|
|
||||||||
1 Department of Molecular Biology, Graduate School of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan
2 Graduate School of Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It is likely that the DnaA protein originates from the same evolutionary ancestor as eukaryotic Orc1 and Cdc6 (Orc1 is a subunit of the origin recognition complex, ORC and Cdc6 is its binding factor) and the archaeal Orc1/Cdc6 homologs (Giraldo 2003; Iyer et al. 2004). These proteins are members of the AAA+ superfamily that carries unique ATP recognition motifs (Neuwald et al. 1999; Giraldo 2003). The binding of ATP to E. coli DnaA conformationally activates the initiation complex by altering modes in inter-DnaA interaction and in DnaA binding to specific sequences, which results in open complex formation (Speck & Messer 2001; McGarry et al. 2004; Kawakami et al. 2005). Similarly, Saccharomyces cerevisiae ORC binds to the origin DNA in a manner that depends on the binding of ATP to Orc1 (Klemm et al. 1997; Bell 2002; Stillman 2005). However, it remains unclear how highly the ATP-dependent activation of the initiation factor is conserved in evolution because the initiation proteins of other species have not been thoroughly analyzed. This is because to date, as for cellular organisms, it has not been possible to reconstitute functional initiation complexes in vitro with purified proteins apart from the case in E. coli.
The hyperthermophile Thermotoga maritima has been shown to be one of the most ancient eubacterial species by phylogenic analyses of ribosomal RNA and proteins, RNA polymerases, and translational elongation factors (Woese 1987; Nelson et al. 1999; Bocchetta et al. 2000). The optimal temperature for the growth of this bacterium is 80 °C. Of the 1877 open reading frames (ORFs) of this eubacterium, 24% are most similar to the ORFs of the Archaea (Nelson et al. 1999). Oligonucleotide sequence skew analysis suggests that the replication origin of this bacterium is within a 559-bp intergenic region (Lopez et al. 2000). This method identifies the asymmetric distribution of specific sequence motifs for the lagging and leading strands in the whole genome, thus permitting the identification of the origin (Mrazek & Karlin 1998; Lopez et al. 1999). As a series of previous studies supports the reliability of this method (Grigoriev 1998; Myllykallio et al. 2000; Mackiewicz et al. 2004), in the study reported here, we have defined the predicted site as the chromosomal origin of this bacterium (denoted as tma-oriC).
T. maritima DnaA homolog (tmaDnaA) has 29% identity and 47% similarity with E. coli DnaA at the amino acid level (Fig. 1). E. coli DnaA consists of four functional domains (Messer 2002; Giraldo 2003; Ishida et al. 2004): domains III include inter-protein interaction sites for DnaA itself, DnaB helicase and the initiation modulator DiaA. Also, domain II is proposed to include a flexible linker between domains I and III. Domain III carries the AAA+ motifs and domain IV does specific DNA-binding motifs. These motifs are highly conserved in tmaDnaA.
|
| Results |
|---|
|
|
|---|
TmaDnaA was over-expressed in E. coli cells such that about 5% of their total cellular proteins were composed of tmaDnaA. During the preparation of cleared lysates and incubation at 60 °C, the tmaDnaA protein remained soluble. After being concentrated by heparin-agarose affinity chromatography, tmaDnaA was further purified through precipitation by dialysis, solubilization by guanidine and gel-filtration (Fig. 2A), which is the same method used to purify E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kubota et al. 1997). At the gel-filtration step, tmaDnaA was eluted as a single peak at a position corresponding to its monomeric form (50 kDa). The purity of the tmaDnaA protein in the final fraction was > 95% (Fig. 2A). We recovered 2.9 mg of the protein from 7.2 L of cell culture.
|
S effectively inhibited the binding of [
-32P]ATP to tmaDnaA. In contrast, GTP, CTP and UTP had a negligible effect on the binding of [
-32P]ATP to tmaDnaA. This indicates tmaDnaA binds with high specificity to adenine nucleotides.
|
Sequence-specific DNA-binding of tmaDnaA
The tma-oriC region appears to be within a 559 bp intergenic region bearing a specific motif that is repeated 10 times; the 12-mer consensus sequence of this motif is AAACCTACCACC (Lopez et al. 2000) (Fig. 3A). By using a gel-mobility retardation assay, we found that tmaDnaA specifically binds to these 12-mer motifs. A typical result obtained using 18-bp DNA containing the consensus sequence is shown in Fig. 3B,C. We thus denoted the 12-mer motifs as tmaDnaA boxes (they are numbered from 1 to 10) (Fig. 3A). Whereas the affinity of E. coli DnaA for the five DnaA boxes within oriC varied considerably (Schaper & Messer 1995; Margulies & Kaguni 1996; McGarry et al. 2004), the affinity of tmaDnaA for the ten tmaDnaA boxes was relatively constant (Table 2).
|
|
Since purified tmaDnaA could bind tma-oriC and adenine nucleotides, we next used the P1 nuclease assay with a plasmid bearing the tma-oriC sequence (pOZ1) to determine whether an open complex is formed in an ATP-tmaDnaA-dependent manner. The P1 nuclease breaks DNA at single-stranded sites (Sekimizu et al. 1987). Digestion with AlwNI was used to specify the site of P1 nuclease cutting (Fig. 4A). When the tma-oriC region is unwound, digestion with P1 nuclease and AlwNI produces fragments of about 2.5 kb and 1.0 kb. We found that when ATP-tmaDnaA and the supercoiled pOZ1 plasmid were incubated at 48 °C in the presence of E. coli HU protein and 5 mM ATP, the tma-oriC region was unwound specifically (Fig. 4BD). The E. coli HU protein is a histone-like nucleoid protein that is heat stable (Drlica & Rouviere-Yaniv 1987).
|
The unwinding site of tma-oriC is within the AT-rich repeats
To determine the region of tma-oriC that is subjected to duplex unwinding, we performed primer extension experiments after open complex formation and P1 nuclease-digestion (Fig. 5A). The primer extension product was about 530 bases, which indicates that the unwinding region is located on the left terminus of tma-oriC. We found that this region contains AT-rich sequence repeats with a 9-mer consensus of TATTATTNA (Fig. 5B). This AT-rich feature of the DNA-unwinding motif in tma-oriC is shared by the replication origins from several other bacterial species (Bramhill & Kornberg 1988; Yoshikawa & Ogasawara 1991). Thus, we suggest that a specific open complex is formed on tma-oriC in an ATP-tmaDnaA-dependent manner.
|
The minimal oriC region contains the two AT-rich repeats and five DnaA boxes
To determine the minimal tma-oriC sequence needed for open complex formation, we used the P1 nuclease assay with a series of deletion derivatives of pOZ1. Our results revealed that the deletion derivative pOZ14 carried the minimal requirements for unwinding (Fig. 6A). The 149-bp tma-oriC region in this plasmid contains the two 9-mer AT-rich repeats and five tmaDnaA boxes. The minimal E. coli oriC is constituted similarly (Bramhill & Kornberg 1988; Messer 2002). The AT-rich cluster in the central part of tma-oriC was unnecessary for the unwinding event. Moreover, we showed again that the duplex unwinding of the minimal region depended on the ATP form of tmaDnaA (Fig. 6B,C).
|
The cooperative binding of DnaA to oriC is an important feature in the process that generates the initiation complex in E. coli (Margulies & Kaguni 1996; Messer 2002; Leonard & Grimwade 2005). To ask whether tmaDnaA also cooperatively binds to DNA, we incubated a 24-bp DNA fragment containing a single tmaDnaA box with various amounts of tmaDnaA and then subjected the mixture to the gel-mobility retardation assay (Fig. 7A). When ADP-tmaDnaA was used, two discrete complexes with different mobilities were formed. The complex with the higher mobility probably contains a single tmaDnaA molecule (Fig. 7A, Complex I). E. coli DnaA binds to a single DnaA box as a momomer, and the mobility of Complex I is similar to that of the similar DNA fragment carrying an E. coli DnaA box and bound DnaA (data not shown). Most likely the complex with the lower mobility contains two tmaDnaA molecules (Fig. 7A, Complex II). When ATP-tmaDnaA was used, Complex II was the major product, even when the protein levels were limited (Fig. 7A). Moreover, considerable amounts of DNA remained in the gel well in a manner depending on ATP-tmaDnaA. Probably multimers of ATP-tmaDnaA are more efficiently formed on DNA than those of ADP-tmaDnaA. These observations and the data shown below suggest that the DNA-binding of the ATP form is highly cooperative, whereas that of the ADP form is less so.
|
We next asked whether high-order structures containing tmaDnaA multimers are formed on the minimal tma-oriC. To do this, we used a gel-mobility retardation assay employing various amounts of tmaDnaA. At least six discrete complexes were formed (Fig. 7B, Complexes IVI). The ATP form enhanced the formation of Complexes II and III at lower protein levels compared to the ADP form. In addition, when 20 molecules of tmaDnaA per tma-oriC were incubated, indiscrete complex was detected (Fig. 7B,C, Complex VII). We noticed that the large Complex VII was preferentially formed by ATP-tmaDnaA in comparison with ADP-tmaDnaA. These features coincide with the higher cooperativity of ATP-tmaDnaA binding. Moreover, the migration rates of ATP-tmaDnaA Complexes IIVI were, respectively, higher than those of the corresponding ADP-tmaDnaA Complexes II-VI (Fig. 7B,D). It is likely that the ATP-tmaDnaA-oriC complex is more compact than the ADP-tmaDnaA-oriC complex, which suggests that inter-DnaAinteraction in the ATP-tmaDnaA complex is tighter than that in the ADP-tmaDnaA complex.
tmaDnaA provokes DNA bending
E. coli DnaA bends DNA at an angle of about 42° by binding to the DnaA box (Schaper & Messer 1995; Fujikawa et al. 2003). To test whether tma-DnaA does the same, we performed a DNA-bending assay using ATP-tmaDnaA and a series of DNA fragments that bear a single tmaDnaA box at various locations (Fig. 8). DNA bending at the central part of the fragment retards its migration in gel more effectively than DNA bending at the end (Kim et al. 1989; Schaper & Messer 1995). Our results indicated that tmaDnaA binding indeed bends DNA, since we observed differences in migration depending on the location of the tmaDnaA box (Fig. 8). The bending angle was calculated to be about 40°, which is similar to that for E. coli DnaA. As the ATP form was used in these experiments, Complex II was formed more efficiently than Complex I. The bending angle was the same between these two complexes, which suggests that only a single tmaDnaA molecule that directly binds to the tmaDnaA box causes the DNA bending. Moreover, the bending angle observed was the same between the ATP and ADP forms of tmaDnaA (S. Ozaki and T. Katatyama, unpublished observations). This nucleotide form-independence in the bending angle was similarly observed for E. coli DnaA (K. Keyamura and T. Katatyama, unpublished observations).
|
| Discussion |
|---|
|
|
|---|
Unlike the case for E. coli DnaA, the ATP form of tmaDnaA was more cooperative in DNA binding than the ADP form (Fig. 7). This feature might support the efficient assembly of ATP-tmaDnaA on tma-oriC at the high temperatures where this bacteria grow. In E. coli, DnaA-ATP is hydrolyzed in a postinitiation stage to prevent extra initiations during the cell cycle (Katayama et al. 1998; Kurokawa et al. 1999). This hydrolysis is promoted by a specific complex formed by the Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp (Kato & Katayama 2001; Suetsugu et al. 2005). As with E. coli DnaA, the intrinsic ATPase activity of tmaDnaA is very weak (Fig. 2C). However, the T. maritima genome does not encode an apparent Hda homolog (Nelson et al. 1999). This raises the question, what is the mechanism that regulates the DnaA-nucleotide switch in this bacterium? Further analysis is needed to address this question.
We determined the minimal tma-oriC region that forms an open complex (Fig. 6). It was found to be a 149-bp fragment that bears two AT-rich 9-mer repeats and five repeats of the 12-mer tmaDnaA boxes (Fig. 9A). The tmaDnaA box cluster is presumably specific for the tma-oriC region on the T. maritima genome. When we searched the whole genome for each of the tmaDnaA boxes present in the 559-bp tma-oriC region, only two copies were found at distant sites except for the tma-oriC region.
|
1 and
2 in addition to the DnaA boxes R1-R4 and M (Bramhill & Kornberg 1988; Messer 2002; McGarry et al. 2004; Kawakami et al. 2005) (Fig. 9A). The I1I3 sites are 9-mer sequences that differ from 3 to 4 bases from the DnaA box consensus (McGarry et al. 2004). The
1and
2 sites are also 9-mer sequences that share sequence homology with the I2 and I3 sites (Kawakami et al. 2005). The composition of tmaDnaA boxes 14 is similar to that of the ATP-DnaA-binding sites within the E. coli minimal oriC, which further suggests that structures of initiation complexes in these two evolutionarily distant species have features in common. In other bacterial species such as Bacillus subtilis, Pseudomonous putida, Thermus thermophilus, Streptomyces sp., Mycobacterium sp. and Vibrio sp., the proposed origin regions contain six or more repeats of their cognate DnaA boxes (Jakimowicz et al. 1998; Messer 2002; Egan & Waldor 2003). However, the minimal region required for open complex formation has not been determined for any of these species. As with T. maritima, all of the DnaA-binding elements may not necessarily be required for open complex in these species. The role played by the tmaDnaA boxes outside the minimal region of tma-oriC remains to be elucidated.
We found the AT-rich 9-mer repeats in the unwinding region of tma-oriC (Fig. 5). This 9-mer sequence is significantly similar to sequences within the unwinding elements determined for three other species, E. coli, B. subtilis and S. cerevisiae (Fig. 9B). In B. subtilis, we noticed that the unique 9-mer sequence repeats three times within the AT-rich 27-mer region of the DNA unwinding unit (Krause et al. 1997). These common features of the origin motifs further support the notion that the initiation mechanisms of distantly related species share a common basis. Notably, the unwinding motifs carry thymine-rich sequences (Fig. 9B). The replication origins of Schizosaccharomyces pombe are also proposed to include the thymine clusters (Okuno et al. 1999; Dai et al. 2005). Importance of the thymine clusters within the origin is suggested in the finding that unwinding activity of mammalian MCM replicative helicase is activated by the thymine-rich single-stranded DNA (You et al. 2003). In the 13-mer E. coli unwinding unit, the 9-mer sequence excluding the GATC sequence is known to contain features other than AT-richness that are needed for initiation in vitro and in vivo (Hwang & Kornberg 1992b). It is likely that ATP-DnaA interacts with the single-strand of this region during initiation (Yung & Kornberg 1989; Speck & Messer 2001).
The GATC sequence in the 13-mer E. coli sequence is unique among the unwinding motifs of the four species (Fig. 9B). This tetramer is the recognition site of DNA-adenine methyltransferase, Dam, which is found mainly in the
proteobacterial division of eubacterial species (Boye et al. 2000; Hiraga et al. 2000; Messer 2002). In E. coli, the adenine residues on both strands within the palindromic GATC sequence are methylated by Dam. Replication temporarily produces the hemimethylated form of oriC and SeqA preferentially binds to the hemimethylated GATC sites, thereby inhibiting additional initiation events (Boye et al. 2000; Messer 2002). The T. maritima and B. subtilis genomes do not encode SeqA or Dam homologs (Nelson et al. 1999), like the majority of eubacterial species (Hiraga et al. 2000). The tmaDnaA box sequence is absent in the dnaA-homolog gene of the T. maritima genome. Thus, unlike the case of E. coli and B. subtilis (Messer 2002), it does not appear that the dnaA-homolog gene in T. maritima is subject to transcriptional autoregulation. These observations are consistent with the idea that the DnaA-adenine nucleotide switch plays a significant role in the control for the replication cycle of this evolutionarily most ancient bacterium.
The E. coli DnaA box is widely conserved among DnaA boxes in eubacterial species (Yoshikawa & Ogasawara 1991; Jakimowicz et al. 1998; Messer 2002). The 3'-terminal sequence (TACCAC) of the tmaDnaA box may be similar to the same region (TNCAC) of the E. coli DnaA box although it is less similar to the equivalent regions of the other binding sequences (Fig. 9C). However, we suggest that the sequence of the 12-mer tmaDnaA box shares similarity with the S. cerevisiae ORC-binding core site ACS (the autonomously replicating sequence consensus sequence) (Giraldo 2003) (Fig. 9C). The 5'-terminal 7-mer (AAACCTA) of the tmaDnaA box is similar to the 5'-terminus (AAACATA) of ACS. Of 11 residues of the ACS, 7 are identical to the archaeal Orc1/Cdc6-binding consensus (Fig. 9C). The archaeal sequence has been suggested to be widely conserved among the binding motifs in archaeal species (Capaldi & Berger 2004; Robinson et al. 2004). These features are consistent with the idea that the binding proteins evolutionarily differentiated from the common ancestor.
| Experimental procedures |
|---|
|
|
|---|
To construct the tmaDnaA-overproducing plasmid, tmaDnaA protein coding-region (1.3 kb) was amplified from the T. maritima genome by PCR using the primers 5'-CGCTCTAGAAGGAGATATACATATGAAAGAGAGAATACTCCAGG and 5'-CCCAAGCTTAACCGCTCAGGGCTCTCC. The first primer contains the Shine-Dalgarno sequence from T7 phage gp10. The PCR product was ligated to the pBAD18 vector (Guzman et al. 1995), resulting in pTHMA-1.
To construct the tma-oriC containing plasmid, tma-oriC region (591 bp) was amplified from the T. maritima genome by PCR using the primers 5'-CGCGGATCCCCTCTTTTCAGGATCAATTATACTGC and 5'-CCGGAATTCGCCATAGTTCCTCTCTCAAGCTC, then ligated to the BamHI/EcoRI sites of pBluescript II vector (Stratagene), resulting in pOZ1 (3.5 kb). pOZ3, pOZ5 and pOZ6 were pOZ1-derivatives deleting the EcoRI-MfeI, EcoRI-SspI EcoRI-BciVI fragments, respectively. pOZ8, pOZ9 and pOZ10 were obtained from pOZ1 by PCR using a set of a forward primer (5'-GGAACTATGGCGAATTCGATATCAAGC) and a reverse primer (5'-CCGGAATTCAAACCTACCACTTACCTACCACTTACCTACCACCCGGGTGGTAAGTTGCAGAC, 5'-CCGGAATTCTTACCTACCACTTACCTACCACCCGGGTGGTAAGTTGCAGAC or 5'-CCGGAATTCTTACCTACCACCCGGGTGGTAAGTTGCAGAC, respectively). pOZ14 and pOZ15 were obtained from pOZ8 by PCR using a set of a forward primer (5'-TCCTGAAAAGAGGGGATCCAC) and a reverse primer (5'- CTGCTATTATTAGTAGTAG or 5'- TAGTAGTAAATAATAGGGGACGC, respectively).
pOZ2, which was used to generate the fragments bearing a 12-mer tmaDnaA box in various places, was constructed by inserting a 24-bp synthetic DNA that bears a 12-mer tmaDnaA box (5'- TACAGAAAACCTACCACCTAAAAT) into the SalI/XbaI sites of pBend2 (Kim et al. 1989).
Purification of tmaDnaA protein
TmaDnaA was purified by a similar method used to purify E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kubota et al. 1997). E. coli BL21 (DE3) cells bearing pTHMA-1 were grown at 37 °C in 7.2 L of LB medium containing 50 µg/mL ampicillin until the optical density (A595) reached 0.4. Thereafter, the cells were incubated for 2 h in the presence of 1% arabinose, harvested by centrifugation, resuspended to an optical density (A595) of 200 in cold buffer A [50 mM HEPES-KOH (pH 7.6), 1 mM EDTA and 2 mM dithiothreitol], frozen in liquid nitrogen and stored at 80 °C. The thawed suspension was diluted two-fold in buffer A containing 250 mM KCl, 20 mM spermidine-HCl, 2 mM dithiothreitol, 5 mM EDTA, and 0.3 mg/mL lysozyme, kept for 30 min on ice, and frozen in liquid nitrogen. After thawing at 04 °C, cleared lysates were obtained by centrifugation at 49 000 r.p.m. for 40 min in a Beckman Ti 502 rotor, resulting in fraction I (16 mg/mL of protein, 120 mL). Fraction I was incubated for 30 min at 60 °C and soluble proteins were obtained by centrifugation at 18 000 r.p.m. for 20 min in a Beckman JA-20. The following procedures were performed at cold temperatures. The supernatant (fraction II; 3.9 mg/mL of protein, 100 mL) was diluted in buffer A containing 10% glycerol to a conductivity equivalent to buffer A containing 200 mM KCl. One-eighth volume of the resulting solution (23 mL) was loaded on to a 5 mL heparin-agarose column (Amersham Biosciences) equilibrated with buffer A containing 200 mM KCl and 10% glycerol at a flow rate of 0.5 mL/min. The column was washed with 3 column volumes of the same buffer. Proteins eluted with a linear gradient of 200500 mM KCl formed a single sharp peak around 300 mM KCl. The steps using the heparin-agarose column were repeated and the peak fractions were collected (fraction III; 0.6 mg/mL of protein, 100 mL). Fraction III was dialyzed for 12 h against buffer A and the precipitates formed during dialysis were collected by centrifugation at 18 000 r.p.m. for 20 min in a Beckman JA-20 rotor. One-eighth volume of these precipitates was resuspended in buffer A containing 4 M guanidine-HCl by brief sonication. The supernatant (fraction IV; 4.4 mg/mL of protein, 100 µL) was then obtained by centrifugation at 14 000 r.p.m. for 10 min in a Himac T15AP21 rotor and gel-filtered on a Superose 12 HR10/30 column equilibrated with buffer A containing 500 mM KCl and 10% glycerol at a flow rate of 0.2 mL/min. The peak fractions were pooled (fraction V; 0.2 mg/mL of protein, 1.8 mL).
Nucleotide binding and ATP hydrolysis assays
Assays analyzing the nucleotide-binding activities of tmaDnaA and tmaDnaA-intrinsic ATPase were performed essentially as previously described for E. coli DnaA (Sekimizu et al. 1987; Katayama 1994; Kawakami et al. 2005). Briefly, tmaDnaA (1.9 pmol) was incubated for 5 min at 38 °C in buffer containing 50 mM HEPES-KOH (pH 7.6), 0.3 mM EDTA, 7 mM dithiothreitol, 20% glycerol, 0.007% Triton X-100, and [
-32P] ATP or [3H] ADP and further incubated for 15 min at 0 °C in the presence of 2.5 mM magnesium acetate. Samples were filtered through nitrocellulose membranes and the radioactivity that was retained was quantified by using a liquid scintillation counter. In the competition assay, tmaDnaA (1.3 pmol) was incubated as described above but in the presence of 1 µM[
-32P] ATP and 50 µM competitor nucleotide. For the tmaDnaA-intrinsic ATPase assay, [
-32P]ATP-tmaDnaA (1 pmol) was incubated at 48 °C in the same buffer described above in the presence of 2.5 mM magnesium acetate and pOZ1 DNA (100 ng), followed by its retention on membranes and analysis by thin layer chromatography and the use of the BAS2500 (Fuji Film) image analyzer.
Gel-mobility retardation assay
This assay was performed essentially as previously described (Schaper & Messer 1995; Kawakami et al. 2005). Briefly, tmaDnaA was incubated for 20 min at 40 °C in buffer (20 µL) containing 20 mM HEPES-KOH (pH 7.6), 1 mM EDTA, 2 mM dithiothreitol, 5 mM magnesium acetate, 200 mM KCl, 10% glycerol, 0.2% Triton X-100, 1 mM ATP and 18-bp DNA (3 pmol). When 24-bp DNA (2 pmol) was used, tmaDnaA was incubated in the same buffer (10 µL) described above except for the presence of 1 mM ATP or ADP. In the DNA-bending assay, tmaDnaA was incubated in the same buffer described above (10 µL). DNA was stained with Gel-Star (Cambrex).
Open complex formation assay using P1 nuclease and primer extension analysis
This assay was performed essentially as previously described (Sekimizu et al. 1987; Nishida et al. 2002; Kawakami et al. 2005). ATP/ADP-tmaDnaA was obtained by incubation in buffer containing 3 µM ATP/ADP under the same conditions described for the nucleotide-binding assay. Buffer (50 µL) for unwinding reaction contained 60 mM HEPES-KOH (pH 7.6), 8 mM magnesium acetate, 30% (v/v) glycerol, 0.32 mg/mL bovine serum albumin, 16 ng HU protein, 5 mM ATP, and a supercoiled form of plasmid (400 ng), unless noted. This buffer was incubated for 1 min at 48 °C, followed by incubation for 10 min at the same temperature in the presence of the ATP or ADP-form of tmaDnaA as indicated. After P1 nuclease digestion (25 units, Yamasa Co.) for 120 s at the same temperature, the DNA was purified and one-tenth volume of the reaction was subjected to digestion with AlwNI. Primer extension analysis was performed as previously described (Hwang & Kornberg 1990). A 32P-end labeled primer (5'-CCGGAATTCGCCATAGTTCCTCTCTCAAGCTC) and the DNA polymerase I Large Fragment were used.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: katayama{at}phar.kyushu-u.ac.jp
| References |
|---|
|
|
|---|
Bocchetta, M., Gribaldo, S., Sanangelantoni, A. & Cammarano, P. (2000) Phylogenetic depth of the bacterial genera Aquifex and Thermotoga inferred from analysis of ribosomal protein, elongation factor, and RNA polymerase subunit sequences. J. Mol. Evol. 50, 366380.[Medline]
Boye, E., Løbner-Olesen, A. & Skarstad, K. (2000) Limiting DNA replication to once and only once. EMBO Rep. 1, 479483.[Medline]
Bramhill, D. & Kornberg, A. (1988) A model for initiation at origins of DNA replication. Cell 54, 915918.[CrossRef][Medline]
Capaldi, S.A. & Berger, J.M. (2004) Biochemical characterization of Cdc6/Orc1 binding to the replication origin of the euryarchaeon Methanothermobacter thermoautotrophicus. Nucleic
Acids Res.
32, 48214832.
Dai, J., Chuang, R.-Y. & Kelly, T.J. (2005) DNA replication origin in the Schizosaccharomyces pombe genome. Proc. Natl. Acad. Sci. USA
102, 337342.
Drlica, K. & Rouviere-Yaniv, J. (1987) Histonelike proteins of bacteria. Microbiol. Rev.
51, 301319.
Egan, E.S. & Waldor, M.K. (2003) Distinct replication requirements for the two Vibrio cholerae chromosomes. Cell 114, 521530.[CrossRef][Medline]
Fujikawa, N., Kurumizaka, H., Nureki, O., et al. (2003) Structural basis of replication origin recognition by the DnaA protein. Nucleic Acids Res.
31, 20772086.
Giraldo, R. (2003) Common domains in the initiators of DNA replication in Bacteria, Archaea and Eukarya: combined structural, functional and phylogenetic perspectives. FEMS Microbiol. Rev. 26, 533554.[CrossRef][Medline]
Grigoriev, A. (1998) Analyzing genomes with cumulative skew diagrams. Nucleic
Acids Res.
26, 22862290.
Guzman, L.M., Belin, D., Carson, M.J. & Beckwith, J. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol.
177, 41214130.
Hiraga, S., Ichinose, C., Onogi, T., Niki, H. & Yamazoe, M. (2000) Bidirectional migration of SeqA-bound hemimethylated DNA clusters and pairing of oriC copies in Escherichia coli. Genes Cells 5, 327341.[Abstract]
Hwang, D.S. & Kornberg, A. (1990) A novel protein binds a key origin sequence to block replication of an E. coli minichromosome. Cell 63, 325331.[CrossRef][Medline]
Hwang, D.S. & Kornberg, A. (1992a) Opening of the replication origin of Escherichia coli by DnaA protein with protein HU or IHF. J. Biol. Chem.
267, 2308323086.
Hwang, D.S. & Kornberg, A. (1992b) Opposed actions of regulatory proteins, DnaA and IciA, in opening the replication origin of Escherichia coli. J. Biol. Chem.
267, 2308723091.
Ishida, T., Akimitsu, N., Kashioka, T., et al. (2004) DiaA, a novel DnaA-binding protein, ensures the initiation timing of Escherichia coli chromosome replication. J. Biol. Chem.
279, 4554645555.
Iyer, L.M., Leipe, D.D., Koonin, E.V. & Aravind, L. (2004) Evolutionary history and higher order classification of AAA+ ATPases. J. Struct. Biol. 146, 1131.[CrossRef][Medline]
Jakimowicz, D., Majka, J., Messer, W., et al. (1998) Structural elements of the Streptomyces oriC region and their interactions with the DnaA protein. Microbiology
144, 12811290.
Katayama, T. (1994) The mutant DnaAcos protein which overinitiates replication of the Escherichia coli chromosome is inert to negative regulation for initiation. J. Biol. Chem.
269, 2207522079.
Katayama, T., Kubota, T., Kurokawa, K., Crooke, E. & Sekimizu, K. (1998) The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase. Cell 94, 6171.[CrossRef][Medline]
Kato, J. & Katayama, T. (2001) Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli. EMBO J. 20, 42534262.[CrossRef][Medline]
Kawakami, H., Keyamura, K. & Katayama, T. (2005) Formation of an ATP-DnaA-specific initiation complex requires DnaA arginine-285, a conserved motif in the AAA+ protein family. J. Biol. Chem.
280, 2742027430.
Kim, J., Zwieb, C., Wu, C. & Adhya, S. (1989) Bending of DNA by gene-regulatory proteins: construction and use of a DNA bending vector. Gene 85, 1523.[CrossRef][Medline]
Klemm, R.D., Austin, R.J. & Bell, S.P. (1997) Coordinate binding of ATP and origin DNA regulates the ATPase activity of the origin recognition complex. Cell 88, 493502.[CrossRef][Medline]
Krause, M., Ruckert, B., Lurz, R. & Messer, W. (1997) Complexes at the replication origin of Bacillus subtilis with the homologous and heterologous DnaA protein. J. Mol. Biol. 274, 365380.[CrossRef][Medline]
Kubota, T., Katayama, T., Ito, Y., Mizushima, T. & Sekimizu, K. (1997) Conformational transition of DnaA protein by ATP: structural analysis of DnaA protein, the initiator of Escherichia coli chromosome replication. Biochem. Biophys. Res. Commun. 232, 130135.[CrossRef][Medline]
Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K. & Katayama, T. (1999) Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli. EMBO J. 18, 66426652.[CrossRef][Medline]
Leonard, A.C. & Grimwade, J.E. (2005) Building a bacterial orisome: emergence of new regulatory features for replication origin unwinding. Mol. Microbiol. 55, 978985.[CrossRef][Medline]
Lopez, P., Forterre, P., Guyader, H. & Philippe, H. (2000) Origin of replication of Thermotoga maritima. Trends Genet. 16, 5960.[CrossRef][Medline]
Lopez, P., Philippe, H., Myllykallio, H. & Forterre, P. (1999) Identification of putative chromosomal origins of replication in archaea. Mol. Microbiol. 32, 883886 .[CrossRef][Medline]
Mackiewicz, P., Zakrzewska-Czerwinska, J., Zawilak, A., Dudek, M.R. & Cebrat, S. (2004) Where does bacterial replication start? Rules for predicting the oriC region. Nucleic
Acids Res.
32, 37813791.
Margulies, C. & Kaguni, J.M. (1996) Ordered and sequential binding of DnaA protein to oriC, the chromosomal origin of Escherichia coli. J. Biol. Chem.
271, 1703517040.
McGarry, K.C., Ryan, V.T., Grimwade, J.E. & Leonard, A.C. (2004) Two discriminatory binding sites in the Escherichia coli replication origin are required for DNA strand opening by initiator DnaA-ATP. Proc. Natl. Acad. Sci. USA
101, 28112816.
Messer, W. (2002) The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev. 26, 355374.[Medline]
Mrazek, J. & Karlin, S. (1998) Strand compositional asymmetry in bacterial and large viral genomes. Proc. Natl. Acad. Sci. USA
95, 37203725.
Myllykallio, H., Lopez, P., Lopez-Garcia, P., et al. (2000) Bacterial mode of replication with eukaryotic-like machinery in a hyperthermophilic archaeon. Science
288, 22122215.
Nelson, K.E., Clayton, R.A., Gill, S.R., et al. (1999) Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature 399, 323329.[CrossRef][Medline]
Neuwald, A.F., Aravid, L., Spouge, J.L. & Koonin, E.V. (1999) AAA+: a class of chaperon-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res.
9, 2743.
Nishida, S., Fujimitsu, K., Sekimizu, K., Ohmura, T., Ueda, T. & Katayama, T. (2002) A nucleotide switch in the Escherichia coli DnaA protein initiates chromosomal replication: evidence from a mutant DnaA protein defective in regulatory ATP hydrolysis in vitro and in vivo. J. Biol. Chem.
277, 1498614995.
Okuno, Y., Satoh, H., Sekiguchi, M. & Masukata, H. (1999) Clustered adenine/thymine stretches are essential for function of a fission yeast replication origin. Mol. Cell. Biol.
19, 66996709.
Robinson, N.P., Dionne, I., Lundgren, M., Marsh, V.L., Bernander, R. & Bell, S.D. (2004) Identification of two origins of replication in the single chromosome of the archaeon Sulfolobus solfataricus. Cell 116, 2538.[CrossRef][Medline]
Schaper, S. & Messer, W. (1995) Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem.
270, 1762217626.
Sekimizu, K., Bramhill, D. & Kornberg, A. (1987) ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome. Cell 50, 259265.[CrossRef][Medline]
Speck, C. & Messer, W. (2001) Mechanism of origin unwinding: sequential binding of DnaA to double- and single-stranded DNA. EMBO J. 20, 14691476.[CrossRef][Medline]
Stillman, B. (2005) Origin recognition and the chromosome cycle. FEBS Lett. 579, 877884.[CrossRef][Medline]
Suetsugu, M., Shimuta, T., Ishida, T., Kawakami, H. & Katayama, T. (2005) Protein associations in DnaA-ATP hydrolysis mediated by the Hda-replicase clamp complex. J. Biol. Chem.
280, 65286536.
Woese, C.R. (1987) Bacterial evolution. Microbiol. Rev.
51, 221271.
Yoshikawa, H. & Ogasawara, N. (1991) Structure and function of DnaA and the DnaA-box in eubacteria: evolutionary relationships of bacterial replication origins. Mol. Microbiol. 5, 25892597.[CrossRef][Medline]
You, Z., Ishimi, Y., Mizuno, T., Sugasawa, K., Hanaoka, F. & Masai, H. (2003) Thymine-rich single-stranded DNA activates Mcm4/6/7 helicase on Y-fork and bubble-like substrates. EMBO J. 22, 61486160.[CrossRef][Medline]
Yung, B.Y.-M. & Kornberg, A. (1989) The dnaA initiator protein binds separate domains in the replication origin of Escherichia coli. J. Biol. Chem.
264, 61466150.
Received: 24 November 2005
Accepted: 9 January 2006
This article has been cited by other articles:
![]() |
S. Ozaki, H. Kawakami, K. Nakamura, N. Fujikawa, W. Kagawa, S.-Y. Park, S. Yokoyama, H. Kurumizaka, and T. Katayama A Common Mechanism for the ATP-DnaA-dependent Formation of Open Complexes at the Replication Origin J. Biol. Chem., March 28, 2008; 283(13): 8351 - 8362. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Keyamura, N. Fujikawa, T. Ishida, S. Ozaki, M. Su'etsugu, K. Fujimitsu, W. Kagawa, S. Yokoyama, H. Kurumizaka, and T. Katayama The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP DnaA-specific initiation complexes Genes & Dev., August 15, 2007; 21(16): 2083 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Pei, J. Liu, J. Li, A. Guo, J. Zhou, and H. Xiang Mechanism for the TtDnaA-Tt-oriC cooperative interaction at high temperature and duplex opening at an unusual AT-rich region in Thermoanaerobacter tengcongensis Nucleic Acids Res., May 14, 2007; 35(9): 3087 - 3099. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |