul Salin5, Naura Chounlamountri1, Valérie Perrot1, Marie-Françoise Belin1, Yoshio Goshima3,4, Jérôme Honnorat1, Nicole Thomasset1,a,* and Pappachan Kolattukudy2,a

1 INSERM, U433, Institut Fédératif des Neurosciences; Université Claude Bernard Lyon 1; Hospices Civils de Lyon, Lyon, F-69372 France
2 Biomolecular Science Center, University of Central Florida, Biomolecular Science, Orlando, Florida 32816-2364, USA
3 Department of Molecular Pharmacology and Neurobiology, Yokohama City University, Graduate School of Medicine, Yokohama 236-0004, Japan
4 CREST, Japan Science and Technology Corporation, Kawaguchi 332-0012, Japan
5 CNRS UMR 5167, Université Claude Bernard Lyon I, Lyon, F-69372 France


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Collapsin response mediator proteins (CRMPs) consist of five homologous cytosolic proteins that participate in signal transduction involved in a variety of physiological events. CRMP1 is highly expressed during brain development; however, its functions remains unclear. To gain insight into its function, we generated CRMP1–/– mice with a knock-in LacZ gene. No gross anatomical changes or behavioral alterations were observed. Expression of CRMP1 was examined by the expression of the knocked-in LacZ gene, in situ hybridization with riboprobes and by imunohistochemistry. CRMP1 was found to be highly expressed in the developing the cerebellum, olfactory bulbs, hypothalamus and retina. In adults, expression level was high in the olfactory bulbs and hippocampus but very low in the retina and cerebellum and undetectable in hypothalamus. To study potential roles of CRMP1, we focused on cerebellum development. CRMP1–/– mice showed a decrease in the number of granule cells migrating out of explants of developing cerebellum, as did treatment of the explants from normal mice with anti-CRMP1 specific antibodies. CRMP1–/– mice showed a decrease in granule cell proliferation and apoptosis in external granule cell layers in vivo. Adult cerebellum of CRMP1–/– did not show any abnormalities.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
CRMP1 belongs to the CRMP phosphoprotein family, composed of five homologous cytosolic proteins highly expressed throughout brain development (for review see Charrier et al. 2003). The first member was identified (Goshima et al. 1995) as an intracellular mediator required for transducing Semaphorin3A-induced neuronal growth cone collapse (Luo et al. 1993). An expanding body of evidence indicates that the functions of CRMPs are not limited to the transduction of the Semaphorin3A signal. CRMPs are involved in different physiological events including apoptosis (Shirvan et al. 1999), cytoskeletal rearrangement (Gu & Ihara 2000; Fukata et al. 2002), neuronal polarity (Arimura et al. 2004), axonal branching (Inagaki et al. 2001), modulation of neurite growth induced by neurotrophins (Quach et al. 2004) and lung morphogenesis (Ito et al. 2000). CRMPs may also contribute to adult brain plasticity (Wang & Strittmatter 1996; Ricard et al. 2001; Yoshimura et al. 2002), and are involved in neurodegenerative disorders such as Alzheimer's disease (Yoshida et al. 1998; Castegna et al. 2002; Uchida et al. 2005), Parkinson's disease (Barzilai et al. 2000) and paraneoplastic neurological disease (Honnorat et al. 1999).

CRMP1, highly expressed during brain development and down-regulated in adults (Wang & Strittmatter 1996; Quach et al. 1997; Byk et al. 1998), can interact with other members of the CRMP family (Wang & Strittmatter 1997). CRMP1 participates in the neurite formation/extension induced by NT3 (Quach et al. 2004). A splice variant of CRMP1 with an extended N-terminus, expressed in developing brain (Yuasa-Kawada et al. 2003), interacts with Rho-kinase and CRMP2, and modulates neuronal morphology (Leung et al. 2002). In addition, CRMP1 is involved in neuroendocrine (Hu et al. 2002) and lung cancer, where its expression is inversely associated with invasive activity (Shih et al. 2003). How CRMP1 functions during central nervous system development remains largely unknown. We have previously shown that a potent CRMP1 partner, CRMP2, is expressed in the proliferative layer of the postnatal developing cerebellum (Ricard et al. 2001) and down-regulated in adult. Therefore, we chose to examine the roles of CRMP1 during the postnatal cerebellar development. To investigate the potential CRMP1 functions in the developing cerebellum, we generated a CRMP1–/– mice using the gene targeting knock-out technique to inactivate CRMP1 gene in the mouse genome. We report that CRMP1 gene disruption leads to a specific alteration of granule cell precursor proliferation, apoptosis, and migration.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Production of a mouse line deficient in CRMP1

We generated mice deficient in the CRMP1 gene by homologous recombination in mouse ES cells. The targeting vector (Fig. 1A) contains the LacZ reporter gene inserted in, and replacing part of, the fourth exon of the CRMP1 gene. After electroporation into embryonic stem cells, G418 and Gancyclovir-resistant colonies were picked and screened by PCR, and by Southern blot hybridization (Fig. 1B,C). Identity of the 5' end of the recombination event was also re-confirmed by additional PCR reactions with primers derived from the 3rd exon outside of the region used in the construct (primer a, Fig. 1A) and from the IRES sequence (primer b), and the identity of the 3' end by PCR with the neo primer (primer d) together with a 6th exon primer (primer g). Of over 200 colonies screened, 48 positive colonies were obtained. Several clones were chosen to produce chimeric animals by aggregation with morulae of the ICR mouse strain. After obtaining the first germ-line transmission, chimeric males were bred with 129 SVE females. Heterozygous animals were identified by genotyping (see Experimental procedures) and bred together to produce homozygous mutant mice in 129 background. The CRMP1–/– mice appeared normal, without obvious gross abnormalities, and they reproduced normally.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
Figure 1  Targeted disruption of the CRMP1 gene. (A) Structure of the wild-type gene, replacement vector and disrupted locus. The 5 kb and 3.5 kb, 5' and 3' CRMP1 fragments, were inserted into the pIRES-LacZ-neo (cassette positioned such that it would disrupt and delete an internal part of the 4th exon of CRMP1 gene). Positions of oligonucleotide primers used for screening and confirmation of homologous recombination are indicated. DNA of individual ES colonies was screened by PCR with a forward neo primer: neo5 (primer d) and a primer from 5th exon outside of the homologous region used in the vector (primer f). Recombination was reconfirmed on the 3' end using primer neo5 (primer d) and a reverse primer from the 6th exon (primer g): and on the 5' end using a forward primer from the 3rd exon (primer a) and a reverse primer from the IRES sequence (primer b). (B) Southern-blot of BamHI digested genomic DNA from ES cells. Hybridization was performed with a 32P labeled probe corresponding to a 1.1 kb sequence of the 2nd intron of the CRMP1 gene. (C) Genotyping by PCR. The 550 bp fragment indicates the neo gene (primers n1 and n2) and the 250 bp fragment is from the 4th exon (deleted in the targeted allele, primer c) and 4th intron of wild-type CRMP1 gene (primer e). 1, 4, 5, heterozygotes; 3, homozygote (missing 250 bp); 2, wild-type. (D) Western-blot of two-month-old wild-type (WT) or CRMP1-deficient (CRMP1–/–) cerebellum tissue extracts immunoblotted with anti-CRMP1, anti-CRMP2, anti-CRMP3, anti-CRMP4 or anti-CRMP5 antibodies. Whereas the two isoforms of 66 kDa and 80 kDa of CRMP1 were detected in cerebellum of wild-type mice, no CRMP1 protein expression was detected in tissue from CRMP1–/– mice.

 
Immunoblots with the specific anti-CRMP1 ATP antibody showed the expected 66 kDa and 80 kDa bands in cerebellum extracts from adult mice (Fig. 1D) but there was no cross-reacting protein in tissues from homozygous mutant animals (Fig. 1D). Since CRMP1 disruption involved substitution of a segment in the fourth exon, neither first exon variants of CRMP1 would be expected to be present in our CRMP1–/– animals. In fact, the antibodies that would cross-react with either variant detected no CRMP1 protein in the CRMP1–/– animals. We examined the cerebellum for other CRMP protein expression to determine whether there were compensatory increases in other CRMPs when the CRMP1 gene was non-functional. We observed no difference in CRMP2, 3, 4 and 5 protein expression by Western-blot between cerebellum tissue from wild-type and CRMP1–/– mice (Fig. 1D).

Phenotype analysis of CRMP1-deficient mice

We did not detect any obvious anatomical or microscopic (hematoxylin-eosin-safran staining) changes in the brain structure of CRMP1–/– animals as compared with age-matched controls.

We tested several behavioral paradigms that could possibly be influenced by the functional impairment of the brain areas that showed high expression of the knocked-in lacZ gene (see below). The results of most tests were within or close to statistical deviations of average values for the wild-type 129 strain. For example, on the rotarod and the thin rod tests of the locomotor function and coordination, we did not find statistically significant differences in performance. Vision seems normal; the CRMP1–/– animals oriented and reacted to light and moving objects. The CRMP1–/– animals smell food well (data not shown). We next tested some functions and behaviors controlled by the hypothalamus. The basal biochemistry tests were normal, including the cortisol and T4 levels (data not shown). The CRMP1–/– animals are fertile and have normal litter size indicating that levels of hormones of the hypothalamus–pituitary axis are most likely to be within normal levels. Their body size and weight are comparable to those of the wild-type animals and the life expectancy is not affected.

Distribution of CRMP 1 in the developing nervous system

Analysis of LacZ expression in the nervous system of the CRMP1–/– mice
The CRMP1–/– mice express the knocked-in LacZ in the nervous system during development and in various parts of the brain after birth. Tissues with the highest expression of LacZ include the olfactory bulb, hypothalamus and cerebellum.

At embryonic day 15 (E15) both homozygous and heterozygous embryos expressed the LacZ in spinal cord and in the developing brain but no staining was detectable in wild-type embryos (not shown). The staining was approximately twice as strong in homozygotes as it was in heterozygotes. The expression in the spinal cord was located in cells in the ventral area of the anterior horn and in the lateral part of the intermediate gray matter (not shown). In the postnatal period, LacZ expression was not detectable in the spinal cord (data not shown), but was very dynamic in the brain.

At P1 through P13, LacZ expression was very strong in the retina, olfactory bulb, hypothalamus, and cerebellum (Fig. 2A–E). The highest CRMP1 expression, as indicated by LacZ expression, was located in the P5/P13 developing cerebellum. At P15 through P21 LacZ expression remained strong in the olfactory bulb and retina, but was much weaker in the cerebellum at P21, and strongly reduced in the hypothalamus (not shown). LacZ expression in the cerebellum was very strong in the Purkinje cells as determined by co-localized expression of the cerebellum-specific protein, L7 (not shown). LacZ expression was located in distinct anterio-posterior stripes (Fig. 2C). In the olfactory bulb, the expression was predominantly in the glomerular and mitral cell layers. In the retina, LacZ expression was predominantly in the ganglion cell layer and slightly less in the amacrine and bipolar cell layers (Fig. 2E). In the hypothalamus, the expression was strong at several distinct nuclei; however, other areas throughout the hypothalamus were also expressing LacZ. One of the prominently stained nuclei was the ventromedial nucleus.


Figure 2
View larger version (65K):
[in this window]
[in a new window]

 
Figure 2  Expression of LacZ reporter knocked into CRMP1 gene in brain from the indicated postnatal stages. Brains from homozygous mutant animals were dissected after transcardiac perfusion with 3% paraformaldehyde, postfixed for 3 h and stained with the X-gal reagent overnight. (A,B) (P5), dorsal and ventral sides of brains are shown. Intense staining can be observed in olfactory bulb (OB) and olfactory cortex (OC), as well as in the hypothalamus (HT). (C) (P10), shows cerebellum (C) staining in distinct stripes. (D) (P13), the brain was dissected together with the olfactory epithelium (OE). At this stage, staining is most prominent in the cerebellum, the olfactory bulb, and the olfactory epithelium. (E) (P2) Section through an eye of homozygote mice, low and high magnification showing strong staining in developing retinal ganglion cells (RGC).

 
In adults (2–3 months old), there was persistent expression in the olfactory bulb, although it was lower than at the P1–P21 stages, while the expression in retina and cerebellum was greatly reduced to a few scattered cells, and the expression in hypothalamus was undetectable. At the same time, expression appeared in the hippocampus CA1 area, the dentate gyrus of hippocampus, and faint but discernible expression appeared throughout the cortex. At P1–P21 we did not detect expression either in the hippocampus or in the cortex.

Analysis of CRMP1 expression in wild-type mice cerebellum by in situ hybridization and immunochemistry
We identified CRMP1 mRNA and protein cellular distribution in the postnatal developing cerebellum of wild-type mice by in situ hybridization with a specific riboprobe for CRMP1 mRNA and by immunohistochemistry with specific antibodies for CRMP1 protein (Fig. 3A). CRMP1 sense riboprobe and immunohistochemistry on CRMP1–/– mice tissue served as negative controls. CRMP1 mRNA and protein were readily detected in Purkinje cells (Fig. 3A). CRMP1 protein was present in the cytoplasm of Purkinje cells and in their dendritic tree, expanding in the molecular layer. Purkinje cell expression of CRMP1 mRNA and proteins were developmentally down-regulated, with a higher expression at P5 and P8, than at P12 (Fig. 3A). We also detected an expression of CRMP1 mRNA and protein in granule cells of the developing cerebellum, at P5, P8, and P12 (Fig. 3A). CRMP1 protein was detected in the cytoplasm of granule cells in the external granule layer and more strongly in granule cells of the internal granule layer. The fibers in the molecular layer were strongly immunoreactive for CRMP1 (at P8 and P12) (Fig. 3A). CRMP1 expression in granule cells seemed to be also down-regulated during development, stronger at P5 and P8 than at P12 (Fig. 3A). Curiously, LacZ staining was not readily detected in granule cells by our technique. This apparent discrepancy could be due to lower sensitivity of LacZ detection compared to in situ hybridization or immunochemistry or it may be a consequence of the presence of IRES sequence in the construct used to knock-in LacZ. To confirm granule cell CRMP1 expression, we performed immunolabeling of CRMP1 protein on freshly purified P5 granule cells, which were clearly positive (Fig. 3B). Neuronal identity of these purified cells was confirmed by colabeling with ß III tubulin, a marker of neuroblasts. As control, we performed immunolabeling on granule cells purified from CRMP1-deficient mice and showed that these cells express ß III tubulin, but showed no immunolabeling for CRMP1 protein (Fig. 3B).


Figure 3
View larger version (61K):
[in this window]
[in a new window]

 
Figure 3  Expression of CRMP1 in the developing cerebellum. (A) Saggital sections of P5, P8 or P12 cerebellum of wild-type or CRMP1-deficient (CRMP1–/–) mice were hybridized with the anti-sense or sense CRMP1 riboprobes or immunolabeled with the anti-CRMP1 ATP antibodies. Arrow points the Purkinje cell layer. Inserts show high magnification of the EGL. CRMP1 mRNA and protein were detected in Purkinje cells and granule cells in the EGL and IGL. Strong CRMP1 immunolabeling was observed in the wild-type ML, especially in the dendritic arborization of the Purkinje cells characterized by their calbindin co-immunostaining, whereas no staining was observed in the CRMP1 deficient mice. EGL, external granular layer; ML, molecular layer; PL, Purkinje cell layer; IGL, internal granular layer. (B) Freshly purified granular cells from cerebellum of P8 wild-type or CRMP1–/– mice grown 48 h in vitro were immunolabeled with anti-CRMP1 ATP antibodies or anti-ß III tubulin antibodies. Granule cells from wild-type and CRMP1–/– mice expressed ß III tubulin. CRMP1 protein was expressed both in axon and soma of granule cells from wild-type mice but was not detected in cells from CRMP1–/– mice.

 
Study of cerebellum development in CRMP1–/– mice

CRMP1 was clearly expressed at all stages of cerebellum development. To study potential roles of CRMP1, we focused on cerebellum development, a well-described model characterized by spatio-temporal specific and organized sequences of development.

In vitro study of granule cell migration in P8 CRMP1–/– mice

As CRMP1 was expressed in granule cells, we examined migration and neurite outgrowth in these cells using cerebellum explants from P8 wild-type and CRMP1–/– animals. At this stage of development, granule cells undergo extensive axonal extension and migration (Komuro et al. 2001). Axonal fibers corresponding to granule parallel fibers extended radially from the explant core after 48 h in culture and these outgrowing processes supported closely apposed granule cell migration (Fig. 4A). Immunolabeling for ß III tubulin was detected in the outgrowing fibers of cerebellar explants from both wild-type and CRMP1–/– mice. These processes and the migrating granule cells clearly expressed CRMP1 in explants from wild-type mice. On the other hand, no CRMP1 immunolabeling was detected in explants from CRMP1–/– mice (Fig. 4A). Explants from CRMP1-deficient mice seemed to show less migrating cells leaving the explant core. So, we quantified the number of migrating granule cells out of the explant core from the wild-type and CRMP1–/– mice. There was a 20% reduction in the migrating cell population in explants from CRMP1–/– mice (161 ± 11 migrating cells) vs wild-type mice (203 ± 12 migrating cells) (P < 0.05) (Fig. 4B). We also quantified the distance of migration by determining the percentage of cells having migrated from 0 to 105 µM from the edge of the explant core. No significant difference of granule cell distance migration was observed between explants from wild-type and CRMP1–/– mice (Fig. 4C). Likewise, no statistical difference was observed between the average axonal outgrowth length in explants from wild-type and CRMP1–/– mice (Fig. 4E). Thus, CRMP1 deficiency affected in vitro the number of migrating granule cells but did not modify migration distance, nor axonal length of granule cells.


Figure 4
View larger version (36K):
[in this window]
[in a new window]

 
Figure 4  Granular cell migration and axonal outgrowth in cerebellum explants from CRMP1–/– and wild-type mice and the effect of anti-CRMP1 antibodies on migration. (A) Cerebellar explants from P8 wild-type (WT) or CRMP1–/– mice were visualized by phase contrast image (top) or immunolabeled with anti-CRMP1 ATP (middle) and anti-ß III tubulin antibodies (bottom). Explants from wild-type and CRMP1–/– mice showed immunolabeling with ß III tubulin. CRMP1 protein was detected in migrating granule cells and their somas only in explants from wild-type mice. (B) Number of migrating cells in cerebellar explants from P8 wild-type or CRMP1–/– mice. n (explants number) = 110 for wild-type, n = 91 for CRMP1–/–. (C) Distance of cell migration (percentage of cells with migration distance < 105 µM) per explant in cerebellar explants from P8 wild-type or CRMP1-deficient (CRMP1–/–) mice. n = 20 for wild-type, n = 16 for CRMP1–/–. (D) Number of migrating cells per explant was determined in explants from P8 wild-type mice after application of anti-CRMP1 ATP antibodies at different doses. n = 66 for control without IgG, n = 38 for preimmune rabbit IgG at 10 µg/mL (preimmune), n = 78 for anti-CRMP1 ATP purified antibodies at 1 µg/mL, n = 66 for anti-CRMP1 ATP purified antibodies at 5 µg/mL, n = 40 for anti-CRMP1 ATP purified antibodies at 10 µg/mL. Statistical significance was assessed with a one-way ANOVA followed by a Fischer's PLSD test. *P < 0.05, ***P < 0.0001. (E) Axonal length of granule cells was quantified in cerebellar explants from P8 wild-type (n = 18) or from CRMP1 deficient mice (n = 19). No difference in axon lengh was detected between explants from wild-type and CRMP1 deficient mice. Statistical significance was assessed with a Student test *P < 0.05.

 
To verify the direct effect of CRMP1 deficiency on alteration of the migrating cell population, we added specific anti-CRMP1 antibodies on wild-type P8 explant culture to specifically block CRMP1 function (Fig. 4D). Addition of anti-CRMP1 ATP antibodies (5 µg/mL) for 48 h resulted in a 30% decrease in the number of cells migrating out of the explant 243 ± 11 with the antibody, 371 ± 16 in control medium. Preimmune IgG at the same concentration showed little effect (350 ± 19 migrating cells) (P < 0.0001) (Fig. 4D). Furthermore, this decrease in the number of cells migrating out of the explant was dependent on the concentration of antibodies showing a clear dose–response (Fig. 4D). Similar result was obtained by treatment with another anti-CRMP1 antibody, anti-CRMP1 LTS, directed against another peptide of the CRMP1 protein sequence (data not shown).

Thus, CRMP1 deficiency or blockade of CRMP1 by antibodies altered the number of migrating granule cells in the cerebellar cortex explant model without affecting their distance of migration.

In vivo study of granule cell migration in P12 CRMP1–/– mice

To investigate whether the results obtained in the in vitro experiments represent the role of CRMP1 in vivo, we analyzed in vivo granule cell migration in P12 CRMP1–/– and wild-type mice. This stage of development coincides with extensive radial migration of granule cells from the external granule layer to the internal granule layer (Rakic 1971; Edmondson & Hatten 1987). To study granule cell migration, in vivo, pups were intraperitoneally injected with BrdU at P10 for two days, to label the granule cells at the peak of their inward migration at P12 when pups were sacrified (Fig. 5A). We quantified the number of BrdU labeled cells in each cerebellar layer as a percentage of all labeled cells and found that 21.35 ± 0.99% granule cells reached the internal granule layer in WT (n = 5) compared to 23.15 ± 0.81% in CRMP1 deficient mice (n = 7). Indeed, BrdU+-labeled cells settling in IGL are mainly granular in origin because a control experiment shows that proliferating labeled cells are mainly restricted to the EGL and white matter at P12 (result not shown). The percentage of migrating granular precursors was not significantly different in wild-type compared to CRMP1–/– mice with a Student t-test as P > 0.05. Thus, granule cell migration is not significantly modified in the CRMP1 deficient mice.


Figure 5
View larger version (89K):
[in this window]
[in a new window]

 
Figure 5  CRMP1 deficiency and granular cell proliferation, apoptosis and migration. (A) Laminar distribution of migrating granular cells is shown after labeling with anti-BrdU antibodies in cerebellum from P12 WT or CRMP1–/– mice 48 h after BrdU injection. The percentage of BrdU labeled cells in IGL was expressed as a percentage of the total number of BrdU-labeled cells in EGL, ML, PL and IGL of P12 WT or CRMP1–/– mice. Statistical significance was assessed with a Student t-test n (number of animals) = 5 for WT, n = 7 for CRMP1. (B) Proliferating granular cells in cerebellum were labeled with anti-BrdU antibodies 1 h after a BrdU injection in WT or CRMP1-deficient (CRMP1–/–) mice at developmental stage of P5. The percentage of BrdU labeled cells per total number of granular cells labeled with DAPI was determined in the EGL of P5 WT or CRMP1-deficient (CRMP1–/–) mice. (C) Apoptotic granular cells in the EGL were detected with the TUNEL labeling in cerebellum of P5 wild-type (WT) or CRMP1–/– mice. The population density of apoptotic TUNEL-labeled granular cells per 1.105 µm2 of EGL was determined. Statistical significance was assessed with a Student test. n (number of animals) = 7 for P5 wild-type and CRMP1-deficient mice. ***P < 0.0001. EGL, external granular layer; ML, molecular layer; PL, Purkinje cell layer; IGL, internal granular layer; WM, white matter.

 
In vivo study of granule cell proliferation, and apoptosis in P5 CRMP1–/– mice

As radial migration of granule cells was not affected at P12, we investigated whether CRMP1 deficiency could affect granule cell development before initiation of their migration, during the period of extensive proliferation, which occurs in the upper strata of EGL at P5. To study the effect of CRMP1 deficiency on granule cell proliferation, we measured the number of mitotic cells in the EGL by quantifying cells having incorporated BrdU 1 h after a BrdU pulse in P5 wild-type and CRMP1–/– mice (Fig. 5B). To assess the EGL development, we also quantified the total number of DAPI-labeled cells in EGL and the EGL area in the same region of wild-type and CRMP1–/– mice cerebellum. Cerebellum of CRMP1–/– mice showed a 44% decrease in number of BrdU-positive cells in EGL (108 ± 3) vs (191 ± 4) (P < 0.0001) (not shown). Similar differences were found when the number of BrdU-positive cells was compared to the number of total DAPI-labeled cells in EGL (26 ± 1% of BrdU-labeled cells in CRMP1–/– mice vs 41 ± 1% of BrdU-labeled cells in wild-type) (P < 0.0001) (Fig. 5B) or when the number of BrdU-positive cells per area of EGL section examined (35 ± 1 cells/1.104 mm2 in CRMP1–/– mice vs 55.4 ± 1 cells/1.104 mm2 in wild-type) (P < 0.0001). These results indicated clearly a decrease of granule cell proliferation in CRMP1–/– mice compared to wild-type mice. Moreover, we found a 10.5% decrease in number of total DAPI-labeled cells in the same region of the EGL (424 ± 10 cells vs 473 ± 12 cells) (P < 0.005), a 10% decrease in EGL surface (31418 ± 609 mm2 vs 34837 ± 551 mm2) (P < 0.0001), and a 11.6% decrease in the number of DAPI-labeled cells per 100 mm of EGL (66 ± 1 cells/100 mm vs 75 ± 2 cells/100 mm) (P < 0.005).

To confirm involvement of CRMP1 in granule cell precursor proliferation, we performed an in vitro proliferation assay by incorporation of BrdU in the culture medium of granule cells purified from P5 CRMP1–/– mice vs wild-type. We determined the percentage of proliferating BrdU-labeled cells compared to the number of total DAPI-labeled cells. We observed a 26% decrease in the percentage of proliferating cells in CRMP1–/– mice (14.2 ± 0.6% of cells vs 19.2 ± 0.4% of cells) (P < 0.0001).

Although we observed a clear decrease of granule cell proliferation in CRMP1-deficient cerebellum vs wild-type, we did not detect changes in the cerebellum morphology at P12 and adult CRMP1–/– mice compared to age-matched wild-type mice, suggesting the possibility of a compensatory process. Therefore we explored granule cell apoptosis by the TUNEL-labeling method in the EGL. In P5 animals, we found a 38% decrease in the population density of apoptotic cells in the EGL of CRMP1–/– mice (12.1 ± 1 cells/1.105 µm2 vs 19.4 ± 1 cells/1.105 µm2 in the wild-type) (P < 0.0001) (Fig. 5C). However, in the cerebellum of P12 animals, we did not detect such differences in the number of apoptotic cells between CRMP1–/– mice vs wild-type (not shown).

These results indicate that at P5 in the CRMP1–/– mice, proliferation and apoptosis of granule cells in the EGL were impaired compared to the wild-type mice, leading to a slight decrease in the number of granule cells in EGL of CRMP1–/– mice at P5. The simultaneous decrease of proliferation and apoptosis could be a compensatory process that could lead to a net result of almost normal cerebellum development.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
To investigate the functions of CRMP1 in the central nervous system we generated CRMP1–/– mice. During development, the expression of the knocked-in LacZ showed the highest levels in the olfactory bulb, hypothalamus and cerebellum. The CRMP1–/–mice displayed no macroscopic or obvious microscopic abnormalities. We first focused on postnatal cerebellum development and we demonstrate that CRMP1-deficiency impairs proliferation and apoptosis of granule cell precursors in the EGL. In vitro, migration of granule cells is altered in CRMP1–/– mice vs the wild-type mice. Our data demonstrate a new role of CRMP1 on granular precursor maturation and suggest that CRMP1 contributes to cerebellum development.

CRMP1 is involved in cerebellar granule cell proliferation and apoptosis

During postnatal cerebellum development, extensive proliferation of granular precursor peaks at P5 in the upper strata of the EGL (Fujita 1967). Then, postmitotic granule cells undergo axon extension, and migrate tangentially in the deeper strata of the EGL (Ryder & Cepko 1994; Komuro et al. 2001), and radially through the expanding molecular layer (ML) to reach their final position in the IGL (Rakic et al. 1971; Edmondson & Hatten 1987). CRMP1 is detected in granular cell soma and processes in the upper and deeper strata of the EGL, ML and IGL as early as P5. This is confirmed in vitro by CRMP1 detection in the cytoplasm and processes of purified granule cells from P5 mice cerebellum. Cerebellar CRMP1 expression decreases after P8/P10, in accordance with earlier studies (Wang & Strittmatter 1996; Quach et al. 1997; Byk et al. 1998). In vivo CRMP1 deficiency induces a significant decrease in the number of proliferating cells in the EGL compared to wild-type mice at P5. During this period, a few proliferating or postmitotic granule cells also undergo apoptosis in the EGL (Wood et al. 1993; Tanaka & Marunouchi 1998). We observed a significant decrease in the number of the apoptotic cells in the EGL of P5 CRMP1–/– compared to P5 wild-type mice. This decreased apoptosis may be related to the reduced proliferation. At P12, when proliferation decreases, CRMP1 expression is down-regulated and CRMP1–/– mice cerebellum no longer shows decreased apoptotic cell number in the EGL compared to wild-type mice. So, the resulting net effect of CRMP1 deficiency on granule cell generation/apoptosis may be crucial during the first postnatal week corresponding to the period of maximum granule cell proliferation and CRMP1 expression. It is possible that CRMP1 transduces proliferation and/or apoptosis signals in granule cell precursors, regulating the balance of proliferation and apoptosis. These conclusions are supported by the fact that the induction of CRMP expression precedes in vitro commitment of neurons to apoptosis (Shirvan et al. 1999; Barzilai et al. 2000 Hou et al. 2006), and that CRMP1 is down-regulated in cells undergoing senescence, a loss of proliferative potential (Benvenuti et al. 2002). Moreover, CRMPs are involved in cell proliferation (Tahimic et al. 2006); more precisely, CRMP1 expression level is cell cycle dependent and, in lung adenocarcinoma cell line, CRMP1 is hypothesized to interact with components of the mitotic machinery such as microtubules, to participate in the regulation of cell cycle (Shih et al. 2001). Interestingly, CRMP1 binds to tubulin heterodimers (Fukata et al. 2002) and dysregulation of microtubule dynamics has been reported to be associated to apoptosis after CRMP over-expression in vitro (Gu & Ihara 2000). CRMP1 could therefore control granule cell proliferation and survival by regulating cytoskeleton dynamics.

CRMP1 is involved in granule cell migration from cerebellar explant

Our data demonstrate that CRMP-1 is present in cerebellar granule cells as two bands 64 kDa and 80 kDa, as previously observed in neural progenitors of the olfactory bulb (Veyrac et al. 2005). We showed that CRMP1 deficiency or blockade with specific antibodies induces a significant decrease in the number of granule cells migrating out of cerebellar explants, but does not affect their distance of migration. Indeed, in the explants, granule cells migrate along previously formed bundles of parallel fibers (Vaillant et al. 2003) a mode of movement similar to granule neuron tangential migration in the deeper strata of the EGL (Alcantara et al. 2000; Komuro et al. 2001). We showed that granule cell axonal length is not affected, indicating that decreased migration may not be due to direct alterations of neuritic differentiation. Our data show that CRMP1 deficiency or blockade with specific antibodies induces a significant decrease in the number of cells migrating out of cerebellar explants. Such a reduction in the number of migrating cells might result from an alteration in proliferation and/or migration of premigratory cells. Indeed, a significant reduction of proliferative granule cells is observed in vitro with granular cell cultures derived from CRMP1 deficient mice, as well as in vivo in P5 CRMP1 deficient mice. We cannot exclude a direct effect of CRMP1 deficiency on granule cell migration. In fact, treatment of wild-type cerebellar explants with increasing concentrations of blocking-CRMP1-antibody induces a drastic reduction in the number of migrating cells. Such a major effect is probably not due exclusively to an alteration in cell proliferation for two reasons: firstly, the peak of granule cell proliferation occurs at P5–P6, whereas the explants are derived from P8 cerebellum; secondly, cell proliferation in explants from wild-type mice can only be alterated during a short time window of 48 h when the migration assay is performed. However, in vivo, migration of granule cells in the different layers of the P12 cerebellum is not affected by CRMP1 deficiency, as indicated by similar laminar distribution of migrating granule cells in the cerebellum of CRMP1–/– and wild-type mice. The granule precursor migratory process involves two successive steps starting with the extension of two horizontal processes (the nascent parallel fibers) which underlie tangential migration of a mainly neurophilic type, before proceeding to granule radial migration along Bergmann glial fibers, across the ML (Ramón y Cajal 1911; Nagata & Nakatsuji 1990; Komuro & Rakic 1998; Komuro et al. 2001). In explant cerebellum culture, it has been shown that the migration observed mimics the tangential migration of granule cells within the deeper EGL (Ryder & Cepko 1994; Alcantara et al. 2000). In addition, tangential and radial granule cell migrations are differently affected by distinct adhesion molecules, binding mechanisms and overall distributions (Chuong et al. 1987). Thus, the discrepancy observed between in vivo and in vitro data on the effect of CRMP1 deficiency on granule cell migration might represent a selective effect of CRMP1 on tangential granule cell migration. Furthermore, the in vivo complex microenvironment of granule cells composed of extracellular matrix molecules, adhesion molecules, and growth factors (Hatten 1999) may provide other signals independently of CRMP1, permitting correct radial granule cell migration. CRMP1 can bind to chondroitin sulfate (Franken et al. 2002), an extracellular matrix component, present around the granule cells in the ML of the postnatal developing cerebellum (Aquino et al. 1984), and involved in granule cell migration (Streit et al. 1993). Interestingly, CRMP1 expression has been also linked to migration in lung cancer cell (Shih et al. 2001, 2003). Furthermore, CRMP1 displays sequence homology with Unc-33, a C. elegans protein (Byk et al. 1998) whose mutation causes abnormal axon growth and migration (Hedgecock et al. 1985; Branda & Stern 2000), suggesting that homology of CRMP1 with Unc 33 may reflect aspects of shared function in migration. In vivo, on the other hand, there is marked redundancy of CRMP isoforms such as CRMP2 and CRMP5, present in the cerebellar ML (Ricard et al. 2001). This redundancy could explain the mild phenotype of knockout animals lacking a single CRMP protein since CRMP2 is required for lymphocyte migration (Vincent et al. 2005). Thus, CRMP1 might be involved in some aspect of cerebellar granular migration during development, in relation with other CRMP isoforms.

CRMP proteins can interact with each other and they most probably function as multimers (Wang & Strittmatter 1997; Deo et al. 2004). Along these lines, we previously demonstrated that CRMP1 and CRMP2 are both involved in Sema3A-induced growth cone collapse (Uchida et al. 2005). Consistently, the growth cone responsiveness to Sema3A is attenuated in CRMP1-deficient DRG neurons, when compared to wild-type (unpublished observations). We are currently investigating whether axons and/or dendrites of neurons are affected in the neocortex of CRMP1-deficient mice. In addition, CRMP1 has also been shown to be present in a protein complex with CRMP2 and Rho-kinase (Leung et al. 2002) and CRMP2 interacts with CRMP5 (CRAM) (Mitsui et al. 2002). The demonstrated presence of other CRMPs, expressed at normal levels in the cerebellum of CRMP1–/– mice, could permit proper cerebellum development observed at P12 despite CRMP1 deficiency. However, the spatio-temporal distribution of CRMP1, CRMP2 and CRMP5 in the developing cerebellum appear to be tightly regulated, so that different intracellular associations of CRMP1 with CRMP2 and/or CRMP5 could occur during granule cell development. CRMP1 associated with these distinct CRMPs might then select different downstream signaling pathways. This could confer to the cells different capacities of response to environmental signals, permitting regulation of migration, proliferation and apoptosis during the different stages of granule cell development.

In conclusion, the significant decrease of granule cell proliferation and apoptosis in the EGL of the developing cerebellum, as well as effects on granule cell migration indicate that CRMP1 could serve as an adaptator for assembling protein complexes capable of regulating multifaceted physiological processes during development. The CRMP1 deficient mice will be useful to sort out the precise activity of CRMP isoforms which would explain their involvement in molecular mechanisms of multiple cellular events during development.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
CRMP1–/– mice: construction of targeting vector and screening for targeted ES clones

The CRMP1 genomic fragments were isolated from R1 ES cell DNA by PCR amplification. CRMP1 specific primers with restriction site overhangs, derived from the CRMP1 cDNA sequence, were used to amplify the 3rd and 4th introns with adjacent exon sequences:

CCGCGGCCGCTGGAGGCGAATGGCCGA 3rd exon, forward, Not1 site
GCGTCTAGATTTCTCAAAGGAAGTCAACAAGCTG 4th exon, reverse, Xba1 site
GCGGGATCCGTATGATGGTGTTCGGGAAG 4th exon, forward, BamHI site
CGGCGCGCCGTCGACAGACATCTGGTACAGGTC 5th exon, reverse, Sal1 site

The primer pair 1 and 2 amplified 5kb fragment corresponding to the 3rd intron and the primers 3 and 4 amplified a 3.5 kb segment representing intron 4. Sequencing of the PCR products confirmed their identity and revealed the predicted exon/intron boundaries. The 5 kb and 3.5 kb, 5' and 3' CRMP1 fragments, were then inserted into the pIRES-LacZ-neo cassette (Jones et al. 1997) positioned such that it would disrupt and delete an internal part of the 4th exon of CRMP1 gene. HSV TK gene was added to the 3' end of the construct as a negative selection marker. Not1 linearized vector (25 µg), was electroporated (240 V, 500 uF) into 2 x 107 R1 ES cells (Nagy et al. 1993). The ES cells were selected with 150 µg/mL G418 (active form) and 2 nM GANC. DNA of individual ES colonies was screened by PCR with a forward neo primer: neo5 (primer d): TATCGCCTTCTTGACGAGTTCTTCTGA) and a primer from 5th exon outside of the homologous region used in the vector (primer f): TCACCTGGCTGTCAGACATC. PCR conditions consisted of 36 cycles of 94 °C for 20 s, 60 °C for 40 s, and 72 °C for 3 min 30 s using BRL Taq polymerase. The recombination was reconfirmed on the 3' end using primer neo5 (primer d) and a reverse primer from the 6th exon (primer g): TTTCTGCATGGACTAAGATCA, and on the 5' end using a forward primer from the 3rd exon (primer a): CAGAGGTGGACGCATCA) and a reverse primer from the IRES sequence (primer b): GGGCGGAATTCTCTAGCTAGA).

Generation of CRMP1–/– mice

Targeted ES cells were aggregated with ICR morula and implanted into pseudopregnant female mice (Nagy et al. 1993). Male chimeras were mated initially with ICR female mice to screen for germ-line transmission. A transmitting chimeric male mouse was then bred with 129SvE female mice and their progeny was genotyped with primers derived from the neo gene: neos (n1) and neoas (n2) sequences CCGACCTGTCCGGTGCCCTGAATGAA and TACCGTAAAGCACGAGGAAGCGGTCA, respectively). Homozygous mutant mice were obtained by intercrossing the heterozygotes and screening the progeny with primers neos +neoas (PCR conditions: 36 cycles of 94 °C for 25 s, 60 °C for 40 s, and 72 °C for 1 min) and U3s (primer c), derived from the portion of the 4th exon deleted in the targeted allele (CGAAGCAGCAGACACCAAATC) and U3as (primer e), reverse primer from the 4th intron (TGAAACAGGAGTGCATCCTTC) (PCR conditions). These two sets of primers were then used for all further genotyping.

All procedure were conducted in accordance with NIH guide-lines concerning the Care and Use of Laboratory Animals and with the approval of the Animal Care Committee of the Ohio State University.

Southern blot analysis

Genomic DNA (10 µg) was digested with restriction enzymes, separated on an agarose gel and transferred to a nylon membrane. Hybridization with a 32P-labeled probe was performed according to standard methods at 65 °C overnight. The probe corresponded to the 1.1 kb sequence of the 2nd intron of the CRMP1 gene (BamHI/Nco1 fragment of the 3.4 kb 2nd intron, sequence not shown).

LacZ staining

The brains were fixed by intracardial perfusion of 3% paraformaldehyde in saline phosphate buffer (PBS) after general anesthesia with avertin and postfixed in the same fixative for 4 h. Cryostat sections were made from a fixed tissue incubated overnight in 30% sucrose. The targeting vector contains the LacZ reporter gene inserted in, and replacing part of the fourth exon of CRMP1 gene, so LacZ staining (detection of ß-galactosidase) reports CRMP1 expression. The sections were stained with the LacZ solution containing 1 mg/mL 5-bromo-4chloro-3inodyl-D-galactosidase, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl2 in PBS, at 37 °C for 8–12 h. For the whole-mount staining, the tissue was stained with the LacZ solution overnight.

The sections were incubated with the primary antibody followed by 1 h incubation with biotinylated anti-rabbit immunoglobulin and peroxidase-labeled streptavidin (ABC kit, Vector Laboratories, Burlingame, CA, USA).

CRMP1 antibodies

The peptides chosen to generate specific antisera were LTSFEKWHEAADTKS (amino acids 117–131) for anti-CRMP1 LTS, and ATPKYATPAPSAKSS (amino acids 508–522) for anti-CRMP1 ATP. The synthetic peptides were conjugated to keyhole limpet hemocyanin and used to immunize rabbits (Honnorat et al. 1999). The antibodies were purified from antisera using the corresponding immobilized peptide. As previously shown, antibodies were specific for CRMP1 and were incorporated into cells (Ricard et al. 2001).

Protein samples and Western-blot analysis

Tissues from CRMP1–/– and wild-type (wt) mice were sonicated in 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.2% Triton X-100, 10 µg/mL of leupeptin, 5 µg/mL of pepstatin, 10 µg/mL of aprotinin, then centrifugated for 10 min at 2000 g at 4 °C. The protein in the supernatant was diluted to a concentration of 2 mg/mL. Western blot was performed as previously described with anti-CRMP1 ATP, CRMP2, CRMP3, CRMP4, or CRMP5 antibodies (Ricard et al. 2001).

Immunohistochemistry

Wild-type and CRMP1–/– mice at P5 (postnatal day 5), P8 and P12 were analyzed. The animals were deeply anesthetized with sodium pentobarbital and perfused intracardially with 4% paraformaldehyde in 0.1 M phosphate buffer (PB). The brains were removed and postfixed in 4% paraformaldehyde for 12 h. After three rinses and overnight cryoprotection in PB/sucrose 20%, the brains were frozen at –60 °C. Saggital cryostat sections (10 µM thick) were collected on Superfrost Plus slides (Polylabo, Strasbourg, France) and stored at –20 °C until required. Sections were permeabilized in PBS/1% gelatin/0.1% Triton X-100 and incubated overnight at room temperature with anti-CRMP1 ATP antibodies (2 µg/mL). Bound antibodies were detected using an Alexa-coupled goat anti-rabbit IgG antibody (1 : 400, Molecular Probes, Eugene, OR, USA). Sections were finally viewed using an epifluorescence Zeiss microscope.

In situ hybridization

Sense or anti-sense digoxigenin-labeled riboprobes were generated by transcription of mouse CRMP1 cDNA (GENBANK accession number Y09080) in pBluescript SK, using the T3 or T7 promoters and labeling with digoxigenin UTP (Roche Molecular Biochemicals, Meylan, France), following the manufacturer's instructions. Brain tissue sections were prepared as described for immunohistochemistry, then treated with the sense and anti-sense riboprobes as previously described (Ricard et al. 2001). No signal was detected using the sense probes.

Purified granule cell culture

Cerebellar granule cells were prepared from 5- or 8-day-old wild-type, CRMP1-deficient or C57Bl/6 J (Charles River, France) mice. Cerebella were excised, the cortices dissected in Gey's balanced salt solution (GBSS, InVitrogen, Cergy-Pontoise, France) containing 0.65% glucose, and placed in CMF-PBS buffer. The tissue was dissociated by trituration in a basal medium eagle solution (InVitrogen) containing 0.05% DNAse and 0.33% glucose, and then centrifuged for 4 min at 1112 r.p.m. Cell suspension was loaded on top of a Percoll step gradient 35% to 60% in CMF-PBS buffer containing 0.2% glucose and 2.5 mM EDTA and then centrifuged for 30 min at 3000 r.p.m. Cells at the 35 : 60% interface were collected were resuspended in Dulbecco's modified Eagle's Medium (DMEM, InVitrogen) supplemented with 0.1% glucose, 0.05% bovine serum albumin, B27, N2 (InVitrogen) and containing DNAse, preplated in a Petri dish coated with 100 µg/mL poly L-lysine (Sigma, L’Isle d’Abeau, France) and incubated for 15 min. Granule cells were dislodged by gentle pipetting and centrifuged for 3 min at 1112 r.p.m. For immunolabeling of freshly purified granule cells, the cell suspension was diluted in PBS, centrifuged for 5 min at 1112 r.p.m., and fixed in 4% paraformaldehyde for 30 min at room temperature.

Immunocytochemistry was performed with anti-CRMP1 ATP antibodies (2 µg/mL) and monoclonal antibodies against ß III tubulin (1 : 400, Sigma), then Alexa-coupled goat anti-rabbit IgG and goat anti-mouse IgG antibodies (1 : 400, Molecular Probes, Eugene, OR, USA). Cells were finally counterstained with a fluorescent nuclear marker DAPI (0.08 µg/mL, Roche, Meylan, France).

For granule cell cultures, cells were resuspended in DMEM supplemented with 0.1% glucose, 10% horse serum and 5% fetal bovine serum, plated at a density of 1.106 cells/mL in 400 µL plates coated with laminin and poly L-lysine, and incubated for 48 h. Cultures were fixed in 4% paraformaldehyde for 30 min, and washed in PBS.

Cerebellar explant cultures and quantification

Cerebella from P8 wild-type or CRMP1–/– mice were removed and the cortices dissected in GBSS containing 0.65% glucose. To optimize the homogeneity of explant shape, the vermis was selected and placed on a Mcllwain tissue chopper, and then cut into 200 µM thick pieces. The explants were plated on laminin/poly L-lysine coated sterile coverslips and grown in 2 mL of 50% Eagle's basal medium, 25% horse serum, 25% Hank's balanced salt solution, 0.65% glucose, 0.4% methylcellulose, supplemented with 100 µM glutamine (InVitrogen). After 48 h, the cultures were washed in PBS, and fixed in 4% paraformaldehyde for 48 h at 4 °C. Immunocytochemistry was performed on few explants as described for purified granule cells. In experiments designed to determine the effect of CRMP1 deficiency, explants were grown in the presence of anti-CRMP1 ATP antibodies at 1, 5 or 10 µg/mL or preimmune IgG at 10 µg/mL.

Only explants showing radial and symmetrical outgrowth of processes were used for quantification. To quantify cell migration, we visualized explants with an inverted microscope (Zeiss Axovert) equipped with x10 and x20 phase-contrast objectives, and counted individual cells migrating out of the explant core (110 explants were observed for wild-type mice and 91 for CRMP1-deficient and a minimum of 38 explants were observed per condition for antibodies experiments). The results were confirmed in at least two independent experiments. To quantify migration distance of cells, the explant images were digitized using Metamorph software, and a computer-generated grid, composed of 0–150, 150–300 µM bins starting from the outward rim of the core of the explant was superimposed on each image. The number of cells that fell within these bins was counted for each side of explant and the data were averaged for each explant (20 explants were observed for wild-type mice and 16 for CRMP1-deficient) and we calculated the percentages of cells having migrated less than 105 µM compared to the total number of migrating cells. To quantify axonal outgrowth, we measured the length of the six longest individual fibers extending radially from each explant using Metamorph software, then averaged the data per explant (18 explants were observed for wild-type mice and 16 for CRMP1-deficient).

Statistical analysis was performed using Student's test or a one-way ANOVA followed by the Fischer's PLSD test, with a P-value of < 0.05 being considered statistically significant.

BrdU labeling and quantification

To determine granule cell proliferation in vivo, P5 wild-type (seven animals) and CRMP1–/– (eight animals) mice were injected intraperitoneally with 5-bromodeoxyuridine (BrdU, 50 mg/kg body weight) 1 h before sacrifice. To study the time-course of granule cell migration in vivo, P10 wild-type (five animals) and CRMP1–/– (seven animals) mice were injected intraperitoneally with BrdU (50 mg/kg body weight) 48 h before sacrifice. Brain tissue sections through the medial cerebellar vermis were then prepared as described for immunohistochemistry. After washing in PBS, the sections were heated for 3 x 5 min in 10 mM citrate buffer, pH 6, in a microwave oven, then left to cool for 30 min at room temperature. Following 1 h permeabilization in PBS containing 1% bovine serum albumin and 0.3% Triton X-100, the sections were incubated overnight with a rat monoclonal antibody against BrdU (1 : 100, Oxford Biotechnology Ltd, UK), then for 2 h with Alexa-coupled goat anti-rat IgG antibody (Molecular probes, Eugene, OR, USA). The sections were finally counterstained with the fluorescent nuclear marker DAPI, and viewed using a epifluorescent Zeiss microscope equipped with an appropriate filter set. To perform quantitative analysis of granule cell proliferation on P5 mice, we selected a region of the cerebellar vermis (lobule V–VI). We assessed the total number of granule cells (DAPI-labeled nucleus) and the number of BrdU-labeled granule cells in the External Granule cell Layer (EGL) of wild-type and CRMP1-deficient mice at x40 magnification. The length and surface of the EGL were also quantified for each field; we express the percentage of BrdU-labeled cell per total number of DAPI-labeled cells, the density of BrdU-labeled cells per 1.104 µm2 of EGL, and the number of total-DAPI cells per 100 µM of EGL. For each animal analyzed, five sections were quantified to calculate the average. Statistical analysis was performed using Student's test, with a P-value of < 0.05 being considered statistically significant. To perform quantitative analysis of the time course of granule cell migration on P12 mice, we assessed the total number of BrdU labeled cells in the EGL, the Molecular Layer (ML) + Purkinje cell Layer (PL) and the Internal Granule cell Layer (IGL) spanning the posterior bank of the fissure between the lobules V and VI. Percentages of migrating granule cells in each layer were calculated by dividing the number of BrdU labeled cells in the layer by the total number of BrdU positive cells in EGL +ML +PL +IGL. For each animal analyzed, five sections were quantified to calculate the average and statistical analysis was performed using Student's test.

Apoptosis assay

Cell death in the developing cerebellum was assessed by the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) method using the Apoptosis Detection System kit provided by Promega (Charbonnières, France) according to the manufacter's instructions. The sections were counterstained with DAPI. Labeled cells were counted over the entire EGL of five adjacent sections. The corresponding EGL area was also measured to calculate the density of apoptotic cells per 1.105 µm2 of EGL. Statistical analysis was performed using Student's test.

In vitro proliferation assay

Granule cells were purified from cerebellum of P5 CRMP1–/– (three animals) and wild-type (three animals) mice as described above. Cells were resuspended in DMEM supplemented with 0.1% glucose, 10% horse serum, plated at a density of 8.105 cells/mL in 500 µL plates (five per animal), coated with laminin and poly L-lysine, and incubated for 2 h before addition of 20 µg/mL BrdU. After 3 h of incubation, cells were washed in PBS, fixed in 4% paraformaldehyde for 30 min, immunolabeled for BrdU, and counterstained with the fluorescent nuclear marker DAPI. BrdU labeled and total DAPI cells were counted at x20 magnification; five fields per plate and five plates per animal were counted, and the data were averaged. Statistical analysis was performed using Student's test.


    Acknowledgements
 
This work was supported by Institut National de la Santé et de la Recherche Medicale (INSERM) and grants from the Lique contre le Cancer, the Association pour la Recherche contre le Cancer (ARC) and the Association Française contre les Myopathies (AFM) and from Region Rhône Alpes. Part of this work was done at the W.M. Keck Genetic Research Facility, the Ohio State University.


    Footnotes
 
Communicated by: Hideyuki Okano

aThese authors contributed equally to this work Back

* Correspondence: E-mail: thomasse{at}lyon.inserm.fr or pk{at}mail.ucf.edu


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Alcantara, S., Ruiz, M., De Castro, F., Soriano, E. & Sotelo, C. (2000) Netrin 1 acts as an attractive or as a repulsive cue for distinct migrating neurons during the development of the cerebellar system. Development 127, 1359–1372.[Abstract]

Aquino, D.A., Margolis, R.U. & Margolis, R.K. (1984) Immunocytochemical localization of a chondroitin sulfate proteoglycan in nervous tissue. J. Cell Biol. 99, 1117–1139.[Abstract/Free Full Text]

Arimura, N., Menager, C., Fukata, Y. & Kaibuchi, K. (2004) Role of CRMP-2 in neuronal polarity. J. Neurobiol. 8, 34–47.

Barzilai, A., Zilkha-Falb, R., Daily, D., Stern, N., Offen, D., Ziv, I., Melamed, E. & Shirvan, A. (2000) The molecular mechanism of dopamine-induced apoptosis: identification and characterization of genes that mediate dopamine toxicity. J. Neural Transm. 60 (Suppl.), 59–76.

Benvenuti, S., Cramer, R., Bruce, J., Waterfield, M.D. & Jat, P.S. (2002) Identification of novel candidates for replicative senescence by functional proteomics. Oncogene 21, 4403–4413.[CrossRef][Medline]

Branda, C.S. & Stern, M.J. (2000) Mechanisms controlling sex myoblast migration in Caenorhabditis elegans hermaphrodites. Dev. Biol. 226, 137–151.[CrossRef][Medline]

Byk, T., Ozon, S. & Sobel, A. (1998) The Ulip family phosphoproteins. Eur. J. Biochem. 254, 14–24.[Medline]

Castegna, A., Aksenov, M., Thongboonkerd, V., Klein, J.B., Pierce, W.M., Booze, R., Markesbery, W.R. & Butterfield, D.A. (2002) Proteomic identification of oxidatively modified proteins in Alzheimerís disease brain. Part II: dihydropyrimidinase-related-protein 2, {alpha}-enolase and heat shock cognate 71. J. Neurochem. 82, 1524–1532.[CrossRef][Medline]

Charrier, E., Reibel, S., Rogemond, V., Aguera, M., Thomasset, N. & Honnorat, J. (2003) Collapsin response mediator proteins (CRMPs): involvement in nervous system development and adult neurodegenerative disorders. Mol. Neurobiol. 28, 51–64.[CrossRef][Medline]

Chuong, C.M., Crossin, K.L. & Edelman, G.M. (1987) Sequential expression and differential function of multiple adhesion molecules during the formation of cerebellar cortical layers. J. Cell Biol. 104, 331–342.[Abstract/Free Full Text]

Deo, R.C., Schmidt, E.F., Elhabazi, A., Togashi, H., Burley, S.K. & Strittmatter, S.M. (2004) Structural bases for CRMP function in plexin-dependent semaphorin3A signaling. EMBO J. 23, 9–22.[CrossRef][Medline]

Edmondson, J.C. & Hatten, M.E. (1987) Glial-guided granule neuron migration in vitro: a high-resolution time-lapse video microscopic study. J. Neurosci. 7, 1928–1934.[Abstract]

Franken, S., Junghans, U., Rosslenbroich, V., Baader, S.L., Hoffmann, R., Gieselmann, V., Viebahn, C. & Kappler, J. (2002) Collapsin response mediator proteins of neonatal brain interact with chondroitin sulfate. J. Biol. Chem. 278, 3241–3250.[Medline]

Fujita, S. (1967) Quantitative analysis of cell proliferation and differentiation in the cortex of the postnatal mouse cerebellum. J. Cell Biol. 32, 277–287.[Abstract/Free Full Text]

Fukata, Y., Itoh, T.J., Kimura, T., Menager, C., Nishimura, T., Shiromizu, T., Watanabe, H., Inagaki, N., Iwamatsu, A., Hotani, H. & Kaibuchi, K. (2002) CRMP-2 binds to tubulin heterodimers to promote microtubule assembly. Nat. Cell Biol. 4, 583–591.[Medline]

Goshima, Y., Nakamura, F., Strittmatter, P. & Strittmatter, S.M. (1995) Collapsin-induced growth cone collapse mediated by an intracellular protein related to UNC-33. Nature 376, 509–514.[CrossRef][Medline]

Gu, Y. & Ihara, Y. (2000) Evidence that CRMP2 is involved in the dynamics of microtubules. J. Biol. Chem. 275, 17917–17920.[Abstract/Free Full Text]

Hatten, M.E. (1999) Central nervous system neuronal migration. Annu. Rev. Neurosci. 22, 511–539.[CrossRef][Medline]

Hedgecock, E.M., Culotti, J.G., Thomson, J.N. & Perkins, L.A. (1985) Axonal guidance mutants of Caenorhabditis elegans identified by filling sensory neurons with fluorescein dyes. Dev. Biol. 111, 158–170.[CrossRef][Medline]

Honnorat, J., Byk, T., Kusters, I., Aguera, M., Ricard, D., Rogemond, V., Quach, T., Aunis, D., Sobel, A., Mattei, M.G., Kolattukudy, P., Belin, M.F. & Antoine, J.C. (1999) Ulip/CRMP proteins are recognized by autoantibodies in paraneoplasic neurological syndromes. Eur. J. Neurosci. 11, 4226–4232.[CrossRef][Medline]

Hou, S.T., Jiang, S.X., Desbois, A., Huang, D., Kelly, J., Tessier, L., Karchewski, L. & Kappler, J. (2006) Calpain-cleaved collapsin response mediator protein-3 induces neuronal death after glutamate toxicity and cerebral ischemia. J. Neurosci. 26, 2241–2249.[Abstract/Free Full Text]

Hu, Y., Ippolito, J.E., Garabedian, E.M., Humphrey, P.A. & Gordon, J.I. (2002) Molecular characterization of a metastatic neuroendocrine cell cancer arising in the prostates of transgenic mice. J. Biol. Chem. 227, 44462–44474.

Inagaki, N., Chihara, K., Arimura, N., Menager, C., Kawano, Y., Matsuo, N., Nishimura, T., Amano, M. & Kaibuchi, K. (2001) CRMP-2 induces axons in cultured hippocampal neurons. Nat. Neurosci. 4, 781–782.[CrossRef][Medline]

Ito, T., Kagoshima, M., Sasaki, Y., Li, C., Udaka, N,. Kitsukawa, T., Fujisawa, H., Taniguchi, M., Yagi, T., Kitamura, H. & Goshima, Y. (2000) Repulsive axon guidance molecule Sema3A inhibits branching morphogenesis of fetal mouse lung. Mech. Dev. 97, 35–45.[CrossRef][Medline]

Jones, A., Korpi, E.R., McKernan, R.M., Pelz, R., Nusser, Z., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J. & Wisden, W. (1997) Ligand-gated ion channel subunit partnerships: GABAA receptor {alpha}6 subunit gene inactivation inhibits {delta} subunit expression. J. Neurosci. 17, 1350–1362.[Abstract/Free Full Text]

Komuro, H. & Rakic, P. (1998) Distinct modes of neuronal migration in different domains of developing cerebellar cortex. J. Neurosci. 18, 1478–1490.[Abstract/Free Full Text]

Komuro, H., Yacubova, E., Yacubova, E. & Rakic, P. (2001) Mode and tempo of tangential cell migration in the cerebellar external granular layer. J. Neurosci. 21, 527–540.[Abstract/Free Full Text]

Leung, T., Ng, Y., Cheong, A., Ng, C.H., Tan, I., Hall, C. & Lim, L. (2002) p80 ROKalpha binding protein is a novel variant of CRMP1 which associates with CRMP2 and modulates Rho-A-induced neuronal morphology. FEBS Lett. 523, 445–449.

Luo, Y., Raible, D. & Raper, J.A. (1993) Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75, 217–227.[CrossRef][Medline]

Mitsui, N., Inatome, R., Takahashi, S., Goshima, Y., Yamamura, H. & Yanagi, S. (2002) Involvement of Fes/Fps tyrosine kinase in semaphorin3A signaling. EMBO J. 21, 3274–3285.[CrossRef][Medline]

Nagata, I. & Nakatsuji, N. (1990) Granule cell behavior on laminin in cerebellar microexplant cultures. Brain Res. Dev. Brain Res. 52, 63–73.[CrossRef][Medline]

Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J.C. (1993) Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. USA 90, 8424–8428.[Abstract/Free Full Text]

Quach, T.T., Rong, Y., Belin, M.F., Duchemin, A.M., Akaoka, H., Ding, S., Baudry, M., Kolattukudy, P.E. & Honnorat, J. (1997) Molecular cloning and expression of a new unc-33 like cDNA from rat brain and its relation to paraneoplastic neurological syndromes. Brain Res. Mol. Brain Res. 46, 329–332.[Medline]

Quach, T.T., Duchemin, A.M., Rogemond, V., Duchemin, A.M., Akaoka, H., Ding, S., Baudry, M., Kolattukudy, P.E. & Honnorat, J. (2004) Involvement of collapsin response mediator proteins in the neurite extension induced by neurotrophins in dorsal root ganglion neurons. Mol. Cell. Neurosci. 25, 433–443.[CrossRef][Medline]

Rakic, P. (1971) Neuron-glia relationship during granule cell migration in developing cerebellar cortex. A Golgi and electronmicroscopic study in Macacus Rhesus. J. Comp. Neurol. 141, 283–312.[CrossRef][Medline]

Ramón y Cajal, S. (1911) Histologie Du Système Nerveux de L’homme et Des Vertbrès. Paris, France: A. Maloine.

Ricard, D., Rogemond, V., Charrier, E., Duchemin, A.M., Akaoka, H., Ding, S., Baudry, M., Kolattukudy, P.E. & Honnorat, J. (2001) Isolation and expression pattern of human Unc-33-Like Phosphoprotein 6/Collapsin Response Mediator Protein 5 (Ulip6/CRMP5): coexistence with Ulip2/CRMP2 in Sema3A-sensitive oligodendrocytes. J. Neurosci. 21, 7203–7214.[Abstract/Free Full Text]

Ryder, E.F. & Cepko, C.L. (1994) Migration patterns of clonally related granule cells and their progenitors in the developing chick cerebellum. Neuron. 12, 1011–1028.[CrossRef][Medline]

Shih, J.Y., Yang, S.C., Hong, T.M., Yuan, A., Chen, J.J., Yu, C.J., Chang, Y.L., Lee, Y.C., Peck, K., Wu,C.W. & Yang, P.C. (2001) Collapsin response mediator protein-1 and the invasion and metastasis of cancer cells. J. Natl. Cancer Inst 93, 1392–1400.[Abstract/Free Full Text]

Shih, J.Y., Lee, Y.C., Yang, S.C., Hong, T.M., Huang, C.Y. & Yang, P.C. (2003) Collapsin response mediator protein-1: a novel invasion-suppressor gene. Clin. Exp Metastasis 20, 69–76.[CrossRef][Medline]

Shirvan, A., Ziv, I., Fleminger, G., Shina, R., He, Z., Brudo, I., Melamed, E. & Barzilai, A. (1999) Semaphorins as mediators of neuronal apoptosis. J. Neurochem. 73, 961–971.[CrossRef][Medline]

Streit, A., Nolte, C., Rasony, T. & Schachner, M. (1993) Interaction of astrochondrin with extracellular matrix components and its involvement in astrocyte process formation and cerebellar granule cell migration. J. Cell Biol. 120, 799–814.[Abstract/Free Full Text]

Tahimic, C.G., Tomimatsu, N., Nishigaki, R., Fukuhara, A., Toda, T., Kaibuchi, K., Shiota, G., Oshimura, M. & Kurimasa, A. (2006) Evidence for a role of Collapsin response mediator protein-2 in signaling pathways that regulate the proliferation of non-neuronal cells. Biochem. Biophys. Res. Commun. 340, 1244–1250.[CrossRef][Medline]

Tanaka, M. & Marunouchi, T. (1998) Immunohistochemical analysis of developmental stage of external granular layer neurons which undergo apoptosis in postnatal rat cerebellum. Neurosci. Lett. 242, 85–88.[CrossRef][Medline]

Uchida, Y., Oshima, T., Sasaki, Y., Suzuki, H., Yanai, S., Yamashita, N., Nakamura, F., Takei, K., Ihara, Y., Mikoshiba, K., Kolattukudy, P., Honnorat, J. & Goshima, Y. (2005) Semaphorin3A signalling is mediated via sequential Cdk5 and GSK3ß phosphorylation of CRMP2: implication of common phosphorylating mechanism underlying axon guidance and Alzheimer's disease. Genes Cells 10, 165–179.[Abstract/Free Full Text]

Vaillant, C., Meissirel, C., Mutin, M., Belin, M.F., Lund, L.R. & Thomasset, N. (2003) MMP-9 deficiency affects axonal outgrowth, migration, and apoptosis in the developing cerebellum. Mol. Cell. Neurosci. 24, 395–408.[CrossRef][Medline]

Veyrac, A., Giannetti, N., Charrier, E., Reymond-Marron, I., Aguera, M., Rogemond, V., Honnorat, J. & Jourdan, F. (2005) Expression of collapsin response mediator proteins 1, 2 and 5 is differentially regulated in newly generated and mature neurons of the adult olfactory system. Eur. J. Neurosci. 21, 2635–2648.[CrossRef][Medline]

Vincent, P., Collette, Y., Marignier, R., Vuaillat, C., Rogemond, V., Davoust, N., Malcus, C., Cavagna, S., Gessain, A., Machuca-Gayet, I., Belin, M.F., Quach, T. & Giraudon, P. (2005) A role for the neuronal protein collapsin response mediator protein 2 in T lymphocyte polarization and migration. J. Immunol. 175, 7650–7660.[Abstract/Free Full Text]

Wang, L.H. & Strittmatter, S.M. (1996) A family of rat CRMP genes is differentially expressed in the nervous system. J. Neurosci. 16, 6197–6207.[Abstract/Free Full Text]

Wang, L.H. & Strittmatter, S.M. (1997) Brain CRMP forms heterotetramers similar to liver dihydropyrimidinase. J. Neurochem. 69, 2261–2269.[Medline]

Wood, K.A., Dipasquale, B. & Youle, R.J. (1993) In situ labeling of granule cells for apoptosis-associated DNA fragmentation reveals different mechanisms of cell loss in developing cerebellum. Neuron 11, 621–632.[CrossRef][Medline]

Yoshida, H., Watanabe, A. & Ihara, Y. (1998) CRMP-2 is associated with neurofibrillary tangles in Alzheimer's disease. J. Biol. Chem. 273, 9761–9768.[Abstract/Free Full Text]

Yoshimura, Y., Shinkawa, T., Taoka, M., Kobayashi, K., Isobe, T. & Yamauchi, T. (2002) Identification of protein substrates of Ca2+/calmodulin-dependent protein kinase II in the postsynaptic density by protein sequencing and mass spectrometry. Biochem. Biophys. Res. Commun. 290, 948–954.[CrossRef][Medline]

Yuasa-Kawada, J., Suzuki, R., Kano, F., Ohkawara, T., Murata, M. & Noda, M. (2003) Axonal morphogenesis controlled by antagonistic roles of two CRMP subtypes in microtubule organization. Eur. J. Neurosci. 17, 2329–2343.[CrossRef][Medline]

Received: 14 April 2006
Accepted: 7 August 2006




This article has been cited by other articles:


Home page
J. Neurosci.Home page
L. Duplan, N. Bernard, W. Casseron, K. Dudley, E. Thouvenot, J. Honnorat, V. Rogemond, B. De Bovis, P. Aebischer, P. Marin, et al.
Collapsin Response Mediator Protein 4a (CRMP4a) Is Upregulated in Motoneurons of Mutant SOD1 Mice and Can Trigger Motoneuron Axonal Degeneration and Cell Death
J. Neurosci., January 13, 2010; 30(2): 785 - 796.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Yamashita, A. Morita, Y. Uchida, F. Nakamura, H. Usui, T. Ohshima, M. Taniguchi, J. Honnorat, N. Thomasset, K. Takei, et al.
Regulation of Spine Development by Semaphorin3A through Cyclin-Dependent Kinase 5 Phosphorylation of Collapsin Response Mediator Protein 1
J. Neurosci., November 14, 2007; 27(46): 12546 - 12554.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K.-Y. Su, W.-L. Chien, W.-M. Fu, I-S. Yu, H.-P. Huang, P.-H. Huang, S.-R. Lin, J.-Y. Shih, Y.-L. Lin, Y.-P. Hsueh, et al.
Mice Deficient in Collapsin Response Mediator Protein-1 Exhibit Impaired Long-Term Potentiation and Impaired Spatial Learning and Memory
J. Neurosci., March 7, 2007; 27(10): 2513 - 2524.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. Yamashita, Y. Uchida, T. Ohshima, S.-i. Hirai, F. Nakamura, M. Taniguchi, K. Mikoshiba, J. Honnorat, P. Kolattukudy, N. Thomasset, et al.
Collapsin Response Mediator Protein 1 Mediates Reelin Signaling in Cortical Neuronal Migration
J. Neurosci., December 20, 2006; 26(51): 13357 - 13362.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Charrier, E.
Right arrow Articles by Kolattukudy, P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Charrier, E.
Right arrow Articles by Kolattukudy, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS