| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Biological Science, Nagoya University Graduate School of Science, Furocho, Chikusa-ku, Nagoya 464-8602, Japan
2 KAN Research Institute, Science Center Building #3, Kyoto-Research Park, 93 Chudoji-Awatacho, Shimogyo-ku, Kyoto 600-8815, Japan
3 Group for Evolutionary Regeneration Biology, RIKEN Center for Developmental Biology, 2-2-3 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan
4 Department of Bioengineering and Bioinformatics, Hokkaido University Graduate School of Information Science and Technology, Kita 14, Nishi 9, Kita-ku, Sapporo 060-0814, Japan
5 Department of Biophysics, Kyoto University Graduate School of Science, Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
The freshwater flatworm planarian (Platyhelminthes) is an attractive system for studying the formation and maintenance of the neural network. Planarian has two interesting characters that make it an appropriate model for studying the CNS. The first is its high regenerative capability. Planarian can regenerate a complete CNS within 1 week after amputation, and day 5 regenerants already possess a functional brain as evaluated by behavioral assays (Inoue et al. 2004). The second is its ability to grow and de-grow in response to food availability. Specifically, planarian can change its body length from 1 to 20 mm, while maintaining the function of each tissue and the proportions of the body including the brain, and this process is dependent on the balance between cell proliferation and death (Romero & Baguò 1991; reviewed in Newmark & Sanchez Alvarado 2002). These characters raise the questions of how planarian can regenerate a complete CNS from even just a tiny fragment in such a short time period, and how it can maintain its neural circuit during growth and shrinkage.
Planarian is considered to be one of the most primitive animals that have a CNS. The planarian CNS is composed of a cephalic ganglion and a pair of ventral nerve cords (VNCs). The cephalic ganglion forms an inverted U-shaped structure with nine branches connected to the sensory organs on each side (Agata et al. 1998; Tazaki et al. 1999). Despite its relatively simple CNS, a high level of regionalization in the brain, well organized neural network and high degree of evolutionary conservation between planarian and vertebrate neural genes have been identified (Cebriáet al. 2002a,b; Mineta et al. 2003; Nakazawa et al. 2003; Cebriá & Newmark 2005; Okamoto et al. 2005). Recently, planarian homologs of netrin and netrin receptors have been reported to be required for proper regeneration as well as maintenance of the CNS (Cebriá & Newmark 2005). In addition to secreted molecules and their receptors, cell adhesion molecules are also known to have crucial functions in the formation and maintenance of the CNS in higher organisms. To further understand the formation and maintenance of the planarian CNS, we focused on investigating the functional roles of neural cell adhesion molecules of the immunoglobulin superfamily (IgCAMs).
IgCAMs are widely expressed in the nervous system, and have been implicated in diverse steps of brain development, including neuronal migration, axon outgrowth, guidance and fasciculation and synapse formation, as well as in the maintenance and function of the neural network in adults. IgCAMs share a similar structural organization. They all contain Ig domains, and with the exception of a few molecules, fibronectin type III (FNIII) repeats in their extracellular domains that provide platforms for adhesion in both homophilic and heterophilic manners. According to the number and arrangement of their protein domains, IgCAMs can be assigned to several different subgroups, such as NCAM, L1 family (which includes L1/NgCAM, neurofascin, NrCAM and CHL1), DSCAM, contactin/TAG-1 family (which includes contactin/F3/F11, TAG-1, BIG-1, BIG-2, NB-2 and NB3), P0, IgLON family (LAMP, OBCAM, neurotrimin/CEPU-1 and neurotractin/kilon), MAG and telencephalin (reviewed in Brummendorf & Rathjen 1996; Walsh & Doherty 1997; Crossin & Krushel 2000; Rougon & Hobert 2003). Although their numbers are limited, invertebrate IgCAMs have been identified in arthropods, molluscs, annelids and nematodes, and shown to be required for the formation and maintenance of their nervous systems (Bastiani et al. 1987; Bieber et al. 1989; Mayford et al. 1992; Huang et al. 1997; Schmucker et al. 2000; Chen et al. 2001; Faivre-Sarrailh et al. 2004).
In the present study, we identified orthologs of vertebrate neural cell adhesion molecule (NCAM), Down Syndrome cell adhesion molecule (DSCAM), L1CAM and contactin in the planarian Dugesia japonica, and designated them DjCAM, DjDSCAM, DjLCAM and DjCTCAM, respectively. We found that DjCAM and DjDSCAM were differentially expressed in the CNS during and after regeneration. Loss of DjCAM expression through RNA interference (RNAi) resulted in a subtle abnormality in axon fasciculation. In contrast to the case for DjCAM, DjDSCAM RNAi-treated animals showed severely affected axon outgrowth in the central region and remarkable decreases and defects in cell migration, axon growth, fasciculation and projection of lateral branches in the brain. Our results led us to propose that DjDSCAM, a planarian ortholog of DSCAM, is essential for various steps of CNS formation via homophilic adhesion.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
To investigate whether neural IgCAMs exist in planarian, we searched planarian ESTs (Mineta et al. 2003) and found four clones that are homologous to vertebrate neural IgCAMs. Since these EST clones only contained partial sequences, the 5' extremities of their open reading frames (ORFs) were isolated by nested PCR, and their full-length sequences were determined. The four genes were homologous to vertebrate NCAM, DSCAM, L1CAM and contactin. NCAM is widely expressed in the vertebrate nervous system, and has been implicated in a variety of processes including cell migration, axonal elongation, fasciculation, pathfinding and synaptic plasticity (Cunningham et al. 1987; reviewed in Walsh & Doherty 1997; Crossin & Krushel 2000). DSCAM was identified though a positional cloning strategy for common Down Syndrome (DS) phenotypes (Yamakawa et al. 1998). DSCAM is highly expressed during brain development (Agarwala et al. 2001; Yimlamai et al. 2005). L1 is predominantly expressed in the developing nervous system, and plays various roles in both the CNS and peripheral nervous system (PNS), similar to NCAM (reviewed in Kamiguchi et al. 1998; Walsh & Doherty 1997). Contactin exhibits cell type-specific expression, and plays a role in axonal elongation and guidance (Virgintino et al. 1999; reviewed in Falk et al. 2002). The planarian orthologs of vertebrate NCAM, DSCAM, L1CAM and contactin were designated Dugesia japonica cell adhesion molecule (DjCAM), Dugesia japonica down syndrome cell adhesion molecule (DjDSCAM), Dugesia japonica L1-like cell adhesion molecule (DjLCAM) and Dugesia japonica contactin/TAG-1 cell adhesion molecule (DjCTCAM), respectively. The domain structures and full length amino acid sequences of the planarian IgCAMs are shown in Fig. 1A and Fig. S1, respectively. The nucleotide sequences of DjCAM, DjDSCAM, DjLCAM and DjCTCAM cDNAs have been deposited in the DDBJ/EMBL/GenBank Nucleotide Databases under accession numbers AB249987, AB249988, AB249990 and AB249989, respectively.
|
Since fruit fly DSCAM, but not vertebrate DSCAM, has been reported to generate as many as 38 016 isoforms that share the same domain structure (Schmucker et al. 2000), we examined whether multiple spliced isoforms are generated from the DjDSCAM gene. Since fruit fly DSCAM encodes 12 alternative exons for the N-terminal half of Ig2, 48 alternative exons for the N-terminal half of Ig3 and 33 alternative exons for Ig7, we amplified the region between Ig2 and Ig8 of DjDSCAM by RT-PCR. We sequenced ten independent clones derived from intact planarian mRNA and ten from regenerating planarian (day 3) mRNA, leading to a total of 20 independent clones. Although 49 of 50 Drosophila DSCAM cDNAs have been reported to contain unique combinations of alternative exons, we could not find any splicing variants among our 20 DjDSCAM cDNAs (data not shown).
To further clarify whether DjCAM, DjDSCAM, DjLCAM and DjCTCAM belong to the NCAM, DSCAM, L1 and contactin/TAG-1 families, respectively, we constructed phylogenetic trees for these molecules (Fig. 1B–E). Since no neural IgCAMs have been identified in any animals that are more primitive than planarian, we selected vertebrate DSCAM as an outgroup for building the phylogenetic tree of the NCAM family and vertebrate NCAM as an outgroup for constructing the phylogenetic tree of the other families. The phylogenetic trees revealed that DjCAM, DjDSCAM, DjLCAM and DjCTCAM are early descendants of the NCAM, DSCAM, L1 and contactin/TAG-1 families, respectively.
Planarian homologs of IgCAM function as cell adhesion molecules
To confirm whether planarian IgCAMs function as cell adhesion molecules and understand their signaling mechanisms, we expressed the IgCAM proteins in BmN4 cells, which are derived from silkworm Bombyx mori larvae, using a silkworm baculovirus expression system (Maeda et al. 1985). This system is a powerful tool for investigating the transcellular interactions of cell adhesion molecules (Sasakura et al. 2005). We prepared BmN4 cells expressing DjCAM, DjDSCAM, DjLCAM or DjCTCAM, as well as BmN4 cells infected with the parental virus as a control. Immunostaining analyses confirmed that the IgCAM proteins were expressed on the cell surface of BmN4 cells (Fig. 2A). The IgCAM-expressing cells were incubated on a gyratory shaker for 1 h, and the cell aggregates formed were quantified. The extent of aggregation was represented by the ratio of the total particle number at time t (60 min) of the incubation (Nt) to the initial particle number (N0). The DjCAM-expressing cells formed aggregates (Nt/N0 = 0.58), whereas the control cells did not, indicating that DjCAM shows homophilic binding activities (Fig. 2B). Since DjCAM is linked to the cell membrane by a GPI anchor, the DjCAM-expressing cells did not form aggregates in the presence of PI-PLC (Nt/N0 = 0.91). An anti-DjCAM antibody also inhibited the formation of aggregates (Nt/N0 = 0.79). Similar examination of the homophilic adhesion activities of the other planarian IgCAMs revealed that the DjDSCAM-, DjLCAM- and DjCTCAM-expressing cells all formed cell aggregates during the incubation. Taken together, these results indicate that all four planarian IgCAMs are able to act as homophilic adhesion molecules (Fig. 2C).
|
Expression of the DjCAM, DjDSCAM, DjLCAM and DjCTCAM genes in intact planarian
To investigate the expression patterns of the DjCAM, DjDSCAM, DjLCAM and DjCTCAM genes in intact planarian, we performed whole-mount in situ hybridization (Fig. 3), and found that these primitive IgCAMs showed different expression patterns in the nervous system. The DjCAM gene was expressed in the brain and a pair of VNCs (arrowheads in Fig. 3C) located just ventral to the brain (Fig. 3A–D). It was strongly expressed in entire areas of the brain that can be divided into a central spongy region (brackets in Fig. 3C) and nine lateral branches (arrows in Fig. 3C) for each side. In addition, the DjCAM signal was detected in the marginal region of the head in which the sensory organs are located (arrowheads in Fig. 3B). No DjCAM expression was detected in the eyes. DjDSCAM transcripts were found in the brain, but not in the VNCs (arrowheads in Fig. 3G), head margins or eyes (Fig. 3E–H). Compared to DjCAM, DjDSCAM expression was restricted to the central region of the brain (brackets in Fig. 3G). DjDSCAM was expressed in the central spongy region and the proximal part of the lateral branches in the brain. Unexpectedly, DjLCAM and DjCTCAM signals were detected in the marginal region of the head (arrowheads in Fig. 3J,M), but not in the CNS (Fig. 3I–N). Besides the nervous system, strong DjLCAM and DjCTCAM expressions were detected in the intestinal ducts that spread over the whole body (Fig. 3I,L).
|
Expression of the DjCAM and DjDSCAM genes during brain regeneration
We next investigated the expression patterns of the DjCAM and DjDSCAM genes in regenerating head regions by performing whole-mount in situ hybridization of amputated planarians (Fig. 4).
|
Similar to the case for DjCAM, DjDSCAM expression within the new brain was first detected at day 2 of regeneration. In comparison with DjCAM, DjDSCAM was strongly and widely expressed in the brain primordium at the early stages of regeneration. It is known that the central and lateral domains of the new brain, corresponding to the primordium of the central spongy region and lateral branches, respectively, can be segregated by the expression pattern of neural markers from day 2 of regeneration (Cebriáet al. 2002b). At day 2, DjDSCAM was expressed in both the central and lateral portions, whereas DjCAM was only expressed in the central portion. However, the expression of DjDSCAM decreased in the central portion, and disappeared in the lateral portion at the late stages of regeneration.
We next investigated whether DjLCAM and DjCTCAM are expressed in the regenerating brain. However, expression of these genes was not detected in the regenerating brain, similar to the case for the intact brain (data not shown).
DjCAM knockdown planarians exhibit partially impaired axon fasciculation in the lateral branches
Based on the observed expression patterns, we speculated that DjCAM and DjDSCAM are involved in CNS formation. Therefore, we next investigated their functions in vivo by generating gene knockdown planarians.
First, we created DjCAM knockdown planarians by RNAi, and assessed whether DjCAM is required for formation of the nervous system. After injection of DjCAM double-stranded RNA (dsRNA), planarians were amputated to generate headless fragments. Next, planarians with newly formed head regions, which were regenerated in the absence of DjCAM gene expression, were analyzed. We confirmed the reduction of DjCAM expression in the RNAi-treated animals by immunostaining with our anti-DjCAM antibody (Fig. 5A,B). DjCAM protein was scarcely expressed in the newly generated brain, and significantly reduced in the VNCs of the original trunk region. We then examined the morphology of the brain with a panneuronal marker, anti-prohormone convertase 2 (PC2) antibody, which labels axons (Fig. 5C,D). Unexpectedly, DjCAM-RNAi animals did not display any overt gross morphological abnormalities. However, abnormalities of axonal fasciculation in the lateral branches were revealed from more detailed observations using a lateral branch marker, anti-G protein beta antibody (Fig. 5E–H). Some neurons constituting lateral branches failed to generate axon fascicles in the absence of DjCAM expression (arrows in Fig. 5F,H).
|
Next, we generated DjDSCAM knockdown planarians using the above-described method. Since we did not have an anti-DjDSCAM antibody available for immunostaining, we checked the reduction in DjDSCAM expression in the RNAi animals by Western blotting (Fig. 6A). DjDSCAM protein was not detected in the RNAi-treated animals. Next, we observed the neural network formation in the DjDSCAM knockdown animals by immunostaining with neural markers. The planarian brain is composed of neuronal cell bodies located in the outer layer and bundles of nerve fibers located in the inner region. Immunostaining with an anti-PC2 antibody detected dense bundles in the central spongy region of control animals (Fig. 6B,D). In contrast, PC2 protein was mainly observed in the outer layers composed of neuronal cell bodies in the knockdown animals, and the density of axon bundles was significantly lower in the central spongy region (Fig. 6C,E). These observations indicate that axons constituting the central spongy region cannot elongate in the absence of DjDSCAM expression. Moreover, severe abnormalities were recognized in the lateral branches (Fig. 6F–M). Although intact planarians usually have nine pairs of lateral branches, and 9-day regenerants have eight or nine pairs, the number of lateral branches in DjDSCAM-RNAi animals was markedly decreased (Fig. 6F,G). We considered that one possible reason for the deletion of several lateral branches may be failure of the neuronal cells to migrate to their correct place. To test this hypothesis, we checked the location of the neuronal cell bodies by staining with the DNA-binding dye Hoechst 33342 (Fig. 6H,I). Each branch is normally composed of two cell body layers and one axon bundle, which extends between the two cell body layers. In DjDSCAM-RNAi animals, not only the number of axon bundles but also the number of cell body clusters, which constitute lateral branches, were decreased. Compared to control animals, accumulated neuronal cell bodies in a single lateral branch, rather than a decrease in the cell number, were observed in DjDSCAM-RNAi animals. These results support the hypothesis that a defect in neuronal cell migration is the critical cause of the reduction in lateral branches. In addition to the decreased number, axon growth (lateral branches 2 and 3 in Fig. 6G), fasciculation (arrowheads in Fig. 6G) and projection of lateral branches were also severely disrupted in the absence of DjDSCAM expression. Lateral branches did not extend radially, and several crossing branches were observed in knockdown animals (arrows in Fig. 6G). Schematic drawings of brain morphology in control animal and DjDSCAM-RNAi animal are shown in Fig. 6L,M.
|
Since planarians display negative phototactic behavior, they move away from a light source and reach the dark side when one side of a container is exposed to light (Inoue et al. 2004; Fig. 7C). Utilizing this responsiveness to light, a phototaxis assay system has been established for planarian. Since we noticed that DjDSCAM-RNAi animals show decreased locomotive activity, we applied this technique to examine whether DjDSCAM-RNAi animals still show decreased locomotion even when compelled to move by light stimulation.
|
Next, we analyzed their phototactic behavior. While all the control animals moved away from the light source and reached the dark side during a 90-second assay, DjDSCAM-RNAi animals hardly moved from the start area, and could not escape from the light source (Fig. 7D,E). However, the traced trajectories of the planarian movements demonstrated that the DjDSCAM-RNAi animals were also trying to move away from the light source. To quantify the locomotive activities, we calculated the mean velocities and total distances moved during the 90 s assay (Fig. 7F,G). Both the velocity and the total distance were significantly reduced in the DjDSCAM-RNAi animals.
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
DjCAM is partly involved in axon fasciculation of lateral branches
Our in situ hybridization and immunohistochemistry analyses demonstrated that DjCAM is widely and strongly expressed throughout the nervous system. Based on this expression pattern, we speculated that DjCAM plays roles in many processes involved in the formation and maintenance of the nervous system. However, the CNS of DjCAM knockdown planarian appeared fairly normal at the gross level.
A more detailed analysis revealed that DjCAM knockdown planarians exhibited mild defects in lateral branches. In normal planarian, there are nine pairs of lateral branches composed of chemosensory neurons, and the individual lateral branches form axon bundles that extend toward the head margins laterally and toward the brain main lobe medially (Okamoto et al. 2005). DjCAM knockdown animals showed impaired axon fasciculation in a fraction of the lateral branches. Similar to Drosophila fasciclin II, whose loss-of-function mutations lead to defasciculation of CNS axons (Lin et al. 1994), planarian DjCAM also appeared to be required for axon fasciculation. Although DjCAM showed heterophilic binding activity with DjCTCAM, DjCTCAM was not expressed in the CNS. These results suggest that DjCAM is partially involved in axon fasciculation of lateral branches, probably via homophilic adhesion. We consider that lateral branch axons cannot interact sufficiently with the surrounding axons in the absence of DjCAM expression, thereby leading to a decline in fasciculation.
DjDSCAM plays crucial roles in several processes involved in neural network formation
We found that DjDSCAM was strongly expressed in both the central and lateral portions of the brain at the early stages of regeneration, and that its level of expression decreased at later stages, indicating that DjDSCAM is predominantly involved in the formation of the nervous system. As predicted from its expression patterns, DjDSCAM-knockdown planarians exhibited a severely disorganized neuronal network.
First, serious defects in axon outgrowth were detected in the central spongy region. Immunostaining with the anti-PC2 antibody, a panneuronal marker that labels axons, revealed accumulation of PC2 protein in the outer layer of the brain in which neuronal cell bodies were located. Second, the neural networks in the lateral branches were severely disorganized. Furthermore, the number of lateral branches was remarkably decreased in DjDSCAM-RNAi animals. Based on the localization of the cell bodies, this phenotype is considered to result from a failure in cell migration. In addition, axon growth, fasciculation and projection were also affected by DjDSCAM gene knockdown.
These results demonstrate that DjDSCAM plays crucial roles in various steps of neural network formation. Based on the results of the cell aggregation assays, DjDSCAM homophilic adhesion activity is required for the formation of the nervous system. In addition, in situ hybridization analysis revealed that DjDSCAM was expressed not only in the primordium of the lateral branches but also in non-neuronal cells surrounding lateral branch neurons. These results suggest that cell interactions between neurons and other neurons or surrounding non-neuronal cells mediated by DjDSCAM homophilic adhesion are involved in proper formation of the neural network.
Drosophila DSCAM is also highly expressed in the embryonic and adult CNS, and plays widespread roles in the wiring of the fly brain (Schmucker et al. 2000; Wang et al. 2002, 2004; Zhan et al. 2004). In Drosophila, the adaptor protein Dock binds to DSCAM through its SH2/SH3 binding motifs, facilitates recruitment of Pak to the complex and promotes actin reorganization (Schmucker et al. 2000). Although the intracellular portions of Drosophila and planarian DSCAMs do not share significant homology, SH2/SH3 binding motifs can be found in both species. Therefore, DjDSCAM homophilic interactions may also promote reorganization of the cytoskeleton through these SH2/SH3 binding motifs.
DjDSCAM knockdown planarians with a disorganized neural network exhibit dramatically decreased locomotive activity
Since DjDSCAM is not expressed in the eyes, the visual tracts of the knockdown animals appeared normal. Furthermore, the knockdown planarians moved their heads so as to escape from a light source, and were therefore considered to recognize light stimulation. However, phototaxis assays revealed that they hardly moved from the start area, and could not escape from the light source. These observations indicate that DjDSCAM knockdown planarians show severe defects in locomotive activity. A previous study reported that headless planarians move in a random way, though they are unable to recognize the direction of a light source (Inoue et al. 2004). Taken together, we conclude that the reduced motility of DjDSCAM knockdown planarians is probably caused by abnormal suppression of movement due to brain dysfunction.
In DjDSCAM-RNAi animals, both the central spongy region and lateral branches showed disorganized morphologies. The central spongy region is composed of interneurons, and regarded as an important area for integrating information, while the lateral branches are composed of chemosensory neurons, and considered to be required for conveying chemosensory information to the brain central region. In the central spongy region, chemosensory and visual neurons are projected, the left and right lobes connect to each other via commissural neurons, and connections between VNCs are observed (Okamoto et al. 2005). Thus, hypoplasia of the neural network in the central region presumably leads to severe defects in brain function. By inhibiting DjDSCAM expression during brain regeneration, axon outgrowth in the central spongy region was significantly suppressed. The failure in axon outgrowth probably causes a deficiency in essential neural connections and the formation of misconnections in the central spongy region. These effects would disrupt the neural network in the brain central region and may induce abnormal suppression of the locomotive activity.
In conclusion, we have revealed that cell adhesions mediated by DjCAM and DjDSCAM are required for various steps in the formation of the neural network. Planarians can regenerate a functional brain in a short time period and also exhibit developmental plasticity. To achieve these dynamic changes in the neural network, proper regulation of cell–cell interactions would be essential. Further studies on the DjDSCAM-mediated adhesion system in planarian may shed light on the molecular mechanisms of mammalian DSCAM-mediated neuronal network formation, which remains to be understood. More extensive analyses of IgCAMs as well as other cell adhesion molecules, such as protocadherins, in the future will provide clues toward understanding the basic mechanisms of neuronal plasticity.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
A clonal strain of the planarian Dugesia japonica, GI, which was established by Dr Kenji Watanabe at University of Hyogo (formerly Himeji Institute of Technology), was used (Ogawa et al. 1998). All worms used in experiments had undergone one week of starvation.
Cloning of DjCAM, DjDSCAM, DjLCAM and DjCTCAM cDNAs
First, four cDNA clones, namely 944HH, 7105HH, 224L06 and 4747HH, which are homologous to vertebrate NCAM, DSCAM, L1 and contactin, respectively, were found using an EST analysis. Since the inserts of these clones only contained partial sequences of the 3' regions, we performed nested PCR to obtain the 5' extremities of their ORFs. The gene-specific reverse primers used were designed on the basis of the EST sequences as follows: 944HH: ACGTCTACTTGTTGAACTTGGACA and TCGTCCAATGGGTTTCGTTGTCAC; 7105HH: GACTAGATCAGAGTTGTTGGGTA and ACTGTTGCCATTGTTGTTTTGTGC; 224L06: TGCCAAACACCACTCTATTCG and ATTGCCGCTGCTGAGACCAAT; and 4747HH: GACATCCATTCCAACCAAACCTTC and TGCTGATTCTCTGCCAAACGTGT. Of the two primers cited for each clone, the former was used for the first PCR, and the latter was used for the second PCR. For 944HH and 4747HH, the PCR amplifications were carried out using a planarian head cDNA library in the 
ZAPII vector (Stratagene) as a template and M13reverse and T3 as the forward primers. Since vertebrate L1CAM and DSCAM include long ORFs, the PCR amplifications of 224L06 and 7105HH were performed using a full-length cDNA library in the pGCAP1 vector (HITACHI) as a template and M13forward and T7 as the forward primers.
Building of phylogenetic trees
Multiple alignments of the deduced amino acid sequences were performed using the Clustal X program (Thompson et al. 1997) and its default parameters. Gapped regions were excluded from the distance calculation. We used a neighbor-joining method (Saitou & Nei 1987) for the tree construction.
Generation of IgCAM-expressing cells using a silkworm baculovirus expression system
The subcloned DjCAM, DjDSCAM, DjLCAM or DjCTCAM cDNAs were each cleaved with NotI and SalI, and the cDNA fragments obtained were inserted into pYNG-sig (Sasakura et al. 2005). Each constructed plasmid was mixed with purified viral DNA (Maeda et al. 1985), and the mixture was transfected into BmN4 cells derived from silkworm Bombyx mori larvae using the Lipofectin reagent (Invitrogen). Recombinant viruses were screened by end-point dilution methods in 96-well plates, and polyhedrin-negative clones were obtained. The recombinant viruses were propagated and concentrated on BmN4 cells. After infection with the recombinant viruses, BmN4 cells were cultured for 4 or 5 days, checked for recombinant protein expression, and subjected to further analyses by aggregation assays.
Measurement of cell aggregation
A total of 1 x 106 cells suspended in 3 mL of HCMF buffer were placed in each well of 24-well plates, that had been precoated with BSA to prevent cell attachment to the dishes. Next, the cells were incubated at 27 °C on a gyratory shaker at 60 r.p.m. To measure cell aggregation, the total particle number in the cell suspension was counted. The extent of aggregation was represented by the ratio of the total particle number at time t (60 min) of the incubation (Nt) to the initial particle number (N0), the latter being identical to the total number of cells added to the medium (Sasakura et al. 2005). To examine heterophilic cell adhesion, two separately infected pools of BmN4 cells, one of which was labeled with a cell labeling solution (Molecular Probes), were mixed and incubated on a gyratory shaker as described above.
Whole-mount in situ hybridization
Digoxigenin (DIG)-labeled RNA probes were synthesized using 1.5 kbp DjCAM, 2.1 kbp DjDSCAM, 2.3 kbp DjLCAM and 2.0 kbp DjCTCAM cDNA fragments encoding the 3' regions as the templates (DIG RNA labeling kit; Roche). Whole-mount in situ hybridization was carried out as previously described (Agata et al. 1998; Umesono et al. 1997). To investigate the expression patterns during the formation of the head region, planarians with newly regenerating heads were generated by amputating the original heads.
Whole-mount immunohistochemistry
Mouse anti-DjCAM polyclonal and monoclonal antibodies were generated against a GST fusion protein. The GST fusion protein, which contained residues 190–390 corresponding to the Ig2–3 domain, was produced in Escherichia coli strain BL21. The fusion protein was injected into Balb/c mice 7 times at 2 week intervals. Whole-mount immunohistochemistry was carried out as previously described (Cebriáet al. 2002b). Mouse anti-PC2 (Okamoto et al. 2005), anti-DjCAM and anti-G protein beta (Inoue et al., manuscript in preparation) polyclonal antibodies were used at 1000-fold dilution, and the signals were detected using an Alexa 488-conjugated goat anti-mouse antibody (Molecular Probes) at 400-fold dilution. Fluorescence was detected with an FV1000 confocal microscope (Olympus).
Generation of gene knockdown planarians by RNAi
dsRNA was basically synthesized as previously described (Sanchez Alvarado & Newmark 1999). To obtain anti-sense and sense RNAs, T3 and T7 RNA polymerases (Roche) were reacted with linearized pBluescript SK (+) containing 1.5 kbp DjCAM or 2.1 kbp DjDSCAM fragments encoding the 3' regions. The RNAs were denatured for 20 min at 65 °C and annealed for 40 min at 37 °C. After ethanol precipitation, dsRNA was resuspended in 10.5 µL of water. Intact planarians were injected with dsRNA 3 times (32 nL/injection) for 3 consecutive days using a Drummond Scientific Nanoinject injector. Control planarians were injected with water. At 4 h after the third injection, planarians were amputated to generate headless fragments. The phenotypes of planarians that regenerated their heads in the absence of specific gene expressions were investigated by immunostaining and behavioral assays.
Detection of sensitivity to light stimulation
Planarian bodies were fixed in agar plates using narrow bronze wires so that they could only move their heads. Planarians were exposed to a narrow light from the horizontal position, and snapshots were obtained every 3 s for 5 min. The head movements were detected with an Axiocam HRm (Carl Zeiss) and a time-lapse module on an Axiovert 200M inverted microscope (Carl Zeiss), and quantified by plotting the position of the center of the head axis.
Phototaxis assay
A previously described phototaxis assay system (Inoue et al. 2004) was used. Planarians were placed into a 60-30–10 mm container filled with 10 mL of boiled tap water at 22 °C. The container was exposed to 500 lux of white light from a horizontal position on one side of the container. Planarian behavior was recorded using a digital video camera (Sony), and analyzed by SMART v2.0 behavior analysis software (Panlab).
|
Acknowledgements |
|---|
|
Footnotes |
|---|
* Correspondence: E-mail: k-takeuchi{at}kan.gr.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Agata, K., Soejima, Y., Kato, K., Kobayashi, C., Umesono, Y. & Watanabe, K. (1998) Structure of the Planarian central nervous system (CNS) revealed by neuronal cell markers. Zool. Sci. 15, 433–440.[Medline]
Bastiani, M.J., Harrelson, A.L., Snow, P.M. & Goodman, C.S. (1987) Expression of fasciclin I and II glycoproteins on subsets of axon pathways during neuronal development in the grasshopper. Cell 48, 745–755.[CrossRef][Medline]
Bieber, A.J., Snow, P.M., Hortsch, M, et al. (1989) Drosophila neuroglian: a member of the immunoglobulin superfamily with extensive homology to the vertebrate neural adhesion molecule L1. Cell 59, 447–460.[CrossRef][Medline]
Brummendorf, T. & Rathjen, F.G. (1996) Structure/function relationships of axon-associated adhesion receptors of the immunoglobulin superfamily. Curr. Opin. Neurobiol. 6, 584–593.[CrossRef][Medline]
Cebriá, F., Kudome, T., Nakazawa, M, et al. (2002a) The expression of neural-specific genes reveals the structural and molecular complexity of the planarian central nervous system. Mech. Dev. 116, 199–204.[CrossRef][Medline]
Cebriá, F., Nakazawa, M., Mineta, K., Ikeo, K., Gojobori, T. & Agata, K. (2002b) Dissecting planarian central nervous system regeneration by the expression of neural-specific genes. Dev. Growth Differ. 44, 135–146.[CrossRef][Medline]
Cebriá, F. & Newmark, P.A. (2005) Planarian homologs of netrin and netrin receptor are required for proper regeneration of the central nervous system and the maintenance of nervous system architecture. Development
132, 3691–3703.
Chen, L., Ong, B. & Bennett, V. (2001) LAD-1, the Caenorhabditis elegans L1CAM homologue, participates in embryonic and gonadal morphogenesis and is a substrate for fibroblast growth factor receptor pathway-dependent phosphotyrosine-based signaling. J. Cell Biol.
154, 841–855.
Crossin, K.L. & Krushel, L.A. (2000) Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Dev. Dyn. 218, 260–279.[CrossRef][Medline]
Cunningham, B.A., Hemperly, J.J., Murray, B.A., Prediger, E.A., Brackenbury, R. & Edelman, G.M. (1987) Neural cell adhesion molecule: structure, immunoglobulin-like domains, cell surface modulation, and alternative RNA splicing. Science
236, 799–806.
Faivre-Sarrailh, C., Banerjee, S., Li, J., Hortsch, M., Laval, M. & Bhat, M.A. (2004) Drosophila contactin, a homolog of vertebrate contactin, is required for septate junction organization and paracellular barrier function. Development
131, 4931–4942.
Falk, J., Bonnon, C., Girault, J.A. & Faivre-Sarrailh, C. (2002) F3/contactin, a neuronal cell adhesion molecule implicated in axogenesis and myelination. Biol. Cell 94, 327–334.[CrossRef][Medline]
Huang, Y., Jellies, J., Johansen, K.M. & Johansen, J. (1997) Differential glycosylation of tractin and LeechCAM, two novel Ig superfamily members, regulates neurite extension and fascicle formation. J. Cell Biol.
138, 143–157.
Inoue, T., Kumamoto, H., Okamoto, K, et al. (2004) Morphological and functional recovery of the planarian photosensing system during head regeneration. Zool. Sci. 21, 275–283.[CrossRef][Medline]
Kamiguchi, H., Hlavin, M.L. & Lemmon, V. (1998) Role of L1 in neural development: what the knockouts tell us. Mol. Cell. Neurosci. 12, 48–55.[CrossRef][Medline]
Lin, D.M., Fetter, R.D., Kopczynski, C., Grenningloh, G. & Goodman, C.S. (1994) Genetic analysis of Fasciclin II in Drosophila: defasciculation, refasciculation, and altered fasciculation. Neuron 13, 1055–1069.[CrossRef][Medline]
Maeda, S., Kawai, T., Obinata, M, et al. (1985) Production of human alpha-interferon in silkworm using a baculovirus vector. Nature 315, 592–594.[CrossRef][Medline]
Mayford, M., Barzilai, A., Keller, F., Schacher, S. & Kandel, E.R. (1992) Modulation of an NCAM-related adhesion molecule with long-term synaptic plasticity in Aplysia. Science
256, 638–644.
Mineta, K., Nakazawa, M., Cebria, F., Ikeo, K., Agata, K. & Gojobori, T. (2003) Origin and evolutionary process of the CNS elucidated by comparative genomics analysis of planarian ESTs. Proc. Natl. Acad. Sci. USA
100, 7666–7671.
Nakazawa, M., Cebria, F., Mineta, K., Ikeo, K., Agata, K. & Gojobori, T. (2003) Search for the evolutionary origin of a brain: planarian brain characterized by microarray. Mol. Biol. Evol.
20, 784–791.
Newmark, P.A. & Sanchez Alvarado, A. (2002) Not your father's planarian: a classic model enters the era of functional genomics. Nature Rev. Genet. 3, 210–219.[CrossRef][Medline]
Ogawa, K., Wakayama, A., Kunisada, T., Orii, H., Watanabe, K. & Agata, K. (1998) Identification of a receptor tyrosine kinase involved in germ cell differentiation in planarians. Biochem. Biophys. Res. Commun. 248, 204–209.[CrossRef][Medline]
Okamoto, K., Takeuchi, K. & Agata, K. (2005) Neural projections in planarian brain revealed by fluorescent dye tracing. Zool. Sci. 22, 535–546.[CrossRef][Medline]
Romero, R. & Baguò, J. (1991) Quantitative cellular analysis of growth and reproduction in freshwater planarians (Turbellaria; Tricladida). I. A cellular description of the intact organism. Invert. Reprod. Dev. 19, 157–165.
Rougon, G. & Hobert, O. (2003) New insights into the diversity and function of neuronal immunoglobulin superfamily molecules. Annu. Rev. Neurosci. 26, 207–238.[CrossRef][Medline]
Saitou, N. & Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.[Abstract]
Sanchez Alvarado, A. & Newmark, P.A. (1999) Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc. Natl. Acad. Sci. USA
96, 5049–5054.
Sasakura, H., Inada, H., Kuhara, A, et al. (2005) Maintenance of neuronal positions in organized ganglia by SAX-7, a Caenorhabditis elegans homologue of L1. EMBO J. 24, 1477–1488.[CrossRef][Medline]
Schmucker, D., Clemens, J.C., Shu, H, et al. (2000) Drosophila Dscam is an axon guidance receptor exhibiting extraordinary molecular diversity. Cell 101, 671–684.[CrossRef][Medline]
Tazaki, A., Gaudieri, S., Ikeo, K., Gojobori, T., Watanabe, K. & Agata, K. (1999) Neural network in planarian revealed by an antibody against planarian synaptotagmin homologue. Biochem. Biophys. Res. Commun. 260, 426–432.[CrossRef][Medline]
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res.
25, 4876–4882.
Umesono, Y., Watanabe, K. & Agata, K. (1997) A planarian orthopedia homolog is specifically expressed in the branch region of both the mature and regenerating brain. Dev. Growth Differ. 39, 723–727.[CrossRef][Medline]
Virgintino, D., Ambrosini, M., D’Errico, P, et al. (1999) Regional distribution and cell type-specific expression of the mouse F3 axonal glycoprotein: a developmental study. J. Comp. Neurol. 413, 357–372.[CrossRef][Medline]
Walsh, F.S. & Doherty, P. (1997) Neural cell adhesion molecules of the immunoglobulin superfamily: role in axon growth and guidance. Annu. Rev. Cell Dev. Biol. 13, 425–456.[CrossRef][Medline]
Wang, J., Ma, X., Yang, J.S, et al. (2004) Transmembrane/juxtamembrane domain-dependent Dscam distribution and function during mushroom body neuronal morphogenesis. Neuron 43, 663–672.[CrossRef][Medline]
Wang, J., Zugates, C.T., Liang, I.H., Lee, C.H. & Lee, T. (2002) Drosophila Dscam is required for divergent segregation of sister branches and suppresses ectopic bifurcation of axons. Neuron 33, 559–571.[CrossRef][Medline]
Yamakawa, K., Huot, Y.K., Haendelt, M.A, et al. (1998) DSCAM: a novel member of the immunoglobulin superfamily maps in a Down syndrome region and is involved in the development of the nervous system. Hum. Mol. Genet.
7, 227–237.
Yimlamai, D., Konnikova, L., Moss, L.G. & Jay, D.G. (2005) The zebrafish down syndrome cell adhesion molecule is involved in cell movement during embryogenesis. Dev. Biol. 279, 44–57.[CrossRef][Medline]
Zhan, X.L., Clemens, J.C., Neves, G, et al. (2004) Analysis of dscam diversity in regulating axon guidance in Drosophila mushroom bodies. Neuron 43, 673–686.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  T. Inoue, T. Hayashi, K. Takechi, and K. Agata Clathrin-mediated endocytic signals are required for the regeneration of, as well as homeostasis in, the planarian CNS Development, May 1, 2007; 134(9): 1679 - 1689. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS</ |
