GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2006) 11, 425-438. doi:10.1111/j.1365-2443.2006.00950.x
© 2006 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ozaki, S.
Right arrow Articles by Katayama, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ozaki, S.
Right arrow Articles by Katayama, T.

The DnaA homolog of the hyperthermophilic eubacterium Thermotoga maritima forms an open complex with a minimal 149-bp origin region in an ATP-dependent manner

Shogo Ozaki1, Kazuyuki Fujimitsu1, Hitoshi Kurumizaka2 and Tsutomu Katayama1,*

1 Department of Molecular Biology, Graduate School of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan
2 Graduate School of Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
In Escherichia coli, ATP-DnaA, but not ADP-DnaA, forms an initiation complex that undergoes site-specific duplex DNA unwinding, open complex formation. However, it remains unclear how highly the ATP-dependent activation of the initiation factor is conserved in evolution. The hyperthermophile Thermotoga maritima is one of the most ancient eubacteria in evolution. Here, we show that the DnaA homolog (tmaDnaA) of this bacterium forms open complexes with the predicted origin region (tma-oriC) in vitro. TmaDnaA has a strong and specific affinity for ATP/ADP as well as for 12-mer repeating sequences within the tma-oriC. Unlike ADP-tmaDnaA, ATP-tmaDnaA is highly cooperative in DNA binding and forms open complexes in a manner that depends on temperature and the superhelical tension of the tma-oriC-bearing plasmid. The minimal tma-oriC required for unwinding is a 149-bp region containing five repeats of the 12-mer sequence and two AT-rich 9-mer repeats. TmaDnaA-binding to the 12-mer motif provokes DNA bending. The 9-mer region is the duplex-unwinding site. The tmaDnaA-binding and unwinding motifs of tma-oriC share sequence homology with corresponding archaeal and eukaryotic sequences. These findings suggest that the ATP-dependent molecular switch of the initiator and the mechanisms in the replication initiation complex are highly conserved in eubacterial evolution.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The initiation of chromosomal replication in prokaryotic and eukaryotic cells involves the formation of an initiation complex, which is a highly regulated constitution containing specific protein multimers and duplex DNA (Bell 2002; Messer 2002; Stillman 2005). The regulation of initiation complex formation is of critical importance in the chromosomal replication that takes place during the cell cycle. The initiation complex of Escherichia coli has been thoroughly analyzed in vitro using the initiator DnaA protein and the replication origin, oriC (Bramhill & Kornberg 1988; Messer 2002; Leonard & Grimwade 2005). These analyses have shown that ATP-bound DnaA first forms homomultimers on the minimal oriC 245-bp region and that this results in the initiation complex. The minimal oriC bears five 9-mer DnaA-binding DnaA boxes and 13-mer AT-rich repeats. Once the initiation complex is formed, part of the AT-rich duplex is unwound in a manner that depends on its superhelicity, heat energy and a millimolar level of ATP: this results in open complex formation. The replicative helicase DnaB is then loaded on to the open complex, leading to the loading of DnaG primase and the DNA polymerase III holoenzyme.

It is likely that the DnaA protein originates from the same evolutionary ancestor as eukaryotic Orc1 and Cdc6 (Orc1 is a subunit of the origin recognition complex, ORC and Cdc6 is its binding factor) and the archaeal Orc1/Cdc6 homologs (Giraldo 2003; Iyer et al. 2004). These proteins are members of the AAA+ superfamily that carries unique ATP recognition motifs (Neuwald et al. 1999; Giraldo 2003). The binding of ATP to E. coli DnaA conformationally activates the initiation complex by altering modes in inter-DnaA interaction and in DnaA binding to specific sequences, which results in open complex formation (Speck & Messer 2001; McGarry et al. 2004; Kawakami et al. 2005). Similarly, Saccharomyces cerevisiae ORC binds to the origin DNA in a manner that depends on the binding of ATP to Orc1 (Klemm et al. 1997; Bell 2002; Stillman 2005). However, it remains unclear how highly the ATP-dependent activation of the initiation factor is conserved in evolution because the initiation proteins of other species have not been thoroughly analyzed. This is because to date, as for cellular organisms, it has not been possible to reconstitute functional initiation complexes in vitro with purified proteins apart from the case in E. coli.

The hyperthermophile Thermotoga maritima has been shown to be one of the most ancient eubacterial species by phylogenic analyses of ribosomal RNA and proteins, RNA polymerases, and translational elongation factors (Woese 1987; Nelson et al. 1999; Bocchetta et al. 2000). The optimal temperature for the growth of this bacterium is 80 °C. Of the 1877 open reading frames (ORFs) of this eubacterium, 24% are most similar to the ORFs of the Archaea (Nelson et al. 1999). Oligonucleotide sequence skew analysis suggests that the replication origin of this bacterium is within a 559-bp intergenic region (Lopez et al. 2000). This method identifies the asymmetric distribution of specific sequence motifs for the lagging and leading strands in the whole genome, thus permitting the identification of the origin (Mrazek & Karlin 1998; Lopez et al. 1999). As a series of previous studies supports the reliability of this method (Grigoriev 1998; Myllykallio et al. 2000; Mackiewicz et al. 2004), in the study reported here, we have defined the predicted site as the chromosomal origin of this bacterium (denoted as tma-oriC).

T. maritima DnaA homolog (tmaDnaA) has 29% identity and 47% similarity with E. coli DnaA at the amino acid level (Fig. 1). E. coli DnaA consists of four functional domains (Messer 2002; Giraldo 2003; Ishida et al. 2004): domains I–II include inter-protein interaction sites for DnaA itself, DnaB helicase and the initiation modulator DiaA. Also, domain II is proposed to include a flexible linker between domains I and III. Domain III carries the AAA+ motifs and domain IV does specific DNA-binding motifs. These motifs are highly conserved in tmaDnaA.


Figure 1
View larger version (54K):
[in this window]
[in a new window]
 
Figure 1  Amino acid sequence of tmaDnaA and E. coli DnaA. Amino acid residues comprising tmaDnaA (Tma) and E. coli DnaA (Eco) are shown using the single letter code. Identical residues are highlighted in black and chemically conserved residues are shown by shaded letters. Black bars with arrowheads and a closed box indicate domains (I to IV) and the helix-turn-helix DNA-binding motif (HTH) of E. coli DnaA, respectively. E. coli DnaA R399 (*) is essential for DNA binding and recognizes three bases of the 9-mer DnaA box sequence in the minor groove (Fujikawa et al. 2003). DnaA signature is a consensus motif among eubacterial DnaA homologs and includes residues that recognize the DnaA box sequence in the major groove (Messer 2002; Fujikawa et al. 2003). In domain III, the AAA+ motifs are indicated (Neuwald et al. 1999).

 
By using the purified tmaDnaA and tma-oriC, we succeeded in reconstituting a nucleoprotein initiation complex in vitro that could undergo site-specific DNA unwinding. We then determined the minimal origin region and its functional components. The overall structure of minimal tma-oriC was principally similar to that of the E. coli minimal oriC. We also found similarities in these sequences of functional components with those found in other bacterial species and the budding yeast. Furthermore, we found that the open complex formation was dependent on ATP bound to tmaDnaA. Thus, we established the regulated open complex formation using purified components of a cellular organism other than E. coli for the first time. The findings support the idea that the molecular mechanisms that initiate and regulate chromosomal replication are highly conserved in eubacterial evolution.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Purification and ATP-binding activity of tmaDnaA

TmaDnaA was over-expressed in E. coli cells such that about 5% of their total cellular proteins were composed of tmaDnaA. During the preparation of cleared lysates and incubation at 60 °C, the tmaDnaA protein remained soluble. After being concentrated by heparin-agarose affinity chromatography, tmaDnaA was further purified through precipitation by dialysis, solubilization by guanidine and gel-filtration (Fig. 2A), which is the same method used to purify E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kubota et al. 1997). At the gel-filtration step, tmaDnaA was eluted as a single peak at a position corresponding to its monomeric form (50 kDa). The purity of the tmaDnaA protein in the final fraction was > 95% (Fig. 2A). We recovered 2.9 mg of the protein from 7.2 L of cell culture.


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
Figure 2  Purification of tmaDnaA and interaction with ATP and ADP. (A) Purification of tmaDnaA. TmaDnaA overproduced in E. coli cells was purified as described in Experimental procedures. The proteins (1.5 µg) in each fraction (fraction I–V) were analyzed by 12% SDS-PAGE and Coomassie Brilliant Blue staining. TmaDnaA is indicated by an arrowhead. (B) Affinity of tmaDnaA for ATP and ADP. TmaDnaA (1.9 pmol) was incubated in buffer containing various concentrations (ranging from 0 to 0.4 nM) of [{alpha}-32P]ATP ({circ}) or [3H]ADP (•), followed by its retention on a membrane. (C) TmaDnaA slowly hydrolyzes ATP in a DNA-independent manner. [{alpha}-32P]ATP-tmaDnaA (1 pmol) was incubated for the indicated time at 48 °C or 0 °C in the presence ({circ}) or absence ({Delta}) of plasmid DNA (100 ng), followed by its retention on a membrane.

 
The affinities of tmaDnaA for ATP and ADP were determined by using a filter-retention assay. For both nucleotides, the dissociation constants (KD) were 40-50 nM and their binding stoichiometries were 0.3-0.4 per tmaDnaA molecule (Fig. 2B). These values are similar to those of E. coli DnaA (Sekimizu et al. 1987; Kawakami et al. 2005). To investigate the binding specificity of tmaDnaA for nucleotides, we performed competition experiments using the filter-retention assay (Table 1). ATP, ADP and ATP{gamma}S effectively inhibited the binding of [{alpha}-32P]ATP to tmaDnaA. In contrast, GTP, CTP and UTP had a negligible effect on the binding of [{alpha}-32P]ATP to tmaDnaA. This indicates tmaDnaA binds with high specificity to adenine nucleotides.


View this table:
[in this window]
[in a new window]
 
Table 1 Nucleotide binding specificity of tmaDnaA.
 
In the presence of nonspecific DNA, E. coli DnaA-ATP is slowly hydrolyzed at 37 °C by its weak intrinsic ATPase activity to produce ADP-DnaA (Sekimizu et al. 1987; Kawakami et al. 2005). We found that tmaDnaA-ATP was slowly hydrolyzed at 48 °C by its intrinsic activity in a DNA-independent manner, thereby producing the ADP-form (Fig. 2C). When tmaDnaA was absent under the same conditions, ATP hydrolysis was not observed (data not shown).

Sequence-specific DNA-binding of tmaDnaA

The tma-oriC region appears to be within a 559 bp intergenic region bearing a specific motif that is repeated 10 times; the 12-mer consensus sequence of this motif is AAACCTACCACC (Lopez et al. 2000) (Fig. 3A). By using a gel-mobility retardation assay, we found that tmaDnaA specifically binds to these 12-mer motifs. A typical result obtained using 18-bp DNA containing the consensus sequence is shown in Fig. 3B,C. We thus denoted the 12-mer motifs as tmaDnaA boxes (they are numbered from 1 to 10) (Fig. 3A). Whereas the affinity of E. coli DnaA for the five DnaA boxes within oriC varied considerably (Schaper & Messer 1995; Margulies & Kaguni 1996; McGarry et al. 2004), the affinity of tmaDnaA for the ten tmaDnaA boxes was relatively constant (Table 2).


Figure 3
View larger version (41K):
[in this window]
[in a new window]
 
Figure 3  Structure of tma-oriC and analysis of the DNA sequence-specific affinity of tmaDnaA. (A) Schematic presentation of the T. maritima genome and the tma-oriC region. The circle represents the whole genome and the relevant E. coli gene homologs are indicated (Nelson et al. 1999). An intergenic region between the two ORFs TM0151 and TM0152 is tma-oriC. This region contains ten repeats of a specific 12-mer sequence (open triangles) and an AT-rich cluster (gray box). In this study, we also found three repeats of a specific 9-mer AT-rich sequence (closed triangles) (see text). The nucleotide length (nt) scale is shown. (B) Gel-mobility retardation assay for analysis of the 12-mer sequence-specific affinity of tmaDnaA. The indicated amounts of tmaDnaA were incubated for 20 min at 40 °C in buffer containing 18 bp DNA (3 pmol) with (Consensus) or without (Nonsense) the consensus 12-mer sequence. The sequences of the 18-bp DNAs were 5'-AGAAAACCTACCACCTAA (Consensus) and 5'-AGACCCAAGCAACAATAA (Nonsense). 8% PAGE and Gel-Star (Cambrex) staining were performed at room temperature. (C) The protein-free DNA (Free) in (B) was quantified by densitometric scanning and an image-analyzing program. The amounts were normalized to those observed in the absence of tmaDnaA (Free DNA (%)). {circ} Consensus DNA; • Nonsense DNA.

 

View this table:
[in this window]
[in a new window]
 
Table 2 Relative affinities of tmaDnaA and E. coli DnaA for their cognate DnaA boxes
 
ATP-tmaDnaA, but not ADP-tmaDnaA, unwinds the tma-oriC duplex

Since purified tmaDnaA could bind tma-oriC and adenine nucleotides, we next used the P1 nuclease assay with a plasmid bearing the tma-oriC sequence (pOZ1) to determine whether an open complex is formed in an ATP-tmaDnaA-dependent manner. The P1 nuclease breaks DNA at single-stranded sites (Sekimizu et al. 1987). Digestion with AlwNI was used to specify the site of P1 nuclease cutting (Fig. 4A). When the tma-oriC region is unwound, digestion with P1 nuclease and AlwNI produces fragments of about 2.5 kb and 1.0 kb. We found that when ATP-tmaDnaA and the supercoiled pOZ1 plasmid were incubated at 48 °C in the presence of E. coli HU protein and 5 mM ATP, the tma-oriC region was unwound specifically (Fig. 4B–D). The E. coli HU protein is a histone-like nucleoid protein that is heat stable (Drlica & Rouviere-Yaniv 1987).


Figure 4
View larger version (43K):
[in this window]
[in a new window]
 
Figure 4  Analysis of the DNA unwinding activity of tmaDnaA. (A) Structure of the tma-oriC-bearing plasmid pOZ1. All the experiments below employed the supercoiled form of this plasmid (400 ng; 170 fmol as a circle). (B) P1 nuclease assay. The indicated amounts of ATP- or ADP-tmaDnaA were incubated for 10 min at 48 °C in buffer (50 µL) containing pOZ1 and E. coli HU protein (16 ng; 850 fmol), followed by digestion with P1 nuclease and AlwNI. The samples were analyzed by 1% agarose gel electrophoresis and ethidium bromide staining. (C) The DNA fragments shown in (B) were quantified by densitometric scanning and an image-analyzing program. The total amounts of the 2.5 kb and 1.0 kb fragments were normalized to the total DNA amounts and are plotted as open complex (%). (D) The unwinding reactions containing pOZ1, HU protein (16 ng) and ATP- or ADP-tmaDnaA (5 pmol) were incubated for the indicated times at 48 °C, followed by analysis using P1 nuclease as above. (E) The unwinding reactions containing pOZ1, HU protein (16 ng) and the indicated amounts of ATP-tmaDnaA were incubated for 3 min at the indicated temperatures, followed by analysis using P1 nuclease as above. (F) The unwinding reactions containing pOZ1, ATP-tmaDnaA (5 pmol), and the indicated amounts of HU protein were incubated for 10 min at 48 °C, followed by analysis using P1 nuclease as above.

 
ADP-tmaDnaA was largely unable to induce tma-oriC unwinding as only minimal amounts of P1 nuclease-digestion products were seen (Fig. 4B–D). The ATP-tmaDnaA-dependent unwinding required a temperature of 43 °C or higher (Fig. 4E). The presence of HU protein was required for this unwinding but excessive amounts of it inhibited this reaction (Fig. 4F). This suggests that the specific superhelical tension of DNA is required for the unwinding reaction (Hwang & Kornberg 1992a). The linear form of pOZ1 was completely inactive with regard to unwinding (data not shown). Moreover, a concentration of ATP at 1 mM or higher was also required for unwinding (data not shown). These requirements of the site-specific unwinding of tma-oriC are similar to those for the unwinding of E. coli oriC (Bramhill & Kornberg 1988; Hwang & Kornberg 1992a; Messer 2002).

The unwinding site of tma-oriC is within the AT-rich repeats

To determine the region of tma-oriC that is subjected to duplex unwinding, we performed primer extension experiments after open complex formation and P1 nuclease-digestion (Fig. 5A). The primer extension product was about 530 bases, which indicates that the unwinding region is located on the left terminus of tma-oriC. We found that this region contains AT-rich sequence repeats with a 9-mer consensus of TATTATTNA (Fig. 5B). This AT-rich feature of the DNA-unwinding motif in tma-oriC is shared by the replication origins from several other bacterial species (Bramhill & Kornberg 1988; Yoshikawa & Ogasawara 1991). Thus, we suggest that a specific open complex is formed on tma-oriC in an ATP-tmaDnaA-dependent manner.


Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
Figure 5  Analysis of the unwinding site within tma-oriC. (A) The unwinding reaction containing pOZ1, HU protein and ATP-tmaDnaA (5 pmol) was incubated for 10 min at 48 °C and P1 nuclease digestion was performed. The DNA was then isolated and subjected to primer extension analysis with the indicated 32P-labeled primer. The products were analyzed by 5% Long Ranger PAGE (Cambrex). In the negative control, P1 nuclease digestion was omitted (P1, –). As a size control, pOZ1 was digested with MfeI and subjected to the primer extension experiments under the same conditions (MfeI). The positions of the size markers ({phi}X174 DNA HinfI fragments) are also indicated. The structure of the tma-oriC region is also indicated using the same symbols shown in Figure 3. The scale beside the tma-oriC structure indicates the distance from the primer (arrowhead). U, the unwound site. nt, nucleotides. M, the MfeI site. (B) The AT-rich 9-mer sequences within the minimal tma-oriC are shown (AT-1-3). Conserved residues (white letters) and consensus sequence (Cs) are also indicated.

 
A primer extension product with about 220 bases was very slightly detected (Fig. 5A). This size corresponds to the region of tmaDnaA box 8. As shown below, this region is outside of the minimal origin region and has no effect for open complex formation. Unwinding at this region is substantially ineffective for initiation.

The minimal oriC region contains the two AT-rich repeats and five DnaA boxes

To determine the minimal tma-oriC sequence needed for open complex formation, we used the P1 nuclease assay with a series of deletion derivatives of pOZ1. Our results revealed that the deletion derivative pOZ14 carried the minimal requirements for unwinding (Fig. 6A). The 149-bp tma-oriC region in this plasmid contains the two 9-mer AT-rich repeats and five tmaDnaA boxes. The minimal E. coli oriC is constituted similarly (Bramhill & Kornberg 1988; Messer 2002). The AT-rich cluster in the central part of tma-oriC was unnecessary for the unwinding event. Moreover, we showed again that the duplex unwinding of the minimal region depended on the ATP form of tmaDnaA (Fig. 6B,C).


Figure 6
View larger version (37K):
[in this window]
[in a new window]
 
Figure 6  Analysis of the minimal tma-oriC region needed for open complex formation in vitro. (A) The structure of the tma-oriC region is shown using the same symbols described in Figure 3. The tma-oriC regions carried by pOZ1 and its derivatives are shown below (open and closed boxes). The unwinding reaction mixtures containing a supercoiled form of each plasmid (400 ng), HU protein (16 ng) and ATP-tmaDnaA (5 pmol) were incubated for 10 min at 48 °C, followed by P1 nuclease analysis as described in Figure 4. pOZ14 contained the minimal tma-oriC region needed for open complex formation in vitro (closed box). (B, C) The unwinding reaction mixtures containing a supercoiled form of pOZ14 (400 ng; 200 fmol as circle), HU protein (16 ng) and the indicated amounts of ATP- or ADP-tmaDnaA were incubated for 10 min at 48 °C, followed by P1 nuclease analysis as described in Figure 4.

 
Cooperative DNA-binding of ATP-tmaDnaA

The cooperative binding of DnaA to oriC is an important feature in the process that generates the initiation complex in E. coli (Margulies & Kaguni 1996; Messer 2002; Leonard & Grimwade 2005). To ask whether tmaDnaA also cooperatively binds to DNA, we incubated a 24-bp DNA fragment containing a single tmaDnaA box with various amounts of tmaDnaA and then subjected the mixture to the gel-mobility retardation assay (Fig. 7A). When ADP-tmaDnaA was used, two discrete complexes with different mobilities were formed. The complex with the higher mobility probably contains a single tmaDnaA molecule (Fig. 7A, Complex I). E. coli DnaA binds to a single DnaA box as a momomer, and the mobility of Complex I is similar to that of the similar DNA fragment carrying an E. coli DnaA box and bound DnaA (data not shown). Most likely the complex with the lower mobility contains two tmaDnaA molecules (Fig. 7A, Complex II). When ATP-tmaDnaA was used, Complex II was the major product, even when the protein levels were limited (Fig. 7A). Moreover, considerable amounts of DNA remained in the gel well in a manner depending on ATP-tmaDnaA. Probably multimers of ATP-tmaDnaA are more efficiently formed on DNA than those of ADP-tmaDnaA. These observations and the data shown below suggest that the DNA-binding of the ATP form is highly cooperative, whereas that of the ADP form is less so.


Figure 7
View larger version (50K):
[in this window]
[in a new window]
 
Figure 7  Gel-mobility retardation assay for analysis of the DNA interaction modes of tmaDnaA. (A) The indicated amounts of tmaDnaA were incubated for 20 min at 48 °C in buffer containing 24-bp DNA (2 pmol) in the presence of ATP or ADP (1 mM). The reactions were analyzed using 8% PAGE as described for Figure 3B. The 24-mer sequence used was 5'-TACAGAAAACCTACCACCTAAAAT. CI, Complex I. CII, Complex II. Free, protein-free DNA. (B) TmaDnaA (0, 1, 2, 3, 5, 7.5 or 10 pmol) was incubated in buffer containing 0.5 pmol of the minimal tma-oriC (149 bp) for 20 min at 48 °C in the presence of 1 mM ATP or ADP. The samples were analyzed by 4% PAGE at cold room. Complexes I–VII are indicated. tmaDnaA/tma-oriC, ratio of tmaDnaA molecules input per tma-oriC fragment. (C) A long exposure of the gel of panel B for obvious visualization of Complex VII. Only lanes 5–7 and 12–14 are shown. (D) Relative size of Complex I–VI in panel B was deduced as double-strand DNA from LMW DNA ladder marker (New England Biolabs). {square} ATP-tmaDnaA-DNA complex. {blacksquare} ADP-tmaDnaA-DNA complex.

 
High-order structures of ATP- and ADP- tmaDnaA-oriC complexes

We next asked whether high-order structures containing tmaDnaA multimers are formed on the minimal tma-oriC. To do this, we used a gel-mobility retardation assay employing various amounts of tmaDnaA. At least six discrete complexes were formed (Fig. 7B, Complexes I–VI). The ATP form enhanced the formation of Complexes II and III at lower protein levels compared to the ADP form. In addition, when 20 molecules of tmaDnaA per tma-oriC were incubated, indiscrete complex was detected (Fig. 7B,C, Complex VII). We noticed that the large Complex VII was preferentially formed by ATP-tmaDnaA in comparison with ADP-tmaDnaA. These features coincide with the higher cooperativity of ATP-tmaDnaA binding. Moreover, the migration rates of ATP-tmaDnaA Complexes II–VI were, respectively, higher than those of the corresponding ADP-tmaDnaA Complexes II-VI (Fig. 7B,D). It is likely that the ATP-tmaDnaA-oriC complex is more compact than the ADP-tmaDnaA-oriC complex, which suggests that inter-DnaAinteraction in the ATP-tmaDnaA complex is tighter than that in the ADP-tmaDnaA complex.

tmaDnaA provokes DNA bending

E. coli DnaA bends DNA at an angle of about 42° by binding to the DnaA box (Schaper & Messer 1995; Fujikawa et al. 2003). To test whether tma-DnaA does the same, we performed a DNA-bending assay using ATP-tmaDnaA and a series of DNA fragments that bear a single tmaDnaA box at various locations (Fig. 8). DNA bending at the central part of the fragment retards its migration in gel more effectively than DNA bending at the end (Kim et al. 1989; Schaper & Messer 1995). Our results indicated that tmaDnaA binding indeed bends DNA, since we observed differences in migration depending on the location of the tmaDnaA box (Fig. 8). The bending angle was calculated to be about 40°, which is similar to that for E. coli DnaA. As the ATP form was used in these experiments, Complex II was formed more efficiently than Complex I. The bending angle was the same between these two complexes, which suggests that only a single tmaDnaA molecule that directly binds to the tmaDnaA box causes the DNA bending. Moreover, the bending angle observed was the same between the ATP and ADP forms of tmaDnaA (S. Ozaki and T. Katatyama, unpublished observations). This nucleotide form-independence in the bending angle was similarly observed for E. coli DnaA (K. Keyamura and T. Katatyama, unpublished observations).


Figure 8
View larger version (41K):
[in this window]
[in a new window]
 
Figure 8  DNA bending assay using tmaDnaA. (A) The DNA fragments bearing the tmaDnaA box (145 bp) at various positions were used for the bending assay. All fragments (145 bp) shown were isolated from pOZ2 (a tmaDnaA box-bearing pBend2-derivative) by using different restriction enzymes [BamHI (B), NruI (N), PvuII (P), XhoI (X) and MluI (M)]. The restriction sites and the tmaDnaA box (open boxes) are indicated. (B) Various DNA fragments with (+) or without ({Delta}) the tmaDnaA box (0.5 pmol) were incubated for 20 min at 48 °C in buffer containing ATP-tmaDnaA (1 pmol). The fragments without the tmaDnaA box (121 bp) were isolated from pBend2. The samples were then analyzed by 6% PAGE. The fragment numbers at the top of the gel correspond to those shown in panel A.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
In this study, we reconstituted in vitro a tmaDnaA-oriC complex that could undergo site-specific duplex unwinding. Significantly, we found that ATP-tmaDnaA, but not ADP-tmaDnaA, was needed for the formation of the open complex. Prior to this study, it had been shown with E. coli only, by using an in vitro reconstitution system, that open complex formation on the chromosomal origin is dependent on ATP. As T. maritima is one of the species that are located most closely in terms of evolutionary distance to the last universal common ancestor of cellular life (Woese 1987; Nelson et al. 1999; Bocchetta et al. 2000), the present study supports the notion that the ATP-dependent molecular switch for the initiator is an original system used to control chromosomal replication. We do not, however, exclude a possibility that quantitative values which we biochemically determined may be modified at 80 °C, an optimal temperature for growth of this bacterial species. AAA+ class ATP-binding motifs are common in initiation factors from various species, including the bacterial DnaA homologs and the eukaryotic and archaeal Orc1/Cdc6 homologs (Giraldo 2003; Iyer et al. 2004). We also found that some specific AAA+ motifs of tmaDnaA are required for open complex formation (S. Ozaki and T. Katatyama, unpublished observations). Structural analysis of the tmaDnaA initiation complex is also in progress.

Unlike the case for E. coli DnaA, the ATP form of tmaDnaA was more cooperative in DNA binding than the ADP form (Fig. 7). This feature might support the efficient assembly of ATP-tmaDnaA on tma-oriC at the high temperatures where this bacteria grow. In E. coli, DnaA-ATP is hydrolyzed in a postinitiation stage to prevent extra initiations during the cell cycle (Katayama et al. 1998; Kurokawa et al. 1999). This hydrolysis is promoted by a specific complex formed by the Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp (Kato & Katayama 2001; Su’etsugu et al. 2005). As with E. coli DnaA, the intrinsic ATPase activity of tmaDnaA is very weak (Fig. 2C). However, the T. maritima genome does not encode an apparent Hda homolog (Nelson et al. 1999). This raises the question, what is the mechanism that regulates the DnaA-nucleotide switch in this bacterium? Further analysis is needed to address this question.

We determined the minimal tma-oriC region that forms an open complex (Fig. 6). It was found to be a 149-bp fragment that bears two AT-rich 9-mer repeats and five repeats of the 12-mer tmaDnaA boxes (Fig. 9A). The tmaDnaA box cluster is presumably specific for the tma-oriC region on the T. maritima genome. When we searched the whole genome for each of the tmaDnaA boxes present in the 559-bp tma-oriC region, only two copies were found at distant sites except for the tma-oriC region.


Figure 9
View larger version (28K):
[in this window]
[in a new window]
 
Figure 9  Comparison of origin motifs. (A) Structure of the minimal regions of tma-oriC and E. coli oriC required for open complex formation. Open triangles, tmaDnaA boxes 1–5 and E. coli DnaA boxes R1–4 and M; gray triangles, ATP-DnaA-specific binding sites (I and {tau} sites); closed triangles, AT-rich repeats within the unwinding region of T. maritima or E. coli.(B) The AT-rich 9-mer repeat sequence of tma-oriC (Tma) is aligned with the DNA-unwinding motifs of E. coli oriC (Eco), B. subtilis (Bsu) oriC, and S. cerevisiae ARS305 (Sc). A possible common sequence (Cs) is shown below. Residues that are identical among three or four of the species are shown in upper case. (C) The consensus sequence of the tmaDnaA box (Tma) is aligned with that of the E. coli DnaA box (Eco) along with those of the Orc1/Cdc6 homolog-binding motifs of archaeal M. thermoautotrophicus (Mth) and the ACS of S. cerevisiae (Sc). A possible common sequence (Cs) is shown below as in (B).

 
The E. coli minimal oriC bears the ATP-DnaA-specific binding sites called I1-I3, {tau}1 and {tau}2 in addition to the DnaA boxes R1-R4 and M (Bramhill & Kornberg 1988; Messer 2002; McGarry et al. 2004; Kawakami et al. 2005) (Fig. 9A). The I1–I3 sites are 9-mer sequences that differ from 3 to 4 bases from the DnaA box consensus (McGarry et al. 2004). The {tau}1and {tau}2 sites are also 9-mer sequences that share sequence homology with the I2 and I3 sites (Kawakami et al. 2005). The composition of tmaDnaA boxes 1–4 is similar to that of the ATP-DnaA-binding sites within the E. coli minimal oriC, which further suggests that structures of initiation complexes in these two evolutionarily distant species have features in common.

In other bacterial species such as Bacillus subtilis, Pseudomonous putida, Thermus thermophilus, Streptomyces sp., Mycobacterium sp. and Vibrio sp., the proposed origin regions contain six or more repeats of their cognate DnaA boxes (Jakimowicz et al. 1998; Messer 2002; Egan & Waldor 2003). However, the minimal region required for open complex formation has not been determined for any of these species. As with T. maritima, all of the DnaA-binding elements may not necessarily be required for open complex in these species. The role played by the tmaDnaA boxes outside the minimal region of tma-oriC remains to be elucidated.

We found the AT-rich 9-mer repeats in the unwinding region of tma-oriC (Fig. 5). This 9-mer sequence is significantly similar to sequences within the unwinding elements determined for three other species, E. coli, B. subtilis and S. cerevisiae (Fig. 9B). In B. subtilis, we noticed that the unique 9-mer sequence repeats three times within the AT-rich 27-mer region of the DNA unwinding unit (Krause et al. 1997). These common features of the origin motifs further support the notion that the initiation mechanisms of distantly related species share a common basis. Notably, the unwinding motifs carry thymine-rich sequences (Fig. 9B). The replication origins of Schizosaccharomyces pombe are also proposed to include the thymine clusters (Okuno et al. 1999; Dai et al. 2005). Importance of the thymine clusters within the origin is suggested in the finding that unwinding activity of mammalian MCM replicative helicase is activated by the thymine-rich single-stranded DNA (You et al. 2003). In the 13-mer E. coli unwinding unit, the 9-mer sequence excluding the GATC sequence is known to contain features other than AT-richness that are needed for initiation in vitro and in vivo (Hwang & Kornberg 1992b). It is likely that ATP-DnaA interacts with the single-strand of this region during initiation (Yung & Kornberg 1989; Speck & Messer 2001).

The GATC sequence in the 13-mer E. coli sequence is unique among the unwinding motifs of the four species (Fig. 9B). This tetramer is the recognition site of DNA-adenine methyltransferase, Dam, which is found mainly in the {gamma} proteobacterial division of eubacterial species (Boye et al. 2000; Hiraga et al. 2000; Messer 2002). In E. coli, the adenine residues on both strands within the palindromic GATC sequence are methylated by Dam. Replication temporarily produces the hemimethylated form of oriC and SeqA preferentially binds to the hemimethylated GATC sites, thereby inhibiting additional initiation events (Boye et al. 2000; Messer 2002). The T. maritima and B. subtilis genomes do not encode SeqA or Dam homologs (Nelson et al. 1999), like the majority of eubacterial species (Hiraga et al. 2000). The tmaDnaA box sequence is absent in the dnaA-homolog gene of the T. maritima genome. Thus, unlike the case of E. coli and B. subtilis (Messer 2002), it does not appear that the dnaA-homolog gene in T. maritima is subject to transcriptional autoregulation. These observations are consistent with the idea that the DnaA-adenine nucleotide switch plays a significant role in the control for the replication cycle of this evolutionarily most ancient bacterium.

The E. coli DnaA box is widely conserved among DnaA boxes in eubacterial species (Yoshikawa & Ogasawara 1991; Jakimowicz et al. 1998; Messer 2002). The 3'-terminal sequence (TACCAC) of the tmaDnaA box may be similar to the same region (TNCAC) of the E. coli DnaA box although it is less similar to the equivalent regions of the other binding sequences (Fig. 9C). However, we suggest that the sequence of the 12-mer tmaDnaA box shares similarity with the S. cerevisiae ORC-binding core site ACS (the autonomously replicating sequence consensus sequence) (Giraldo 2003) (Fig. 9C). The 5'-terminal 7-mer (AAACCTA) of the tmaDnaA box is similar to the 5'-terminus (AAACATA) of ACS. Of 11 residues of the ACS, 7 are identical to the archaeal Orc1/Cdc6-binding consensus (Fig. 9C). The archaeal sequence has been suggested to be widely conserved among the binding motifs in archaeal species (Capaldi & Berger 2004; Robinson et al. 2004). These features are consistent with the idea that the binding proteins evolutionarily differentiated from the common ancestor.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Construction of plasmid DNA

To construct the tmaDnaA-overproducing plasmid, tmaDnaA protein coding-region (1.3 kb) was amplified from the T. maritima genome by PCR using the primers 5'-CGCTCTAGAAGGAGATATACATATGAAAGAGAGAATACTCCAGG and 5'-CCCAAGCTTAACCGCTCAGGGCTCTCC. The first primer contains the Shine-Dalgarno sequence from T7 phage gp10. The PCR product was ligated to the pBAD18 vector (Guzman et al. 1995), resulting in pTHMA-1.

To construct the tma-oriC containing plasmid, tma-oriC region (591 bp) was amplified from the T. maritima genome by PCR using the primers 5'-CGCGGATCCCCTCTTTTCAGGATCAATTATACTGC and 5'-CCGGAATTCGCCATAGTTCCTCTCTCAAGCTC, then ligated to the BamHI/EcoRI sites of pBluescript II vector (Stratagene), resulting in pOZ1 (3.5 kb). pOZ3, pOZ5 and pOZ6 were pOZ1-derivatives deleting the EcoRI-MfeI, EcoRI-SspI EcoRI-BciVI fragments, respectively. pOZ8, pOZ9 and pOZ10 were obtained from pOZ1 by PCR using a set of a forward primer (5'-GGAACTATGGCGAATTCGATATCAAGC) and a reverse primer (5'-CCGGAATTCAAACCTACCACTTACCTACCACTTACCTACCACCCGGGTGGTAAGTTGCAGAC, 5'-CCGGAATTCTTACCTACCACTTACCTACCACCCGGGTGGTAAGTTGCAGAC or 5'-CCGGAATTCTTACCTACCACCCGGGTGGTAAGTTGCAGAC, respectively). pOZ14 and pOZ15 were obtained from pOZ8 by PCR using a set of a forward primer (5'-TCCTGAAAAGAGGGGATCCAC) and a reverse primer (5'- CTGCTATTATTAGTAGTAG or 5'- TAGTAGTAAATAATAGGGGACGC, respectively).

pOZ2, which was used to generate the fragments bearing a 12-mer tmaDnaA box in various places, was constructed by inserting a 24-bp synthetic DNA that bears a 12-mer tmaDnaA box (5'- TACAGAAAACCTACCACCTAAAAT) into the SalI/XbaI sites of pBend2 (Kim et al. 1989).

Purification of tmaDnaA protein

TmaDnaA was purified by a similar method used to purify E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kubota et al. 1997). E. coli BL21 (DE3) cells bearing pTHMA-1 were grown at 37 °C in 7.2 L of LB medium containing 50 µg/mL ampicillin until the optical density (A595) reached 0.4. Thereafter, the cells were incubated for 2 h in the presence of 1% arabinose, harvested by centrifugation, resuspended to an optical density (A595) of 200 in cold buffer A [50 mM HEPES-KOH (pH 7.6), 1 mM EDTA and 2 mM dithiothreitol], frozen in liquid nitrogen and stored at –80 °C. The thawed suspension was diluted two-fold in buffer A containing 250 mM KCl, 20 mM spermidine-HCl, 2 mM dithiothreitol, 5 mM EDTA, and 0.3 mg/mL lysozyme, kept for 30 min on ice, and frozen in liquid nitrogen. After thawing at 0–4 °C, cleared lysates were obtained by centrifugation at 49 000 r.p.m. for 40 min in a Beckman Ti 50–2 rotor, resulting in fraction I (16 mg/mL of protein, 120 mL). Fraction I was incubated for 30 min at 60 °C and soluble proteins were obtained by centrifugation at 18 000 r.p.m. for 20 min in a Beckman JA-20. The following procedures were performed at cold temperatures. The supernatant (fraction II; 3.9 mg/mL of protein, 100 mL) was diluted in buffer A containing 10% glycerol to a conductivity equivalent to buffer A containing 200 mM KCl. One-eighth volume of the resulting solution (23 mL) was loaded on to a 5 mL heparin-agarose column (Amersham Biosciences) equilibrated with buffer A containing 200 mM KCl and 10% glycerol at a flow rate of 0.5 mL/min. The column was washed with 3 column volumes of the same buffer. Proteins eluted with a linear gradient of 200–500 mM KCl formed a single sharp peak around 300 mM KCl. The steps using the heparin-agarose column were repeated and the peak fractions were collected (fraction III; 0.6 mg/mL of protein, 100 mL). Fraction III was dialyzed for 12 h against buffer A and the precipitates formed during dialysis were collected by centrifugation at 18 000 r.p.m. for 20 min in a Beckman JA-20 rotor. One-eighth volume of these precipitates was resuspended in buffer A containing 4 M guanidine-HCl by brief sonication. The supernatant (fraction IV; 4.4 mg/mL of protein, 100 µL) was then obtained by centrifugation at 14 000 r.p.m. for 10 min in a Himac T15AP21 rotor and gel-filtered on a Superose 12 HR10/30 column equilibrated with buffer A containing 500 mM KCl and 10% glycerol at a flow rate of 0.2 mL/min. The peak fractions were pooled (fraction V; 0.2 mg/mL of protein, 1.8 mL).

Nucleotide binding and ATP hydrolysis assays

Assays analyzing the nucleotide-binding activities of tmaDnaA and tmaDnaA-intrinsic ATPase were performed essentially as previously described for E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kawakami et al. 2005). Briefly, tmaDnaA (1.9 pmol) was incubated for 5 min at 38 °C in buffer containing 50 mM HEPES-KOH (pH 7.6), 0.3 mM EDTA, 7 mM dithiothreitol, 20% glycerol, 0.007% Triton X-100, and [{alpha}-32P] ATP or [3H] ADP and further incubated for 15 min at 0 °C in the presence of 2.5 mM magnesium acetate. Samples were filtered through nitrocellulose membranes and the radioactivity that was retained was quantified by using a liquid scintillation counter. In the competition assay, tmaDnaA (1.3 pmol) was incubated as described above but in the presence of 1 µM[{alpha}-32P] ATP and 50 µM competitor nucleotide. For the tmaDnaA-intrinsic ATPase assay, [{alpha}-32P]ATP-tmaDnaA (1 pmol) was incubated at 48 °C in the same buffer described above in the presence of 2.5 mM magnesium acetate and pOZ1 DNA (100 ng), followed by its retention on membranes and analysis by thin layer chromatography and the use of the BAS2500 (Fuji Film) image analyzer.

Gel-mobility retardation assay

This assay was performed essentially as previously described (Schaper & Messer 1995; Kawakami et al. 2005). Briefly, tmaDnaA was incubated for 20 min at 40 °C in buffer (20 µL) containing 20 mM HEPES-KOH (pH 7.6), 1 mM EDTA, 2 mM dithiothreitol, 5 mM magnesium acetate, 200 mM KCl, 10% glycerol, 0.2% Triton X-100, 1 mM ATP and 18-bp DNA (3 pmol). When 24-bp DNA (2 pmol) was used, tmaDnaA was incubated in the same buffer (10 µL) described above except for the presence of 1 mM ATP or ADP. In the DNA-bending assay, tmaDnaA was incubated in the same buffer described above (10 µL). DNA was stained with Gel-Star (Cambrex).

Open complex formation assay using P1 nuclease and primer extension analysis

This assay was performed essentially as previously described (Sekimizu et al. 1987; Nishida et al. 2002; Kawakami et al. 2005). ATP/ADP-tmaDnaA was obtained by incubation in buffer containing 3 µM ATP/ADP under the same conditions described for the nucleotide-binding assay. Buffer (50 µL) for unwinding reaction contained 60 mM HEPES-KOH (pH 7.6), 8 mM magnesium acetate, 30% (v/v) glycerol, 0.32 mg/mL bovine serum albumin, 16 ng HU protein, 5 mM ATP, and a supercoiled form of plasmid (400 ng), unless noted. This buffer was incubated for 1 min at 48 °C, followed by incubation for 10 min at the same temperature in the presence of the ATP or ADP-form of tmaDnaA as indicated. After P1 nuclease digestion (25 units, Yamasa Co.) for 120 s at the same temperature, the DNA was purified and one-tenth volume of the reaction was subjected to digestion with AlwNI. Primer extension analysis was performed as previously described (Hwang & Kornberg 1990). A 32P-end labeled primer (5'-CCGGAATTCGCCATAGTTCCTCTCTCAAGCTC) and the DNA polymerase I Large Fragment were used.


    Acknowledgements
 
We are grateful to Drs Takeyoshi Wakagi and Hiroshi Yoshikawa for the T. maritima genome DNA and valuable suggestions on ACS, respectively. This study was supported in part by a research grant from the Naito Foundation and by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    Footnotes
 
Communicated by: Hiroyuki Araki

* Correspondence: E-mail: katayama{at}phar.kyushu-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bell, S.P. (2002) The origin recognition complex: from simple origins to complex functions. Genes Dev. 16, 659–672.[Free Full Text]

Bocchetta, M., Gribaldo, S., Sanangelantoni, A. & Cammarano, P. (2000) Phylogenetic depth of the bacterial genera Aquifex and Thermotoga inferred from analysis of ribosomal protein, elongation factor, and RNA polymerase subunit sequences. J. Mol. Evol. 50, 366–380.[Medline]

Boye, E., Løbner-Olesen, A. & Skarstad, K. (2000) Limiting DNA replication to once and only once. EMBO Rep. 1, 479–483.[Medline]

Bramhill, D. & Kornberg, A. (1988) A model for initiation at origins of DNA replication. Cell 54, 915–918.[CrossRef][Medline]

Capaldi, S.A. & Berger, J.M. (2004) Biochemical characterization of Cdc6/Orc1 binding to the replication origin of the euryarchaeon Methanothermobacter thermoautotrophicus. Nucleic Acids Res. 32, 4821–4832.[Abstract/Free Full Text]

Dai, J., Chuang, R.-Y. & Kelly, T.J. (2005) DNA replication origin in the Schizosaccharomyces pombe genome. Proc. Natl. Acad. Sci. USA 102, 337–342.[Abstract/Free Full Text]

Drlica, K. & Rouviere-Yaniv, J. (1987) Histonelike proteins of bacteria. Microbiol. Rev. 51, 301–319.[Free Full Text]

Egan, E.S. & Waldor, M.K. (2003) Distinct replication requirements for the two Vibrio cholerae chromosomes. Cell 114, 521–530.[CrossRef][Medline]

Fujikawa, N., Kurumizaka, H., Nureki, O., et al. (2003) Structural basis of replication origin recognition by the DnaA protein. Nucleic Acids Res. 31, 2077–2086.[Abstract/Free Full Text]

Giraldo, R. (2003) Common domains in the initiators of DNA replication in Bacteria, Archaea and Eukarya: combined structural, functional and phylogenetic perspectives. FEMS Microbiol. Rev. 26, 533–554.[CrossRef][Medline]

Grigoriev, A. (1998) Analyzing genomes with cumulative skew diagrams. Nucleic Acids Res. 26, 2286–2290.[Abstract/Free Full Text]

Guzman, L.M., Belin, D., Carson, M.J. & Beckwith, J. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130.[Abstract/Free Full Text]

Hiraga, S., Ichinose, C., Onogi, T., Niki, H. & Yamazoe, M. (2000) Bidirectional migration of SeqA-bound hemimethylated DNA clusters and pairing of oriC copies in Escherichia coli. Genes Cells 5, 327–341.[Abstract]

Hwang, D.S. & Kornberg, A. (1990) A novel protein binds a key origin sequence to block replication of an E. coli minichromosome. Cell 63, 325–331.[CrossRef][Medline]

Hwang, D.S. & Kornberg, A. (1992a) Opening of the replication origin of Escherichia coli by DnaA protein with protein HU or IHF. J. Biol. Chem. 267, 23083–23086.[Abstract/Free Full Text]

Hwang, D.S. & Kornberg, A. (1992b) Opposed actions of regulatory proteins, DnaA and IciA, in opening the replication origin of Escherichia coli. J. Biol. Chem. 267, 23087–23091.[Abstract/Free Full Text]

Ishida, T., Akimitsu, N., Kashioka, T., et al. (2004) DiaA, a novel DnaA-binding protein, ensures the initiation timing of Escherichia coli chromosome replication. J. Biol. Chem. 279, 45546–45555.[Abstract/Free Full Text]

Iyer, L.M., Leipe, D.D., Koonin, E.V. & Aravind, L. (2004) Evolutionary history and higher order classification of AAA+ ATPases. J. Struct. Biol. 146, 11–31.[CrossRef][Medline]

Jakimowicz, D., Majka, J., Messer, W., et al. (1998) Structural elements of the Streptomyces oriC region and their interactions with the DnaA protein. Microbiology 144, 1281–1290.[Abstract]

Katayama, T. (1994) The mutant DnaAcos protein which overinitiates replication of the Escherichia coli chromosome is inert to negative regulation for initiation. J. Biol. Chem. 269, 22075–22079.[Abstract/Free Full Text]

Katayama, T., Kubota, T., Kurokawa, K., Crooke, E. & Sekimizu, K. (1998) The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase. Cell 94, 61–71.[CrossRef][Medline]

Kato, J. & Katayama, T. (2001) Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli. EMBO J. 20, 4253–4262.[CrossRef][Medline]

Kawakami, H., Keyamura, K. & Katayama, T. (2005) Formation of an ATP-DnaA-specific initiation complex requires DnaA arginine-285, a conserved motif in the AAA+ protein family. J. Biol. Chem. 280, 27420–27430.[Abstract/Free Full Text]

Kim, J., Zwieb, C., Wu, C. & Adhya, S. (1989) Bending of DNA by gene-regulatory proteins: construction and use of a DNA bending vector. Gene 85, 15–23.[CrossRef][Medline]

Klemm, R.D., Austin, R.J. & Bell, S.P. (1997) Coordinate binding of ATP and origin DNA regulates the ATPase activity of the origin recognition complex. Cell 88, 493–502.[CrossRef][Medline]

Krause, M., Ruckert, B., Lurz, R. & Messer, W. (1997) Complexes at the replication origin of Bacillus subtilis with the homologous and heterologous DnaA protein. J. Mol. Biol. 274, 365–380.[CrossRef][Medline]

Kubota, T., Katayama, T., Ito, Y., Mizushima, T. & Sekimizu, K. (1997) Conformational transition of DnaA protein by ATP: structural analysis of DnaA protein, the initiator of Escherichia coli chromosome replication. Biochem. Biophys. Res. Commun. 232, 130–135.[CrossRef][Medline]

Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K. & Katayama, T. (1999) Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli. EMBO J. 18, 6642–6652.[CrossRef][Medline]

Leonard, A.C. & Grimwade, J.E. (2005) Building a bacterial orisome: emergence of new regulatory features for replication origin unwinding. Mol. Microbiol. 55, 978–985.[CrossRef][Medline]

Lopez, P., Forterre, P., Guyader, H. & Philippe, H. (2000) Origin of replication of Thermotoga maritima. Trends Genet. 16, 59–60.[CrossRef][Medline]

Lopez, P., Philippe, H., Myllykallio, H. & Forterre, P. (1999) Identification of putative chromosomal origins of replication in archaea. Mol. Microbiol. 32, 883–886 .[CrossRef][Medline]

Mackiewicz, P., Zakrzewska-Czerwinska, J., Zawilak, A., Dudek, M.R. & Cebrat, S. (2004) Where does bacterial replication start? Rules for predicting the oriC region. Nucleic Acids Res. 32, 3781–3791.[Abstract/Free Full Text]

Margulies, C. & Kaguni, J.M. (1996) Ordered and sequential binding of DnaA protein to oriC, the chromosomal origin of Escherichia coli. J. Biol. Chem. 271, 17035–17040.[Abstract/Free Full Text]

McGarry, K.C., Ryan, V.T., Grimwade, J.E. & Leonard, A.C. (2004) Two discriminatory binding sites in the Escherichia coli replication origin are required for DNA strand opening by initiator DnaA-ATP. Proc. Natl. Acad. Sci. USA 101, 2811–2816.[Abstract/Free Full Text]

Messer, W. (2002) The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev. 26, 355–374.[Medline]

Mrazek, J. & Karlin, S. (1998) Strand compositional asymmetry in bacterial and large viral genomes. Proc. Natl. Acad. Sci. USA 95, 3720–3725.[Abstract/Free Full Text]

Myllykallio, H., Lopez, P., Lopez-Garcia, P., et al. (2000) Bacterial mode of replication with eukaryotic-like machinery in a hyperthermophilic archaeon. Science 288, 2212–2215.[Abstract/Free Full Text]

Nelson, K.E., Clayton, R.A., Gill, S.R., et al. (1999) Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature 399, 323–329.[CrossRef][Medline]

Neuwald, A.F., Aravid, L., Spouge, J.L. & Koonin, E.V. (1999) AAA+: a class of chaperon-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res. 9, 27–43.[Abstract/Free Full Text]

Nishida, S., Fujimitsu, K., Sekimizu, K., Ohmura, T., Ueda, T. & Katayama, T. (2002) A nucleotide switch in the Escherichia coli DnaA protein initiates chromosomal replication: evidence from a mutant DnaA protein defective in regulatory ATP hydrolysis in vitro and in vivo. J. Biol. Chem. 277, 14986–14995.[Abstract/Free Full Text]

Okuno, Y., Satoh, H., Sekiguchi, M. & Masukata, H. (1999) Clustered adenine/thymine stretches are essential for function of a fission yeast replication origin. Mol. Cell. Biol. 19, 6699–6709.[Abstract/Free Full Text]

Robinson, N.P., Dionne, I., Lundgren, M., Marsh, V.L., Bernander, R. & Bell, S.D. (2004) Identification of two origins of replication in the single chromosome of the archaeon Sulfolobus solfataricus. Cell 116, 25–38.[CrossRef][Medline]

Schaper, S. & Messer, W. (1995) Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem. 270, 17622–17626.[Abstract/Free Full Text]

Sekimizu, K., Bramhill, D. & Kornberg, A. (1987) ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome. Cell 50, 259–265.[CrossRef][Medline]

Speck, C. & Messer, W. (2001) Mechanism of origin unwinding: sequential binding of DnaA to double- and single-stranded DNA. EMBO J. 20, 1469–1476.[CrossRef][Medline]

Stillman, B. (2005) Origin recognition and the chromosome cycle. FEBS Lett. 579, 877–884.[CrossRef][Medline]

Su’etsugu, M., Shimuta, T., Ishida, T., Kawakami, H. & Katayama, T. (2005) Protein associations in DnaA-ATP hydrolysis mediated by the Hda-replicase clamp complex. J. Biol. Chem. 280, 6528–6536.[Abstract/Free Full Text]

Woese, C.R. (1987) Bacterial evolution. Microbiol. Rev. 51, 221–271.[Free Full Text]

Yoshikawa, H. & Ogasawara, N. (1991) Structure and function of DnaA and the DnaA-box in eubacteria: evolutionary relationships of bacterial replication origins. Mol. Microbiol. 5, 2589–2597.[CrossRef][Medline]

You, Z., Ishimi, Y., Mizuno, T., Sugasawa, K., Hanaoka, F. & Masai, H. (2003) Thymine-rich single-stranded DNA activates Mcm4/6/7 helicase on Y-fork and bubble-like substrates. EMBO J. 22, 6148–6160.[CrossRef][Medline]

Yung, B.Y.-M. & Kornberg, A. (1989) The dnaA initiator protein binds separate domains in the replication origin of Escherichia coli. J. Biol. Chem. 264, 6146–6150.[Abstract/Free Full Text]

Received: 24 November 2005
Accepted: 9 January 2006




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Ozaki, H. Kawakami, K. Nakamura, N. Fujikawa, W. Kagawa, S.-Y. Park, S. Yokoyama, H. Kurumizaka, and T. Katayama
A Common Mechanism for the ATP-DnaA-dependent Formation of Open Complexes at the Replication Origin
J. Biol. Chem., March 28, 2008; 283(13): 8351 - 8362.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Keyamura, N. Fujikawa, T. Ishida, S. Ozaki, M. Su'etsugu, K. Fujimitsu, W. Kagawa, S. Yokoyama, H. Kurumizaka, and T. Katayama
The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP DnaA-specific initiation complexes
Genes & Dev., August 15, 2007; 21(16): 2083 - 2099.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Pei, J. Liu, J. Li, A. Guo, J. Zhou, and H. Xiang
Mechanism for the TtDnaA-Tt-oriC cooperative interaction at high temperature and duplex opening at an unusual AT-rich region in Thermoanaerobacter tengcongensis
Nucleic Acids Res., May 14, 2007; 35(9): 3087 - 3099.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow