|
|
||||||||
1 Departments of Chemistry and
2 Bioscience, Faculty of Science, Shizuoka University, 836 Oya Suruga-ku Shizuoka, 422-8529 Japan
3 Laboratory of Cell Regulation, Cancer Research UK London Research Institute, Lincoln's Inn Fields Laboratories, 44 Lincoln's Inn Fields, London WC2A 3PX, UK
| Abstract |
|---|
|
|
|---|
tor2ts double mutant cells show distinct phenotypes, as the cells cease division with normal cell size in the absence of G1 arrest. Tor2 physically interacts with the conserved Rhb1/GTPase. Intriguingly, over-expression of rhb1+ or deletion of Rhb1-GAP-encoding tsc2+ is capable of rescuing stress-sensitive phenotypes of the tor1 mutant, implying that Tor1 and Tor2 also share functions in cell survival under adverse environment. We propose that Tor1 and Tor2 are involved in both corroborative and independent roles in nutrient sensing and stress response pathways. | Introduction |
|---|
|
|
|---|
2000 amino acids) consists of stretches of HEAT repeats, which mediate proteinprotein interactions (Kunz et al. 2000; Perry & Kleckner 2003). The following C-terminal
500 amino acid residues contain the FAT domain, also involved in proteinprotein interactions (Alarcon et al. 1999; Bosotti et al. 2000), the FKBP12-rapamycin binding (FRB) domain (Zheng et al. 1995) and the kinase catalytic domain, which is highly homologous to phosphoinositide (PI)-3 and PI-4 kinases. Finally, the very C-terminal 33 residues of TOR form the FATC domain, which is reported to be indispensable for TOR function both in vivo and in vitro (Peterson et al. 2000; Takahashi et al. 2000). In the cell, TOR forms two distinct complexes, TOR complex 1 (TORC1) and TOR complex 2 (TORC2). These complexes contain several non-TOR components, in which some of them are shared in common (e.g. Lst8), while others are specific for either TORC1 (e.g. raptor) or TORC2 (e.g. rictor and Avo3) (Hara et al. 2002; Kim et al. 2002; Loewith et al. 2002; Jacinto et al. 2004; Sarbassov et al. 2004). Unlike most of the other higher eukaryotes that contain a single-copy ortholog, Saccharomyces cerevisiae has two TOR proteins, Tor1 and Tor2, in which Tor1 is nonessential while Tor2 is essential for growth (Heitman et al. 1991; Helliwell et al. 1994). Both Tor1 and Tor2 are included in TORC1, while only Tor2 is incorporated into TORC2. It is shown that TORC1 mediates the rapamycin-sensitive signaling branch, while TORC2 is rapamycin-insensitive. In budding yeast, binding of the Rapamycin-FKBP12 complex to TORC1, a mode of action that is conserved from yeast to human, inhibits the TOR kinase activity and elicits a number of responses that appear to mimic nitrogen starvation response (Loewith et al. 2002; Jacinto & Hall 2003). On the other hand, rapamycin-insensitive TORC2 is required for the organization of the actin cytoskeleton (Jacinto et al. 2004).
|
Recent evidence indicates that the tuberous sclerosis complex (a TSC1/TSC2 heterodimer) acts as a negative regulator of mTOR (Gao et al. 2002; Inoki et al. 2002; Tee et al. 2002). The inhibition of TOR signaling by the TSC complex is attributed to the ability of the TSC complex to act as a specific GTPase activating protein (GAP) for the small GTPase Rheb (Inoki et al. 2003; Saucedo et al. 2003; Stocker et al. 2003; Tee et al. 2003; Zhang et al. 2003). In line with this notion, transient expression of Rheb leads to the TOR-mediated phosphorylation of 4E-BP1, indicating that Rheb activates TOR. Indeed, human Rheb is able to interact with mTOR (Long et al. 2005).
Despite its excellence as a model system, budding yeast does not contain TSC1/2-GAP. Also the mutant of the RHEB counterpart, RHB1, is neither essential nor the rhb1 mutant mimics TOR inactivation (Urano et al. 2000). This may suggest that the molecular pathways that control TOR signaling might not be identical between budding yeast and mammals. It is therefore important to characterize another simple system by which to investigate evolutional conservations of TOR systems. Fission yeast Schizosaccharomyces pombe might fill this gap, as this organism possesses, in addition to tor1+ and tor2+, the RHEB gene, rhb1+, which is essential for cell viability, and TSC1 and TSC2 orthologs (Mach et al. 2000; Kawai et al. 2001; Weisman & Choder 2001; Matsumoto et al. 2002; van Slegtenhorst et al. 2004). Moreover, components of TORC including Mip1 (Kog1/raptor), Sin1 (Avo1), Ste20 (Avo3/rictor), and Wat1/Pop3 (Lst8) have been identified and characterized to some extent (Kemp et al. 1997; Hilti et al. 1999; Wilkinson et al. 1999; Shinozaki-Yabana et al. 2000; Ochotorena et al. 2001).
Studies in our laboratory as well as others have shown that, as in budding yeast, tor1+ is not essential for growth while tor2+ is essential. The null mutant for tor1+(tor1
) has defects in cell survival under various stress conditions such as high osmolarity, low and high pH, high temperature, and certain drugs including hydroxyurea (Kawai et al. 2001; Weisman & Choder 2001). The deletion mutant is also defective in the nitrogen-starvation response, in which on nitrogen depletion, unlike wild-type cells, tor1
cells fail to arrest the cell cycle at G1, which is a prerequisite for sexual development. As a result, tor1
is sterile. Tor1 has been shown to phosphorylate and activate an AGC kinase/S6K Gad8 (Matsuo et al. 2003), which regulates the growth under stress conditions and the nitrogen-starvation response through unknown mechanisms. In contrast to the knowledge of Tor1, the cellular functions of Tor2 remain to be studied (Kawai et al. 2001; Weisman & Choder 2001).
In order to dissect the physiological roles of Tor2, we created temperature-sensitive tor2 mutants and characterized these phenotypes. We present evidence that tor2 mutants mimic the nitrogen-starvation response at the restrictive temperature, suggesting that Tor2 is a key molecule that senses a nitrogen source, thereby allowing cell proliferation under nutrient-rich conditions. Furthermore, both biochemical and genetic analyses indicate that Rhb1 and Tor2 act in the same pathway that corroborates with Tor1.
| Results |
|---|
|
|
|---|
To create tor2 temperature sensitive mutants, PCR-based mutagenesis was carried out that targeted the C-terminal region containing the kinase and FATC domains (Fig. 1A, upper). Two temperature sensitive mutants were obtained, and nucleotide sequencing analysis revealed that they constitute different tor2 alleles, referred to as tor2ts-13 and tor2ts-19, respectively. Both tor2ts-13 and tor2ts-19 mutants grew normally on rich YE5S plates when cultured at 26 °C, but they did not form colonies at 36 °C (Fig. 1B).
Three amino acid changes were found in tor2ts-13: Cys2163 to Arg, Ile2280 to Val and Gln2305 to Leu. Arg2163 was situated in the highly conserved kinase domain, while Val2280 and Leu2305 were present in a gap region between the kinase domain and the FATC domain (Fig. 1A, lower). In tor2ts-19, there were two mutation sites: Ile2241 to Thr, and Ser2293 to Pro. Thr2241 was present in a gap region and Pro2293 located in the FATC domain. This suggests that the gap region and the FATC domain as well as the kinase domain are critical for Tor2 activity and cell survival.
tor2ts mutants display G1-cell cycle arrest with a small cell size at the restrictive temperature
tor2ts-13 and tor2ts-19 mutants did not grow on YE5S plates when cultured at 36 °C (Fig. 1B). The mutant cells were then examined for growth in YE5S liquid medium. Cells were cultured in YE5S at 26 °C to a mid-log phase (3 x 106 cells/mL), transferred to a fresh YE5S and then shifted to 36 °C. While wild-type cells continued to divide, tor2ts-13 cells ceased increasing in cell number after approximately two rounds of cell division (Fig. 2A). Prior to the temperature shift, both cell size and shape were normal in tor2ts-13. When cultured at 36 °C, in contrast, the mutant cells became shorter in size and almost round (Fig. 2B). At 4 h and 8 h after the shift to 36 °C, the average cell length was reduced to 6.4 µM and 6.2 µM, respectively, which were
50% decreases compared to wild-type cells (13.0 µM and 12.9 µM). Similar results were obtained for tor2ts-19. It is of note that, in contrast to the reduced length, the cell width remained constant in these mutant cells.
|
tor2ts mutants induce autophagy and are competent for sexual differentiation under nutrient-rich conditions
Under nitrogen deprivation, two major physiological changes are known to occur, autophagy and sexual differentiation. We next sought to examine whether tor2ts mutants display these responses at the restrictive temperature. First, the mutant cells were examined to see if they conducted autophagy when cultured at 36 °C. Because autophagy accompanies large-scale protein degradation (Nakashima et al. 2006), the production of free amino acids was examined. For this purpose, cells had been labeled with L-[14C] Phe at 26 °C and then transferred to a fresh medium without the radioactive amino acid, followed by a temperature shift to 36 °C. At the indicated times, the amount of protein degradation was measured by counting the acid-soluble radioactivity. Proteins are insoluble to acid but amino acids and small peptides derived from protein degradation are soluble to acid. Thus, radioactivity in acid solution reflects the amount of protein degradation. When cultured at 26 °C, tor2ts-13 as well as the wild-type showed only a basal level of protein degradation (Fig. 3A), which confirmed that autophagy was repressed under nutrient-rich conditions at the permissive temperature in both tor2ts-13 and wild-type. Upon a temperature shift to 36 °C, however, tor2ts-13 cells showed a significant amount of protein degradation, which increased as the incubation time was prolonged. In contrast, wild-type cells showed only a marginal increase in radioactivity. These results imply that the protein degradation observed in tor2ts-13 was not due to the general response to heat shock; instead the inactivation of Tor2 did impose autophagy as if tor2ts-13 cells responded to nitrogen starvation. In tor2ts-19, such protein degradation was obscure (data not shown), the reason for which is unclear. It is possible that the residual Tor2 activity is retained in tor2ts-19 mutant cells, which is sufficient to inhibit autophagy.
|
tor2ts mutants induce expression of the nitrogen starvation-specific gene
We then examined whether the mutants would express the genes that are specific for nitrogen starvation. isp6+ encodes a vacuolar protease that is essential for autophagy and its expression is induced specifically with nitrogen starvation (Nakashima et al. 2002, 2006). As shown in Fig. 3D, isp6+ was expressed at a basal level in tor2ts-13 cells before temperature shift; however, it became highly expressed as incubated at 36 °C. In contrast, such an expression pattern was not observed in wild-type cells. A house keeping gene, nda3 (encoding ß-tubulin), did not show such induction. The same experiment was carried out for tor2ts-19, which showed a similar pattern. The results indicate that tor2ts mutants expressed nitrogen starvation specific genes on shift to the restrictive temperature and support the notion that tor2ts mutants mimic nitrogen starvation responses.
tor1
tor2ts double mutants display additive phenotypes of each single mutant
As described earlier, in S. pombe, TOR is encoded by two genes, tor1+ and tor2+, in which tor2+ is essential for proliferation (Weisman & Choder 2001). In contrast, tor1+ is a nonessential gene; tor1-deletion results in slow growth and hypersensitivity to various stresses, suggesting that the activity of Tor1 is important for cell survival especially when the cells are exposed to an adverse environment (Kawai et al. 2001; Wesiman & Choder 2001). Furthermore, tor1
was unable to respond properly to nitrogen starvation. In order to examine the function of Tor1 and Tor2 in cell proliferation and stress response, we created tor1
tor2ts-13 and tor1
tor2ts-19 double mutants and observed their phenotypes. First we examined the growth of the double mutants at varying temperatures. The mutant cells were spotted on to YE5S plates using a 10-times serial dilution and were cultured for 3 days. Both tor2ts-13 and tor2ts-19 mutants grew normally at 26 °C, 30 °C and even at 32 °C (fifth and sixth rows in Fig. 4A). tor1
could also form colonies well at these temperatures. The tor1
tor2ts-13 double mutant, on the other hand, grew only marginally at 30 °C and did not do so at 32 °C (the third row). Similar results were observed for tor1
tor2ts-19. These results demonstrate that Tor1 as well as Tor2 is important for cell proliferation and, furthermore, although Tor1 is dispensable, Tor1 becomes necessary for cell growth when Tor2 function is compromised.
|
tor2ts-13 and tor1
tor2ts-19 double mutants stopped proliferation earlier than the tor2ts-13 and tor2ts-19 single mutants. Prior to the temperature shift, tor1
tor2ts-13 and tor1
tor2ts-19 showed almost normal cell size, 13.2 µM and 12.9 µM, respectively (Fig. 4C). At 4 h and 8 h after being cultured at 36 °C, the cell length of tor1
tor2ts-19 was 14.5 µM and 14.2 µM, respectively, which indicates that, in sharp contrast to tor2ts-19, the cell size was not decreased (Fig. 2C). Similar results were also obtained for tor1
tor2ts-13 (Fig. 4C). In this case, the cell size was somewhat decreased; however, it was still longer than that of tor2ts-13, 9.9 µM and 6.4 µm for tor1
tor2ts-13 and tor2ts-13 at 4 h, respectively. It should be noted that the cell length of tor1
was not decreased when starved for nitrogen (Kawai et al. 2001; Weisman & Choder 2001). Given that tor2ts mutants mimic the physiologies of nitrogen starvation, as described earlier, failure to decrease the cell length in the double mutant seems to correspond to the appearance of tor1
phenotypes in the tor2ts mutant background. It therefore appears that the tor1
tor2ts double mutants display additive phenotypes of each single mutant.
It is shown that, when starved for nitrogen, tor1
is defective in G1 arrest (Kawai et al. 2001; Weisman & Choder 2001). We then examined this point by flow cytometry. On the temperature shift, unlike a tor2ts-19 single mutant (see Fig. 2C), tor1
tor2ts-19 showed only the 2C peak, and no 1C peak appeared at 36 °C (Fig. 4D). Similar results were obtained for tor1
tor2ts-13, although a small 1C peak appeared after incubation for 4 h. Taken together, the results presented here led us to the following idea. When Tor2 is inactivated, the cells cease proliferation after two rounds of cell cycle and become arrested at G1 with a small cell size. This process requires Tor1 activity. If the function of Tor1 is simultaneously lost, the cells fail to divide at a reduced cell size, and as a result, they became neither arrested at G1 nor smaller (Fig. 4C,D).
Tor2 physically interacts with a small GTPase Rhb1
Several groups have reported that a novel small GTP-binding protein, Rheb, binds and activates mTOR (Long et al. 2005). S. pombe has a Rheb counterpart gene, rhb1+ (Mach et al. 2000). Intriguingly, rhb1 mutants, in which its expression is turned off by promoter shut-off systems, display phenotypes very similar to tor2ts described earlier. Bearing this in mind, we next examined whether Rhb1 would interact with Tor2. In order to detect these two proteins, Tor2 was tagged with HA and Rhb1 with GFP at each N-terminus, and their own promoters were replaced with the thiamine-repressible nmt1 promoter (Maundrell 1993; Bähler et al. 1998). The cells that over-express both HA-Tor2 and GFP-Rhb1 were cultured in liquid medium without thiamine, and protein extracts were prepared and subjected to immunoprecipitation. As shown in Fig. 5A, GFP-Rheb was co-precipitated with HA-Tor2. When the cells were cultured in the presence of thiamine (repressed condition), co-immunoprecipitation of Rhb1 and Tor2 was not observed (data not shown), probably because the amount of each protein was not sufficient for detection of the interaction. This result demonstrates that Rhb1 and Tor2 interact physically with each other, at least under overproduction conditions.
|
Having seen the physical interaction, we next sought the genetic interaction between rhb1+ and tor2+. As previously described, tor1
was unable to survive under stress conditions such as high osmotic pressure and certain drugs (Fig. 5B). We reasoned these defects of tor1
in the following manner. In tor1
, in which only the Tor2 pathway is functional, the basal level of Tor2 activity is sufficient to support cell division under normal conditions, but it is not sufficient under stress conditions. If this is the case, when the Tor2 pathway is activated, tor1
cells may become viable under stress conditions.
We have shown that, as in mammalian cells, Tor2 binds Rhb1 (Fig. 5A), and therefore we expected that over-expression of rhb1+ would stimulate Tor2 activity, thereby rescuing the growth defects of tor1
in stress response. To this end, the promoter of rhb1+ was replaced with the nmt1+ promoter. As shown in Fig. 5B, tor1
rhb1+ o/e (rhb1+-over-expressing tor1
) cells were capable of growing on the plates in the presence of either 1 M KCl or 4 mM hydroxyurea (the third row, Fig. 5B). In animals, the Tsc1/Tsc2 complex negatively regulates Rheb, and inactivation of either Tsc1 or Tsc2 results in the hyperactivation of Rheb (Inoki et al. 2003; Saucedo et al. 2003; Stocker et al. 2003; Tee et al. 2003; Zhang et al. 2003). We constructed tor1
tsc2
cells and examined their growth under stress conditions. As expected, these double mutants behaved the same as tor1
rhb1+o/e cells, in which growth was restored under stress conditions (the fourth row). These results substantiated the notion that, in fission yeast, Tor2 acts downstream of Rhb1 and that Tor1 and Tor2 share functions under adverse growth conditions.
Actin organization in tor2ts mutants
In S. cerevisiae, TORC1 operates the growth of cells, whose inhibition leads cells to show nitrogen starvation-like response (Loewith et al. 2002; Jacinto & Hall 2003), while TORC2 is required for the organization of the actin cytoskeleton (Jacinto et al. 2004). Our results strongly suggest that Tor2 in S. pombe functions as TORC1; however, it is also possible that Tor2 is involved in actin organization because Tor2 is essential as in S. cerevisiae. In S. cerevisiae, actin patches localize at buds; however, they became dispersed after temperature shift in tor2ts mutants (Helliwell et al. 1998; Jacinto et al. 2004). In S. pombe, actin localizes at the growing tips or the septa of cells and it also makes fibers along the long axis (Fig. 6A). When cultured at 26 °C, both tor2ts-13 and tor2ts-19 cells showed the actin organization patterns similar to wild-type cells (Fig. 6B,C). At 2 h after shift to 36 °C, actin still localized at the tips of the cells in either tor2ts-13 or tor2ts-19 although it seemed slightly displaced from cell tips. The results suggest that Tor2 is not critically important for action organization.
|
| Discussion |
|---|
|
|
|---|
The C-terminal 33 residues of TOR form the FATC domain. Deletion of the C-terminal Trp as well as small deletions (three or more residues) of the C-terminus abolished mTOR activity both in vivo and in vitro (Peterson et al. 2000; Takahashi et al. 2000). A recent study has shown that the FATC domain forms a novel structural motif consisting of an
-helix and a C-terminal disulfide bonded loop (Dames et al. 2005). The flexibility of FATC changed upon reduction of the disulfide bond. Therefore, the FATC domain may function to regulate the kinase activity of TOR. In tor2ts-13, one mutation site out of three resides in the FATC domain, which supports the importance of this domain. Failure of the epitope-tagging of Tor2 at its C-terminus is consistent with this notion (M. Uritani, unpublished observation). In tor2ts-13, another mutation site was found at the gap region, and in tor2ts-19, all mutation sites were located at the gap region. The gap region consists of 70 amino acid residues, which are located between the kinase and FATC domains. The significance of the gap region remains to be clarified; however, our results suggest that the gap region is crucial for TOR activity.
In S. cerevisiae, rapamycin treatment but not the tor2 mutation leads to switching the cell from vegetative growth to a nitrogen-starvation response (Helliwell et al. 1998). In contrast, in fission yeast, although growth is not inhibited by rapamycin even at high concentrations (Weisman et al. 1997; Kawai et al. 2001), as shown in this study, inactivation of Tor2 alone is sufficient to commit the cell to the nitrogen-starvation response. Only Tor2 but not Tor1 may fulfilll the budding yeast equivalent "rapamycin-sensitive" function. It is also possible that Tor2 plays a major role in the "rapamycin-sensitive" events, while that of Tor1 is minor. In agreement with this idea, Tor2 did not seem to play an important role in actin organization (Fig. 6), while in the budding yeast, the "rapamycin-insensitive" function of Tor2 is to organize the actin cytoskeleton (Helliwell et al. 1998; Jacinto et al. 2004). If the above idea is true, tor2 mutants may be obtained that are sensitive to rapamycin in the tor1
background. The tor2ts mutants described in this study did not show rapamycin sensitivity. We have recently obtained rapamycin-sensitive tor2 mutants and their analysis is underway (M. Uritani, unpublished observations).
Previous reports have indicated that tor1+ is necessary for the proper response to nitrogen starvation (Kawai et al. 2001; Weisman & Choder 2001). Given the notion that Tor2 plays a crucial role in nitrogen signaling as shown in the current work, this function of Tor1 agrees with our data that tor1
tor2ts mutants failed to mimic a nitrogen-starvation response when cultured at the restrictive temperature (Fig. 4BD). The precise function of Tor1 and Tor2 is still unclear and further study is necessary. At present, we have a working hypothesis that Tor1 is necessary for physiological alterations against nitrogen starvation, while Tor2 prevents them, and its inactivation triggers these responses even in the presence of nitrogen sources (Fig. 7).
|
(Hilti et al. 1999; Wilkinson et al. 1999; Kawai et al. 2001; Ochotorena et al. 2001; Weisman & Choder 2001). Avo1 and rictor/Avo3 are specific components for the TORC2 complex, and thus in fission yeast Tor1, but not Tor2 as in budding yeast, might interact with Sin1 and Ste20 to form TORC2. In contrast, mip1+ is an essential gene, and similar to tor2+, its role is related to nitrogen starvation and mating response pathways (Shinozaki-Yabana et al. 2000). Raptor/Kog1 is specific for TORC1. It is therefore possible that Tor2 and Mip1 form TORC1, again different from the budding yeast system, in which Tor1 and Tor2 form TORC1. Obviously, more biochemical study with regard to TOR-complexes is necessary for further understanding of the roles of Tor1 and Tor2 in fission yeast. We are currently undertaking investigation of the physical interaction between Tor2 and Mip1. Both the physical and genetic interactions between Tor2 and Rhb1 presented in this work (Fig. 5A,B) strongly suggest that Rhb1 is an upstream element of the Tor2-mediated signaling pathway (Fig. 7). In line with this, recently Urano et al. (2005) also reported binding between a hyperactive Rheb protein and Tor2, and furthermore, an rhb1 shut-off mutant strain is known to display G1-mimicking phenotypes similar to tor2ts (Mach et al. 2000). We have been attempting to identify the downstream molecules of Tor2 by screening for multicopy suppressors of tor2ts mutants. Understanding of TOR-mediated growth factor/nutrient signaling pathways would be our final goal.
| Experimental procedures |
|---|
|
|
|---|
The strains used in this study are listed in Table 1. Cells were grown in Edinburgh minimal medium (EMM3) or yeast extract complete medium with uracil, histidine, adenine, lysine, and leucine (YE5S) as previously described (Moreno et al. 1991; Kawai et al. 2001).
|
tor2ts mutants were obtained as follows. First, the kanR cassette was inserted just after the open reading frame of tor2+. Using the set of primers, cctcctctttgagtgttcgtaaatctgtgc and acaatataaagagatgcattctctactaca, a DNA fragment was amplified which was from 200 bp upstream from the conserved Ser1817 that is responsible for FKBP-rapamycin binding in S. cerevisiae and to 200 bp downstream of the kanR insertion. This 3.4 kb DNA fragment was mutagenized with error-prone PCR. 513 (h
leu132 ura4-D18) was transformed with the DNA fragment. From
500 G418-resistant colonies, the two colonies were selected that grew on YE5S plates at 26 °C but not at 36 °C. Marker insertion, replacement of the promoter, and tagging were carried out as previously described (Bähler et al. 1998).
Measurement of protein degradation
Protein degradation was measured as previously described (Nakashima et al. 2006). In brief, mid-log cells were labeled with [U-14C]L-phenylalanine (1.85 MBq/mmol) at a final concentration of 11.1 KBq/mL, harvested, washed twice with EMM3-N, and incubated in EMM3-N at 30 °C. At intervals, aliquots (0.1 mL) of the culture were withdrawn, mixed quickly with 11 µL of 100% trichloroacetic acid solution, and kept on ice overnight. To the suspension, 11 µL of a bovine serum albumin solution (10 mg/mL) was added and mixed well. The mixture was centrifuged at 12000 g for 15 min at 4 °C, the supernatant was spotted on to a paper disk (Whatman 3 mM 2.4-cm diameter), and the radioactivity on the disk was measured with a liquid scintillation counter after drying. Results were expressed as the percentage of radioactivity in the acid-soluble fraction compared to the radioactivity in the initial total fraction.
Northern blotting
Cells were cultured in YE5S at 26 °C, and the cells in the mid-log phase were shifted to 36 °C and cultured at the times as indicated in Fig. 3D. Total RNA (25 µg) from the cells was subjected to Northern hybridization with the entire coding region of isp6+ as a probe (Nakashima et al. 2002). As a control probe, the entire region of nda3+ was used. ECL direct labeling and detection system (GE Healthcare) was used for detection.
Others
General, cytological and molecular genetic techniques were followed according to standard protocols (Moreno et al. 1991). Transformation of S. pombe cells was performed by the lithium acetate method (Okazaki et al. 1990). Cell-cycle analyses were conducted as previously described (Kawai et al. 2001).
| Acknowledgements |
|---|
| Footnotes |
|---|
aPresent address: Department of Molecular Biotechnology, Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530, Japan
| References |
|---|
|
|
|---|
Bähler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A., 3rd, Steever, A.B., Wach, A., Philippsen, P & Pringle, J.R. (1998) Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943951.[CrossRef][Medline]
Bosotti, R., Isacchi, A. & Sonnhammer, E.L. (2000) FAT: a novel domain in PIK-related kinases. Trends Biochem. Sci. 25, 225227.[CrossRef][Medline]
Dames, S.A., Mulet, J.M., Rathgeb-Szabo, K., Hall, M.N. & Grzesiek, S. (2005) The solution structure of the FATC domain of the protein kinase target of rapamycin suggests a role for redox-dependent structural and cellular stability. J. Biol. Chem. 280, 2055820564.
Egel, R. & Egel-Mitani, M. (1974) Premeiotic DNA synthesis in fission yeast. Exp. Cell Res. 88, 127134.[CrossRef][Medline]
Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R.S., Ru, B. & Pan, D. (2002) Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat. Cell Biol. 4, 699704.[CrossRef][Medline]
Hara, K., Maruki, Y., Long, X., Yoshino, K., Oshiro, N., Hidayat, S., Tokunaga, C., Avruch, J. & Yonezawa, K. (2002) Raptor, a binding partner of target of rapamycin (TOR), mediates TOR action. Cell 110, 7789.
Heitman, J., Movva, N.R. & Hall, M.N. (1991) Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253, 905909.
Helliwell, S.B., Howald, I., Barbet, N. & Hall, M.N. (1998) TOR2 is part of two related signaling pathways coordinating cell growth in Saccharomyces cerevisiae. Genetics 148, 99112.
Helliwell, S.B., Wagner, P., Kunz, J., Deuter-Reinhard, M., Henriquez, R. & Hall, M.N. (1994) TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast. Mol. Biol. Cell 5, 105118.[Abstract]
Hilti, N., Baumann, D., Schweingruber, A.M., Bigler, P. & Schweingruber, M.E. (1999) Gene ste20 controls amiloride sensitivity and fertility in Schizosaccharomyces pombe. Curr. Genet. 35, 585592.[CrossRef][Medline]
Inoki, K., Li, Y., Xu, T. & Guan, K.L. (2003) Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev. 17, 18291834.
Inoki, K., Li, Y., Zhu, T., Wu, J. & Guan, K.L. (2002) TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4, 648657.[CrossRef][Medline]
Jacinto, E. & Hall, M.N. (2003) Tor signalling in bugs, brain and brawn. Nat. Rev. Mol. Cell Biol. 4, 117126.[CrossRef][Medline]
Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M.A., Hall, A. & Hall, M.N. (2004) Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat. Cell Biol. 6, 11221128.[CrossRef][Medline]
Kawai, M., Nakashima, A., Ueno, M., Ushimaru, T., Aiba, K., Doi, H. & Uritani, M. (2001) Fission yeast tor1 functions in response to various stresses including nitrogen starvation, high osmolarity, and high temperature. Curr. Genet. 39, 166174.[CrossRef][Medline]
Kemp, J.T., Balasubramanian, M.K. & Gould, K.L. (1997) A wat1 mutant of fission yeast is defective in cell morphology. Mol. Gen. Genet. 254, 127138.[CrossRef][Medline]
Kim, D.H., Sarbassov, D.D., Ali, S.M., King, J.E., Latek, R.R., Erdjument-Bromage, H., Tempst, P. & Sabatini, D.M. (2002) mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 110, 163175.[CrossRef][Medline]
Kumada, K., Su, S., Yanagida, M. & Toda, T. (1995) Fission yeast TPR-family protein nuc2 is required for G1-arrest upon nitrogen starvation and is an inhibitor of septum formation. J. Cell Sci. 108, 895905.[Abstract]
Kunz, J., Schneider, U., Howald, I., Schmidt, A. & Hall, M.N. (2000) HEAT repeats mediate plasma membrane localization of Tor2p in yeast. J. Biol. Chem. 275, 3701137020.
Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J.L., Bonenfant, D., Oppliger, W., Jenoe, P. & Hall, M.N. (2002) Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 10, 457468.[CrossRef][Medline]
Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K. & Avruch, J. (2005) Rheb binds and regulates the mTOR kinase. Curr. Biol. 15, 702713.[CrossRef][Medline]
Mach, K.E., Furge, K.A. & Albright, C.F. (2000) Loss of Rhb1, a Rheb-related GTPase in fission yeast, causes growth arrest with a terminal phenotype similar to that caused by nitrogen starvation. Genetics 155, 611622.
Martin, D.E. & Hall, M.N. (2005) The expanding TOR signaling network. Curr. Opin. Cell Biol. 17, 158166.[CrossRef][Medline]
Matsumoto, S., Bandyopadhyay, A., Kwiatkowski, D.J., Maitra, U. & Matsumoto, T. (2002) Role of the Tsc1-Tsc2 complex in signaling and transport across the cell membrane in the fission yeast Schizosaccharomyces pombe. Genetics 161, 10531063.
Matsuo, T., Kubo, Y., Watanabe, Y. & Yamamoto, M. (2003) Schizosaccharomyces pombe AGC family kinase Gad8p forms a conserved signaling module with TOR and PDK1-like kinases. EMBO J. 22, 30733083.[CrossRef][Medline]
Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123, 127130.[CrossRef][Medline]
Moreno, S., Klar, A. & Nurse, P. (1991) Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795823.[Medline]
Nakashima, A., Hasegawa, T., Mori, S., Ueno, M., Tanaka, S., Ushimaru, T., Sato, S. & Uritani, M. (2006) A starvation-specific serine protease gene, isp6+, is involved in both autophagy and sexual development in Schizosaccharomyces pombe. Curr. Genet. 49, 403413.[CrossRef][Medline]
Nakashima, A., Ueno, M., Ushimaru, T. & Uritani, M. (2002) Involvement of a CCAAT-binding complex in the expression of a nitrogen-starvation-specific gene, isp6+. Schizosaccharomyces pombe. Biosci. Biotechnol. Biochem. 66, 22242227.[CrossRef][Medline]
Nurse, P. & Bissett, Y. (1981) Gene required in G1 for commitment to cell cycle and in G2 for control of mitosis in fission yeast. Nature 292, 558560.[CrossRef][Medline]
Ochotorena, I.L., Hirata, D., Kominami, K., Potashkin, J., Sahin, F., Wentz-Hunter, K., Gould, K.L., Sato, K., Yoshida, Y., Vardy, L. & Toda, T. (2001) Conserved Wat1/Pop3 WD-repeat protein of fission yeast secures genome stability through microtubule integrity and may be involved in mRNA maturation. J. Cell Sci. 114, 29112920.[Medline]
Okazaki, K., Okazaki, N., Kume, K., Jinno, S., Tanaka, K. & Okayama, H. (1990) High-frequency transformation method and library transducing vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe. Nucleic Acids Res. 18, 64856489.
Perry, J. & Kleckner, N. (2003) The ATRs, ATMs, and TORs are giant HEAT repeat proteins. Cell 112, 151155.[CrossRef][Medline]
Peterson, R.T., Beal, P.A., Comb, M.J. & Schreiber, S.L. (2000) FKBP12-rapamycin-associated protein (FRAP) autophosphorylates at serine 2481 under translationally repressive conditions. J. Biol. Chem. 275, 74167423.
Sarbassov, D.D., Ali, S.M., Kim, D.H., Guertin, D.A., Latek, R.R., Erdjument-Bromage, H., Tempst, P. & Sabatini, D.M. (2004) Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr. Biol. 14, 12961302.[CrossRef][Medline]
Saucedo, L.J., Gao, X., Chiarelli, D.A., Li, L., Pan, D. & Edgar, B.A. (2003) Rheb promotes cell growth as a component of the insulin/TOR signalling network. Nat. Cell Biol. 5, 566571.[CrossRef][Medline]
Schmelzle, T. & Hall, M.N. (2000) TOR, a central controller of cell growth. Cell 103, 253262.[CrossRef][Medline]
Shinozaki-Yabana, S., Watanabe, Y. & Yamamoto, M. (2000) Novel WD-repeat protein Mip1p facilitates function of the meiotic regulator Mei2p in fission yeast. Mol. Cell. Biol. 20, 12341242.
van Slegtenhorst, M., Carr, E., Stoyanova, R., Kruger, W.D. & Henske, E.P. (2004) Tsc1+ and tsc2+ regulate arginine uptake and metabolism in Schizosaccharomyces pombe. J. Biol. Chem. 279, 1270612713.
Stocker, H., Radimerski, T., Schindelholz, B., Wittwer, F., Belawat, P., Daram, P., Breuer, S., Thomas, G. & Hafen, E. (2003) Rheb is an essential regulator of S6K in controlling cell growth in Drosophila. Nat. Cell Biol. 5, 559565.[CrossRef][Medline]
Takahashi, T., Hara, K., Inoue, H., Kawa, Y., Tokunaga, C., Hidayat, S., Yoshino, K., Kuroda, Y. & Yonezawa, K. (2000) Carboxyl-terminal region conserved among phosphoinositide-kinase-related kinases is indispensable for mTOR function in vivo and in vitro. Genes Cells 5, 765775.[Abstract]
Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C. & Blenis, J. (2002) Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)-mediated downstream signaling. Proc. Natl. Acad. Sci. USA 99, 1357113576.
Tee, A.R., Manning, B.D., Roux, P.P., Cantley, L.C. & Blenis, J. (2003) Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr. Biol. 13, 12591268.[CrossRef][Medline]
Urano, J., Comiso, M.J., Guo, L., Aspuria, P.J., Deniskin, R., Tabancay, A.P., Jr., Kato-Stankiewicz, J. & Tamanoi, F. (2005) Identification of novel single amino acid changes that result in hyperactivation of the unique GTPase, Rheb, in fission yeast. Mol. Microbiol. 58, 10741086.[CrossRef][Medline]
Urano, J., Tabancay, A.P., Yang, W. & Tamanoi, F. (2000) The Saccharomyces cerevisiae Rheb G-protein is involved in regulating canavanine resistance and arginine uptake. J. Biol. Chem. 275, 1119811206.
Weisman, R. & Choder, M. (2001) The fission yeast TOR homolog, tor1+, is required for the response to starvation and other stresses via a conserved serine. J. Biol. Chem. 276, 70277032.
Weisman, R., Choder, M. & Koltin, Y. (1997) Rapamycin specifically interferes with the developmental response of fission yeast to starvation. J. Bacteriol. 179, 63256334.
Wilkinson, M.G., Pino, T.S., Tournier, S., Buck, V., Martin, H., Christiansen, J., Wilkinson, D.G. & Millar, J.B. (1999) Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway. EMBO J. 18, 42104221.[CrossRef][Medline]
Wullschleger, S., Loewith, R. & Hall, M.N. (2006) TOR signaling in growth and metabolism. Cell 124, 471484.[CrossRef][Medline]
Zhang, Y., Gao, X., Saucedo, L.J., Ru, B., Edgar, B.A. & Pan, D. (2003) Rheb is a direct target of the tuberous sclerosis tumour suppressor proteins. Nat. Cell Biol. 5, 578581.[CrossRef][Medline]
Zheng, X.F., Florentino, D., Chen, J., Crabtree, G.R. & Schreiber, S.L. (1995) TOR kinase domains are required for two distinct functions, only one of which is inhibited by rapamycin. Cell 82, 121130.[CrossRef][Medline]
Received: 16 April 2006
Accepted: 31 August 2006
This article has been cited by other articles:
![]() |
H. Mukaiyama, S. Kajiwara, A. Hosomi, Y. Giga-Hama, N. Tanaka, T. Nakamura, and K. Takegawa Autophagy-deficient Schizosaccharomyces pombe mutants undergo partial sporulation during nitrogen starvation Microbiology, December 1, 2009; 155(12): 3816 - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shiozaki Nutrition-Minded Cell Cycle Sci. Signal., November 10, 2009; 2(96): pe74 - pe74. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Murai, Y. Nakase, K. Fukuda, Y. Chikashige, C. Tsutsumi, Y. Hiraoka, and T. Matsumoto Distinctive Responses to Nitrogen Starvation in the Dominant Active Mutants of the Fission Yeast Rheb GTPase Genetics, October 1, 2009; 183(2): 517 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schonbrun, D. Laor, L. Lopez-Maury, J. Bahler, M. Kupiec, and R. Weisman TOR Complex 2 Controls Gene Silencing, Telomere Length Maintenance, and Survival under DNA-Damaging Conditions Mol. Cell. Biol., August 15, 2009; 29(16): 4584 - 4594. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hartmuth and J. Petersen Fission yeast Tor1 functions as part of TORC1 to control mitotic entry through the stress MAPK pathway following nutrient stress J. Cell Sci., June 1, 2009; 122(11): 1737 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Helmlinger, S. Marguerat, J. Villen, S. P. Gygi, J. Bahler, and F. Winston The S. pombe SAGA complex controls the switch from proliferation to sexual differentiation through the opposing roles of its subunits Gcn5 and Spt8 Genes & Dev., November 15, 2008; 22(22): 3184 - 3195. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Picazarri, K. Nakada-Tsukui, and T. Nozaki Autophagy during Proliferation and Encystation in the Protozoan Parasite Entamoeba invadens Infect. Immun., January 1, 2008; 76(1): 278 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kanoh and M. Yanagida Tel2: a common partner of PIK-related kinases and a link between DNA checkpoint and nutritional response? Genes Cells, December 1, 2007; 12(12): 1301 - 1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hayashi, M. Hatanaka, K. Nagao, Y. Nakaseko, J. Kanoh, A. Kokubu, M. Ebe, and M. Yanagida Rapamycin sensitivity of the Schizosaccharomyces pombe tor2 mutant and organization of two highly phosphorylated TOR complexes by specific and common subunits. Genes Cells, December 1, 2007; 12(12): 1357 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. van Slegtenhorst, D. Khabibullin, T. R. Hartman, E. Nicolas, W. D. Kruger, and E. P. Henske The Birt-Hogg-Dube and Tuberous Sclerosis Complex Homologs Have Opposing Roles in Amino Acid Homeostasis in Schizosaccharomyces pombe J. Biol. Chem., August 24, 2007; 282(34): 24583 - 24590. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Zurita-Martinez, R. Puria, X. Pan, J. D. Boeke, and M. E. Cardenas Efficient Tor Signaling Requires a Functional Class C Vps Protein Complex in Saccharomyces cerevisiae Genetics, August 1, 2007; 176(4): 2139 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuo, Y. Otsubo, J. Urano, F. Tamanoi, and M. Yamamoto Loss of the TOR Kinase Tor2 Mimics Nitrogen Starvation and Activates the Sexual Development Pathway in Fission Yeast Mol. Cell. Biol., April 15, 2007; 27(8): 3154 - 3164. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Weisman, I. Roitburg, M. Schonbrun, R. Harari, and M. Kupiec Opposite Effects of Tor1 and Tor2 on Nitrogen Starvation Responses in Fission Yeast Genetics, March 1, 2007; 175(3): 1153 - 1162. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |