|
|
||||||||
-globin locus is required for their temporal specific expressions
National Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Peking Union Medical College & Chinese Academy of Medical Sciences, 5 Dong Dan San Tiao, Beijing, 100005, China
| Abstract |
|---|
|
|
|---|
-globin cluster represents a unique model of transcriptional regulation and provides challenges to the current understanding of interactions between distal and proximal regulatory elements. Although the gene proximal regions are believed to possess almost all the necessary elements for temporal and spatial specificity of gene transcription, it is still not clear whether the relative distance of embryonic
- and fetal/adult
-genes to their distal regulatory element
-URE plays any role in transcriptional switching. To investigate the role of gene order in regulating temporal expression, we inverted the entire structure gene region of human
-globin locus in a BAC clone bringing
-genes closest to
-URE and
-gene the farthest away. Expression analysis of the reverted locus in transgenic mice showed that
-globin genes, now relocated closer to
-URE, maintained their expression levels through all developmental stages. However, the
-globin gene suffered a total loss at both embryonic and fetal/adult stages. It indicates that proximal location of
-globin gene to
-URE is necessary for its normal embryonic expression and necessary to prevent embryonic expression of the
-globin gene. We proved that, in the human
-globin gene cluster, the normal order of structural genes relative to
-URE plays a crucial role in the regulation of developmental switching. | Introduction |
|---|
|
|
|---|
-globin gene cluster, spanning about 80 kb at the very tip of the short arm of chromosome 16, includes seven tandemly linked genes organized in the order telomere-
-
1-
2-
1-
2-
1-
-centromere, where
denotes pseudogenes (Higgs et al. 1998; Zhang et al. 2002). Their expression is transcriptionally controlled, resulting in developmentally regulated changes in expression of the
-like globin gene products:
-globin in the embryonic stage and
2 and
1-globin in the fetal-adult stages. The
-globin gene is also expressed in the adult stage but its expression level is very low and its function is still unknown (Marks et al. 1986). Two
-like globin chains, together with two ß-like globin chains, form several types of heterotetrameric hemoglobins during different stages of development (Liebhaber & Russell 1998).
2
2 and
2
2 are expressed in the embryonic stage,
2
2 in the fetal stage and
2ß2 and
2
2 in the adult stage.
High-level expression of the
-like globin genes is controlled by five DNase I hypersensitive sites, HS4, HS8, HS10, HS33 and HS40, located in the upstream region of the human
-globin gene cluster (
-URE) (Higgs et al. 1998). Previous studies indicated that all the necessary information for appropriate developmental switching is present within and/or directly flanking the
-like globin genes, since human
- and
-globin genes can be expressed in a developmentally appropriate manner whenever they are coinserted or inserted alone into the mouse genome. For example, human
-globin gene exhibits a normal developmental switching mode when it is integrated into the mouse genome alone under the direction of ß-LCR HS2 (Spangler et al. 1990; Sabath et al. 1993). Human
- and
-globin genes also switch normally when they are coinserted into the mouse genome in their natural order, under the direction of
-HS40 (Sharpe et al. 1993) or
-URE (Feng et al. 2001). Three elements are involved in the autonomous silencing regulation of human
-globin gene: 5'promoter, 3'UTR of mRNA and 3'flanking region. The key sequence in 3' flanking region is localized to a 108 bp fragment located 1.2 kb 3' to
-globin gene. It contains NF-kappaB motif to form NF-kappaB complex, which is crucial to
-silencing (Wang & Liebhaber 1999). As to the promoter, one study concluded that the proximal 128 bp of
-promoter is sufficient for correct developmental switching (Sabath et al. 1993). Another study showed that the embryonic specific activation of the
-globin gene is conferred by the 67 bp
-promoter fragment containing only a CACCC and TATA box (Pondel et al. 1996). The role of the transcribed gene in silencing is associated with mRNA stability (Liebhaber et al. 1996; Russell et al. 1998).
However, as a highly evolved gene cluster, the expression regulation of human
-like globin genes should be considered more from the cluster level. Cluster regulation mechanism, such as the interaction between individual genes and upstream regulatory elements, also play important roles in the developmental switching regulation. Studies in the human ß-globin gene cluster proved that the gene order relative to its upstream regulatory element, the locus control region (LCR), plays an important role in the developmentally regulated expression of clustered genes. When the structural genes are inverted and linked with the LCR, the ß-globin gene, now in the LCR-proximal position, switches on in the 9.5-days-postcoitus (dpc) yolk sac and is expressed at all stages. The
-globin gene, now relocated to the 3' end of the ß-globin locus, is transcriptionally silent at all developmental stages (Tanimoto et al. 1999). Unlike the LCR in human ß-globin locus, HS-40 of
-globin locus resides in the intron of a constitutive expressed gene C16orf35. The presence of an exon between HS-40 and the
-like globin genes results in a unique structure of gene organization and may, thus, change the dynamics of the interactions among these regulatory elements and downstream structural genes. So the regulatory mechanism in the cluster level may be more complicated in human
-globin locus and the effect of gene order relative to
-URE on developmental switching has not yet been addressed.
Bacterial Artificial Chromosome (BAC) has been widely employed in studies of large gene clusters in their native context due to its capacity for very large inserts (Heintz 2001; Gong et al. 2003). We have previously generated transgenic mice with BAC carrying 110 kb normal human
-globin gene cluster (Feng et al. 2001). To investigate the effect of gene order relative to
-URE on the developmental switching of human
-globin gene cluster, we constructed the 125 kb
-INV Bacterial Artificial Chromosome (BAC) clone carrying
-URE and inverted human
-like globin genes. Six transgenic lines bearing
-INV BAC clone were generated. Tissue- and developmental stage-specific expression pattern of human
-like globin genes was observed in the transgenic mice by RNase protection assay (RPA). We concluded that the order of structural genes relative to the
-URE is critical for maintaining normal developmental switching in the human
-globin gene cluster.
| Results |
|---|
|
|
|---|
-INV BAC clone
Firstly, we constructed the BAC clone containing the
-URE and inverted human
-like globin genes. GET-homologous recombineering (Lee et al. 2001) was applied in the construction of new BAC clone. The general strategy is shown in Fig. 1A. By one homologous recombination, in which the upstream and downstream arms (C1 and C2) of the insertion fragment are homologous to the upstream and downstream sequences of
-globin structural genes, we got the BAC clone containing the
-URE and inserted Km+ gene and ClaI digestion site (
-DY380-N1). By the other homologous recombination, in which the upstream and downstream arms (A1 and A2) of insertion fragment are homologous to the upstream and downstream sequences of
-URE, we got the BAC clone containing the
-globin structural genes and inserted Km+ gene and ClaI digestion site (
-DY380-N2). Restriction mapping and PFGE analysis revealed that the colonies were correctly modified (data not shown). Then, 20 µg BAC DNA of
-DY380-N1 and
-DY380-N2 were digested with ClaI separately. After PFGE, the DNA fragments containing
-URE and BAC vector backbone and the DNA fragments containing structural genes were recovered separately and ligated. Then the ligated DNA was electroporated into the DH10B E. coli strain and screened by in situ colony hybridization. We got 85 candidate clones from about 500 colonies (data not shown). By restriction mapping, PFGE (Fig. 2) and sequencing analysis (Supplementary Fig. S2), we identified the BAC clone carrying entire
-URE (from 86153 to 139295 of AE006462
[GenBank]
, GenBank), downstream flanking sequence (from 185661 to 204073 of AE006462
[GenBank]
, GenBank) and inverted human
-like globin genes (from 185660 to 139298 of AE006462
[GenBank]
, GenBank), which was named
-INV (Fig. 1B). Sequencing of PCR product of the ligation sites proved that the order of the
-like globin genes is reversed (Supplementary Fig. S1).
|
|
The
-INV BAC DNA was purified as a linear 118 kb fragment and microinjected into fertilized eggs to generate transgenic mice. Genomic DNA prepared from tails of newborn mice was analyzed by PCR with human HS40 and
-globin gene primers. Six founder mice were identified from 32 newly born mice by PCR (data not shown). Then Southern blot analysis was used to verify the PCR results (Fig. 3A). They all have the same hybridized bands as the human genomic DNA control, which confirmed the structural integrity of the transgene. Compared with human genomic DNA, transgene copy numbers for each strain are 14 (
-INV-1), 5 (
-INV-2), 1 (
-INV-3), 19 (
-INV-4), 3 (
-INV-5), 1 (
-INV-6), respectively.
|
-INV-3 and
-INV-6). The SfiI digested high-molecular-weight genomic DNA was hybridized by HS40 probe. Both of the lines carry the entire 29.6 kb fragment (Fig. 3B). Combined with PCR and Southern blot data described above, it showed that the two mouse lines contained the intact
URE-inverted
-globin genes DNA fragment at least, if not the whole BAC.
Expression pattern of human
-like globin genes in
-INV transgenic mice
The transcription of the human
-like globin genes in transgenic mice was examined using RNase protection assay. The relative expression levels of human
-like globin genes were measured by comparing with the expression levels of endogenous mouse
-like globin genes at each developmental time point. We detected the developmental switching mode in
-INV-1,
-INV-3 and
-INV-6 (Fig. 4AC) to observe whether normal developmental switching occurred at different developmental time points. After inversion of structural genes relative to
-URE, the expression of human
-globin gene cannot be detected at any developmental stages by RPA. Human
2 and
1-globin genes switch on in the 9.5 dpc yolk sac and continue throughout life. This is different from normal
-globin transgenic mice, in which human
-globin gene can be detected at 9.5 dpc yolk sac and switches off between days 10.5 and 12.5; meanwhile two human
-globin genes switch on at day 12.5 (Feng et al. 2001).
|
-globin with respect to mouse
-globin. The expression level of human
-globin gene increases with development. In adult bone marrow, the expression levels of human
-globin gene are
-INV-1, 4.35%;
-INV-2, 15%;
-INV-3, 133.52%;
-INV-4, 3.99%;
-INV-5, 31.85% and
-INV-6, 82.95% (per each transgene copy), which is not significantly different from those in normal
globin transgenic mice: 147.7% in
8 and 58.5% in
16 (Fig. 4E, Supplementary Fig. S3) (Feng et al. 2001). The expression level of human
-globin gene varies dramatically among different transgenic lines, indicating integration-site-dependent expression. The ratio of expression level of
2/
1-globin gene ranges from 0.0068 to 0.59 in 14.5 dpc fetal liver and ranges from 1.05 to 2.78 in adult bone marrow. In adult
-INV-3 transgenic mouse, human
-globin gene is expressed in bone marrow and spleen, but not in liver, brain and muscle, exhibiting the same erythroid-specific expression pattern as endogenous mouse
-globin gene (Fig. 4B). | Discussion |
|---|
|
|
|---|
-URE in the developmental switching of human
-globin gene cluster, we constructed a Bacterial Artificial Chromosome (BAC) clone carrying
-URE and inverted human
-like globin genes (
-INV). Similar cloning approach has been successfully applied in the reconstruction of two BACs containing different large chromosome DNA fragments (Shen et al. 2005). This cloning strategy could be widely applied to genomic research.
Six lines of transgenic mice were confirmed to have the intact
-INV locus integrated into their genome by Southern blot and long range mapping analysis. Surprisingly, compared with normal
-globin transgenic mice, transcription of the embryonic
-globin gene, now being the farthest gene from HS-40 in the inverted locus, was not detectable, at any stage in any of the lines we examined. This indicated that competition from actively transcribed
-globin gene promoters were able to shut down interactions between the
-gene promoter and
-URE, even at the embryonic stage when the
-gene is normally active. This was supported by a study in MEL cells, which demonstrated that enhancer activity of HS40 could be trapped by both erythroid and nonerythroid promoters inserted between HS40 and human
-globin gene, leading to the impairment of
-globin gene expression (Deville et al. 2004). The fetal/adult
2 and
1-globin genes, now being the most proximal gene to
-URE, became the only globin genes transcribed from the inverted locus through all stages. It indicated that competition of
-globin gene promoter for
-URE could prevent the embryonic expression of
-globin genes in normal human
-globin gene cluster. This alteration in temporal expressions as a result of locus inversion is consistent with the notion that the appropriate order of genes in a multigene locus is required for their temporally specific expression during development as observed in other locus.
The silencing of the human
-globin gene is associated with the expression characteristics of human
-globin gene. Because human
-globin gene is an adult gene and expressed throughout lifetime after switching on, it may not have the autonomous silencing mechanism observed in the human
-globin gene (Spangler et al. 1990; Sabath et al. 1993). In the
-INV locus, once
-URE was engaged with the most closely located and active
-globin gene promoter, the probability of interaction between
-URE and
-gene promoter was grossly reduced. Since
-globin genes have no autonomous silencing mechanism,
-URE cannot be released from
-globin gene promoter to interact with
-globin gene promoter, leading to the permanent silencing of
-globin gene. Hence, the proximity of human
-globin gene to
-URE is critical for its proper expression in the embryonic stage.
Alternatively, inversion might break up the specific interaction mode between
-URE and structural genes. Studies with Chromosome Conformation Capture (3C) technique showed that, in human and mouse ß-globin gene clusters, LCR is inclined to interact with individual promoter directly to create a specific nuclear compartment named the active chromatin hub (ACH) (Palstra et al. 2003). 3C work in our laboratory suggested that in mouse
-globin gene cluster, the URE also interacts with individual promoter directly with ACH formation (L. Xin, G.L. Zhou, D.P. Liu & C.C. Liang, unpublished observation). Therefore, ACH conformation might widely exist in the eukaryotic gene clusters, including human
-globin gene cluster. Recent studies showed that many factors could influence the formation of ACH in human and mouse ß-globin gene clusters, such as deletion of HS3 (Patrinos et al. 2004) and EKLF (Drissen et al. 2004). Inversion of structural genes might also influence the formation of the certain ACH conformation, leading to the change of developmental switching mode. Further 3C experiments are expected to reveal more insights and further understanding of these mechanisms.
The change of developmental switching mode in
-INV transgenic mice is similar to the phenomenon observed in reversed ß-structural genes transgenic mice, in which adult ß-globin gene was consistently expressed from embryonic stage and the expression of embryonic
-globin gene could not be detected (Tanimoto et al. 1999). This indicated that, although human
- and ß-globin gene clusters are located in a different chromosome environment and have different developmental switching modes, the structural gene order relative to the upstream regulatory element is an important factor in the developmental switching regulation for both loci. We would argue that gene order seems to be playing more predominant roles in globin switching regulation, although proximal regulatory elements and transacting factors are involved in the processes, since the normal and inverted locus were in the milieu of the same transcription factors and possess the same proximal regulatory elements.
A previous study proved that in fetal and adult life the steady level of
2-mRNA predominates over
1-mRNA by approximately 3 : 1 (Higgs et al. 1998). Transgenic studies in our laboratory showed that the expression level of human
2-globin gene is higher than
1-globin gene and the ratio ranges from 1.83 to 3.2 (Feng et al. 2001). However, after the reversion of
-structural genes, the expression level of
1-globin gene is higher than
2-globin gene in the fetal stage (the ratio of
2/
1-mRNA ranges from 0.0068 to 0.59), while
2-globin gene remains higher expression level than
1-globin gene in the adult stage (the ratio of
2/
1-mRNA ranges from 1.05 to 2.78). This proved that closeness of
1-globin gene to
-URE enhances its expression relative to
2-globin gene, especially in the fetal stage.
On the other hand, reversion of structural genes relative to
-URE did not affect the tissue specific expression mode and expression level of the human
-globin gene, which varied dramatically among different transgenic lines, suggesting that
-URE can provide downstream structural genes with integration site-dependent expression in transgenic mice. This is consistent with previous studies (Feng et al. 2001). The expression level in
-INV transgenic mice is similar to that in normal
globin transgenic mice. Therefore, gene order doesn't participate in the regulation of erythroid specific expression and gene expression level. The cis-regulatory elements and trans-acting factors should play more important roles.
Taken together, after reversion of the structural genes, the human
-globin gene exhibits the same integration-site-dependent, erythroid-specific expression and a similar expression level as normal
globin transgenic mice, but the developmental switching mode has changed with total loss of expression of the
-globin gene. The
-globin gene switches on early in the embryonic stage and continues lifetime. Competition mechanism or destruction of specific spatial conformation might be responsible for the change of developmental switching mode. We proved that, in the human
-globin gene cluster, the normal order of structural genes relative to
-URE plays a crucial role in the regulation of developmental switching. Combined with the studies in human ß-globin gene cluster (Tanimoto et al. 1999), gene order might be a universal regulatory factor in the temporal regulation of eukaryotic gene clusters.
| Experimental procedures |
|---|
|
|
|---|
The general strategy for construction of the
-INV BAC clone is shown in Fig. 1A. In order to retrieve either the
-URE or the structural gene fragments of the
-globin locus, one kind of unique enzyme digestion site should be inserted into the upstream and downstream of
-URE or structural genes by homologous recombination. By bioinformatics analysis of BAC191K2 (Feng et al. 2001), which contains human
-globin gene cluster, we chose ClaI as the restrictive enzyme to be inserted. The intergenic region between
-URE and structural genes (at position 139295, 139298 of AE006462
[GenBank]
, respectively, GeneBank) was chosen as the insertion site. The other inherent ClaI site is located
13 kb 3' of
-globin gene (at position 185660 of AE006462
[GenBank]
, GeneBank).
Firstly, BAC191K2 were transformed into DY380 E. coli strain, which contains a defective
-phage carrying the red recombination system genes (exo, bet & gam) under the control of a temperature-sensitive promoter (Lee et al. 2001). The positive clones were termed
-BAC-DY380. Then the PCR fragment containing 50 bp homologous arms, the Kanamycin resistant gene (Km+) and the additional ClaI sites were electroporated into
-BAC-DY380 E. coli strain for GET-recombine ring, and the target fragments were replaced with the insertion fragments. The Km+ gene fragment was amplified from plasmid pEGFP-C1 (Clontech). We need twice GET-recombination to generate two BAC clones, in which
-URE or the structural genes were replaced with Km+ gene separately. Primers were as follows: 5'-attggttagttgataacccaattaggtcctccttcaatctggctgaaagcAaaccgtctatcagggcgatGG-3' and 5'-ctccttgctggtctgttcctcgtgcacatttcacagcggctcctctctccATCGATccgaagcccaacctttcataga-3' for deletion of
-URE; 5'-caggacagtgagcaagacaggggtaaggccagagtgggtgggcacacccaATCGATaaaccgtctatcagggcgatgg-3' and 5'-gaggaaaagcatctcta catgtgcctagaagactggaacagctacgcatcccgaagcccaacctttcataga-3' for deletion of
-structural genes. The ClaI sites (in bold font) were included in two of above primers. In all primers, the homologous arms were shown in lowercase, and the primers for amplifying Km+ gene were shown in capital. The procedure of GET-recombineering is as previously described (Lee et al. 2001).
After homologous recombination, we got two new BAC clones containing either the
-URE or the structural genes, in which ClaI sites were inserted into the upstream of
-globin gene (at position 139295, 139298 of AE006462
[GenBank]
, respectively, GenBank). By BAC maxipreparation, ClaI digestion, pulse field gel electrophoresis (PFGE, CHEF Mapper, BIO-RAD) on 1% low melting point (LMP) agarose, the target DNA fragments containing either
-URE and BAC vector backbone or structural genes were cut from the gel, recovered by ß-Agarase I (New England Biolabs) and concentrated by Microcon®. Centrifugal Filter YM-30 (Millipore). Finally, the two DNA fragments were ligated and electroporated into DH10B E. coli. By in situ colony hybridization, the candidate clones were picked out. Restriction map analysis, PFGE and sequencing of BAC terminals and ligation sites were applied to identify the correctness of the target BAC clones.
DNA purification for microinjection
The
-INV BAC DNA were prepared by QIAGEN Large-Construct Kit®. Then 35 µg of BAC DNA was digested by 160 units NotI in a 200 µL system at 37 °C for 12 h. The digested BAC DNA was added to a 0.5 x 5cm pre-equilibrized Sepharose CL-4B column. The column was washed by injection buffer (10 mM Tris-HCl, pH 7.5/0.1 mM EDTA, pH 8.0/100 mM NaCl). The eluted fractions were collected with a 24-well plate (0.5 mL for each well). Of each fraction, 20 µL was loaded on PFGE to identify the appropriate fractions and use it for microinjection.
Generation of transgenic mice
The murine zygotes were from C57BL/6 J-mated KM female mice; the fosters were KM female mice. The purified
-INV BAC DNA was diluted to 1.5 ng/µL for pronuclear microinjection into murine zygotes. The injected zygotes were cultured in KSOM culture medium (Erbach et al. 1994) for 23 h, and healthy injected zygotes were selected for oviduct transfer.
Identification of founder transgenic mice
Mouse tail genome DNA was prepared by phenol/chloroform extraction from mice of 4-6 weeks old. First, the transgenic founders were rapidly screened by PCR. Primers used for
-INV transgenic mice detection were: human HS-40: 5'-TCGACCCTCTGGAACCTAT-3' and 5'-CTGGCTGTGAACACTTTGG-3'; human
-globin gene: 5'-GGGATGGGCGGGAGTG-3' and 5'-TGGGGACCAGAAGAGTGC-3'. Then the founder mice were further confirmed by Southern blot analysis, using human HS-40,
- and
-globin genes as probes. Positive founders were bred to KM/ICR mice, and copy numbers of the transgene were quantified by comparing the band brightness of transgene with human genome (Promega) in Southern blot using the PhosphorImage® (Molecular Dynamics) analysis as previously described (Huang et al. 2000; Feng et al. 2001).
The long-range mapping was performed as described (Peterson et al. 1998). 2 x 106 mouse fetal liver cells were embedded in 1% agarose plugs. High-molecular-weight DNA was prepared and digested with SfiI, and resolved by PFGE, and transferred to Hybond-N+ nylon membrane using alkali solution. Southern blot hybridization was performed with 32P labeled HS40 probe.
Total RNA isolation and RNase protection assay
Total RNA was extracted from yolk sacs of 9.5 and 10.5 dpc embryos, fetal livers of 12.5, 14.5 and 16.5 dpc embryos, and bone marrow and spleen of adult mice by TRIzol reagent (Gibco/BRL). RNase protection assay was performed to detect the expression levels of human
- and
-globin genes as previously described (Huang et al. 2000; Feng et al. 2001). Autoradiography was performed, and protected bands on the gels were quantified via PhosphorImage® analysis. The following globin-specific probes were used: mouse
, pT7m
; mouse
, pT7m
; human
, pT7h
; human
, pSP6h
.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: liudp{at}pumc.edu.cn
| References |
|---|
|
|
|---|
Drissen, R., Palstra, R.J., Gillemans, N., et al. (2004) The active spatial organization of the beta-globin locus requires the transcription factor EKLF. Genes Dev.
18, 24852490.
Erbach, G.T., Lawitts, J.A., Papaioannou, V.E. & Biggers, J.D. (1994) Differential growth of the mouse preimplantation embryo in chemically defined media. Biol. Reprod. 50, 10271033.[Abstract]
Feng, D.X., Liu, D.P., Huang, Y., et al. (2001) The expression of human alphalike globin genes in transgenic mice mediated by bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA
98, 1507315077.
Gong, S., Zheng, C., Doughty, M.L., et al. (2003) A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425, 917925.[CrossRef][Medline]
Heintz, N. (2001) BAC to the future: the use of BAC transgenic mice for neuroscience research. Nature Rev. Neurosci. 2, 861870.[CrossRef][Medline]
Higgs, D.R., Sharpe, J.A. & Wood, W.G. (1998) Understanding
globin gene expression: a step towards effective gene therapy. Seminar Hematol.
35, 93104.
Huang, Y., Liu, D.P., Wu, L., et al. (2000) Proper developmental control of human globin genes reproduced by transgenic mice containing a 160-kb BAC carrying the human beta-globin locus. Blood Cells Mol. Dis. 26, 598610.[CrossRef][Medline]
Lee, E.C., Yu, D. & Martinez, D.V.J. (2001) A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73, 5665.[CrossRef][Medline]
Liebhaber, S.A. & Russell, J.E. (1998) Expression and developmental control of the human
-globin gene cluster. Ann. NY Acad. Sci.
850, 5463.[CrossRef][Medline]
Liebhaber, S.A., Wang, Z., Cash, F.E., Monks, B. & Russel, J.E. (1996) Developmental silencing of the embryonic
-globin gene: concerted action of the promoter and the 3'-flanking region combined with stage-specific silencing by the transcribed segment Mol. Cell. Biol.
16, 26372646.
Marks, J., Shaw, J.P. & Shen, C.K. (1986) Sequence organization and genomic complexity of primate
1 globin gene, a novel alpha-globin-like gene. Nature
321, 785788.[CrossRef][Medline]
Palstra, R.J., Tolhuis, B., Splinter, E., Nijmeijer, R., Grosveld, F. & Laat, W. (2003) The beta-globin nuclear compartment in development and erythroid differentiation. Nature Genet. 35, 190194.[CrossRef][Medline]
Patrinos, G.P.,
Krom, M.,
Boer, E., et al. (2004) Multiple interactions between regulatory regions are required to stabilize an active chromatin hub. Genes Dev.
18, 14951509.
Peterson, K.R., Navas, P.A., Li, Q. & Stamatoyannopoulos, G. (1998) LCR-dependent gene expression in ß-globin YAC transgenics: detailed structural studies validate functional analysis even in the presence of fragmented YACs. Human Mol. Genet. 82, 28992905.
Pondel, M.D., Sharpe, J.A., Clark, S., Pearson, L., Wood, W.G. & Proudfoot, N.J. (1996) Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice. Nucleic Acids Res.
24, 41584164.
Russell, J.E., Morales, J., Makeyev, A.V. & Liebhaber, S.A. (1998) Sequence divergence in the 3' untranslated regions of human zeta- and alpha-globin mRNAs mediates a difference in their stabilities and contributes to efficient alpha-to-zeta gene development switching. Mol. Cell. Biol.
18, 21732183.
Sabath, D.E., Spangler, E.A., Rubin, E.M. & Stamatoyannopoulo, G. (1993) Analysis of the human
-globin gene promoter in transgenic mice. Blood
82, 28992905.
Sharpe, J.A., Wells, D.J., Whitelaw, E., Vyas, P., Higgs, D.R. & Wood, W.G. (1993) Analysis of the human
-globin gene cluster in transgenic mice. Proc. Natl. Acad. Sci. USA
90, 1126211266.
Shen, W., Huang, Y., Tang, Y., Liu, D.P. & Liang, C.C. (2005) A general method to modify BACs to generate large recombinant DNA fragments. Mol. Biotechnol. 31, 181186.[CrossRef][Medline]
Spangler, E.A., Andrews, K.A. & Rubin, E.M. (1990) Developmental regulation of the human
-globin gene promoter in transgenic mice. Nucleic
Acids Res.
18, 70937097.
Tanimoto, K., Liu, Q., Bungert, J. & Engel, J.D. (1999) Effects of altered gene order or orientation of the locus control region on human ß-globin gene expression in mice. Nature 398, 344348.[CrossRef][Medline]
Wang, Z. & Liebhaber, S.A. (1999) A-3'-flanking NF-kappaB site mediates developmental silencing of the human zeta-globin gene. EMBO J. 18, 22182228.[CrossRef][Medline]
Zhang, H.B., Liu, D.P. & Liang, C.C. (2002) The control of expression of the
-globin gene cluster. Int. J. Hematol.
76, 420426.[Medline]
Received: 20 July 2005
Accepted: 27 October 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |