HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Jolivet, S. Articles by Mercier, R. Search for Related Content PubMed PubMed Citation Articles by Jolivet, S. Articles by Mercier, R.

Station de Génétique et d’Amélioration des Plantes, Institut Jean-Pierre Bourgin, Institut National de la Recherche Agronomique, Route de Saint-Cyr, 78026 Versailles cedex, France

	Abstract

Top Abstract Introduction Results Discussion Experimental procedures References

 
Meiotic recombination involves the formation and repair of DNA double-strand breaks (DSB). One of the genes required for DSB formation in the yeast Saccharomyces cerevisiae, Ski8/Rec103, is intriguing because it also plays a role in cytoplasmic RNA metabolism, a function difficult to relate to DSB formation. The meiotic role of Ski8 is conserved in several fungi, but has not been investigated outside this kingdom. We identified the Ski8 homolog in Arabidopsis thaliana and isolated two mutants. We showed that the Arabidopsis Ski8 homolog was required for normal plant development and growth, suggesting a conserved somatic function, but that it was not required for meiotic recombination or progression. The data presented here provide strong evidence that the meiotic role of Ski8 is not conserved in Arabidopsis and sequence analysis suggests that this may also be the case in a range of other species.

	Introduction

Top Abstract Introduction Results Discussion Experimental procedures References

 
Meiotic recombination involves the formation and repair of DNA double-strand breaks (DSB). DSB formation is catalyzed by Spo11, which is widely conserved in eukaryotes, including fungi, invertebrates, mammals and plants (Keeney 2001). Nine other genes, encoding proteins of unknown function, are required for DSB formation in the yeast Saccharomyces cerevisiae. Five of these genes are specific to meiosis (Rec102, Rec104, Rec114, Mei4 and Mer2) and do not seem to be conserved outside fungi, at least in terms of their sequences. A second group of genes appear to be widely conserved but encode proteins also involved in somatic DSB repair (Rad50, Mre11 and Xrs2) (Keeney 2001). The remaining gene, Ski8/Rec103 (Gardiner et al. 1997), is intriguing because its product is also required for the 3' to 5' decay of cytoplasmic mRNA; it thus plays important functions in both mRNA turnover and antiviral activity (Masison et al. 1995; Jacobs Anderson & Parker 1998). These functions are difficult to relate to DSB formation. It has therefore been suggested that Ski8 may play an indirect role in DSB formation, regulating the expression of one of the other genes involved in this process, for example. However, Ski8 seems to play a direct role in both mechanisms in yeast, as a member of the Ski2/Ski3/Ski8 complex (Brown et al. 2000; Araki et al. 2001) and through direct protein/protein interaction with Spo11 (Arora et al. 2004). The meiotic role of Ski8 appears to be conserved, because homologs in Schizosaccharomyces pombe and Sordaria macrospora are also required for the initiation of meiotic recombination (Evans et al. 1997; Tesse et al. 2003). However, the possible involvement of Ski8 in meiosis has not been investigated in organisms from the non-fungal kingdoms.

We identified the Ski8 homolog in Arabidopsis (At4g29830/VIP3) and characterized two allelic mutations in this gene (vip3-2 and vip3-3). Like the ski8 mutants of S. pombe and S. macrospora, these mutants grew poorly. However, they displayed no meiotic defects, unlike the three tested fungi, which cannot initiate recombination in the absence of Ski8. The defects in synapsis and chiasma formation observed in the Arabidopsis Atspo11-1 mutants, which cannot initiate recombination (Grelon et al. 2001), were not detected in vip3 mutants. Furthermore, the rate of chiasma formation was unaffected in vip3 mutants. Thus, the meiotic function of Ski8 is not conserved in Arabidopsis.

	Results

Top Abstract Introduction Results Discussion Experimental procedures References

 
The Arabidopsis Ski8 homolog

Using the BLASTP algorithm and Ski8/Rec103/Rec14 proteins from several organisms as a query, we identified the At4g29830/VIP3 gene in the Arabidopsis genome as encoding a putative Ski8 homolog. This gene has been reported to be involved in the determination of flowering time (Zhang et al. 2003), but its function was not investigated further in light of its homology with Ski8. When the deduced amino acid sequence of the protein encoded by this gene was used as a query in a BLAST search against the nr database, the first hits were vertebrate Ski8 homologs and the first Drosophila melanogaster and Schizosaccharomyces pombe hits were also the Ski8/Rec14 proteins of these species. We used RT-PCR to redefine the cDNA, which was identical to that in the databases (GENBANK accession number BT008333), and to demonstrate that this gene was ubiquitously expressed (data not shown). The VIP3 gene contains two exons, and gives rise to a 963 bp cDNA. The corresponding 321-amino acid protein is very similar to known Ski8 proteins, displaying 35% identity to the mouse Ski8, its closest known homolog (Fig. 1). The Ski8 amino acids shown to be required for interactions with Ski2 and Spo11 (Cheng et al. 2004) (asterisks on Fig. 1) were found to be conserved in this protein. Phylogenetic reconstruction (Fig. 1B) showed that the Ski8 proteins from a large range of species cluster together with At4g29830/VIP3. In contrast, the next two Arabidopsis hits from BLAST analyses (At1g48630 and At3g49660) are on different branches, and are much closer to functionally unrelated proteins (RACK1, a regulator of translation (Nilsson et al. 2004) and WDR5, a general regulator of gene expression (Wysocka et al. 2005), respectively. High bootstrap values on the phylogenic tree and the non-duplication of At4g29830/VIP3 designate this gene as the only homolog of Ski8 in Arabidopsis.

View larger version (98K): [in this window] [in a new window]   Figure 1  The Ski8 proteins. (A) Alignment of Ski8 proteins from a range of species representing different kingdoms. Identical amino acids are shaded in black and similar amino acids in gray. The positions of the two vip3 mutations investigated in this study are indicated by triangles. Asterisks indicate the amino acids shown to be required for Ski8 interactions with Spo11 and Ski2 (Cheng et al. 2004). (B) Neighbor-joining unrooted tree built from of a large range of Ski8 proteins and other functionally unrelated proteins. Taf72 was used as the outgroup. The numbers on the branches (bootstrap values) indicate the number of times the partition of the proteins into the two sets separated by that branch occurred among the trees, for 1000 trees.

We investigated VIP3 gene function in plants by searching for mutants in public T-DNA insertion line collections. We identified two mutations in the SALK collections (Alonso et al. 2003), disrupting this gene at different positions. We named these mutant alleles vip3-2 and vip3-3 (SALK_083364 and SALK_117732). For each of these mutations, we amplified and sequenced the genomic DNA next to the T-DNA insertion, to determine the precise position of the insertion. In vip3-2 and vip3-3, the T-DNA is inserted into exons I and II, respectively, at bases 303 and 893 in the cDNA. The corresponding disrupted positions in the VIP3 protein are presented in Fig. 1. We were unable to amplify the VIP3 cDNA from the tissues of the two mutant lines (data not shown), whereas the amplification was successful in the wild-type, confirming that these mutants did not express the VIP3 gene. For both lines, plants homozygous for the mutation displayed identical pleiotropic defects (Fig. 2), similar to those with a different allele reported by Zhang et al. (2003). Crosses demonstrated that these two mutations were not complementary, and were therefore allelic, confirming that the vip3 disruptions were responsible for the observed phenotype. Both homozygous mutants displayed major growth defects, resulting in frail and dwarf plants with fruits dramatically reduced in size (Fig. 2A). Floral developmental defects were observed, including flowers more open than the wild-type and some variation of sepal, petal and anther number and size (Fig. 2B). In greenhouse conditions, vip3 plants produced few if any seeds by self-fertilization. Forced out-crossing using wild-type pollen grains restored seed production, indicating that vip3 sterility was primarily a form of male sterility. This conclusion was supported by observations of male and female gametophyte development (Fig. 3). In flowering plants, meiosis does not generate the gametes directly, but instead produces spores, which undergo haploid mitotic divisions, giving rise to the male and female gametophyte, the pollen grain and the embryo sac, respectively. Figure 3A shows a wild-type anther stained as described by Alexander (1969). The anthers contained an average of 470 regular pollen grains, with the envelope stained green and the cytoplasm stained red, indicating viability. The vip3 mutant produced very few pollen grains (average = 20, n = 50), due to both anther growth defects and pollen grain degeneration (Fig. 3B–D), which can be clearly seen on cleared anthers (Fig. 3E,F). These pollen grain defects were genetically driven by the sporophyte tissues, and not by the gametophyte itself, as heterozygous plants had normal pollen grains. In contrast to this strong male defect, female gametogenesis was only mildly affected in vip3. In the wild-type, three haploid divisions of the spore lead to an eight-cell embryo sac (arrowheads on Fig. 3G). Fusion of the two central cells and degeneration of the three anti-podal cells give rise to a four-cell mature embryo sac (Fig. 3H). In vip3, 78% (n = 471) of the embryo sacs developed normally (Fig. 3I,J), with only 22% appearing to have degenerated (Fig. 3K).

View larger version (41K): [in this window] [in a new window]   Figure 2  vip3 mutants display pleiotropic defects. (A) Five-week-old wild-type, vip3-2 and vip3-3 plants (Scale bar 1 cm). (B) Wild-type and vip3-2 flower.

View larger version (84K): [in this window] [in a new window]   Figure 3  Male and female gametogenesis in vip3. (A) Wild-type and (B–D) vip3-2 anthers with pollen grains stained as described elsewhere (Alexander 1969). (E) Cleared wild-type anther. (F) Cleared vip3-2 anther with collapsing pollen grains. (G) Wild-type ovules containing an embryo sac at the eight-cell (arrows) stage. (H) Wild-type ovule containing a mature embryo sac composed of four cells. (I, J) vip3-2 ovules indistinguishable from wild-type. (K) A vip3-2 ovule with a degenerated embryo sac (Scale bars 100 µm). c, central cell; e, egg cell; s, synergid cells.

VIP3 is not required for the progression of meiosis and crossover formation

Ski8 is required for the initiation of meiotic recombination in several fungi. We therefore compared the behavior of meiotic chromosomes in the vip3 mutants with that of meiotic chromosomes in the wild-type and the Atspo11-1-1 mutant (Fig. 4), which is defective in the initiation of recombination (Grelon et al. 2001). In the wild-type, the ten chromosomes appear as threads at leptotene and are fully synapsed at pachytene (Fig. 4A). The resulting five bivalents condense at diakinesis, revealing the presence of chiasmata—the cytological counterpart of crossovers, holding the two homologous chromosomes together within the bivalent (Fig. 4B). The bivalents organize on the metaphase I plate (Fig. 4C) and two rounds of segregation lead to the formation of four sets of five chromatids (Fig. 4D). Both vip3-2 and vip3-3 homozygotes displayed absolutely normal meiosis (> 250 cells observed), including full synapsis at pachytene (Fig. 4E), bivalents and chiasmata at diakinesis (Fig. 4F) and metaphase I (Fig. 4G) and regular chromosome segregation (Fig. 4H). These observations strongly contrasted with the meiotic defects observed in spo11-1 mutants of Arabidopsis (Grelon et al. 2001) (Fig. 4I–L), in which synapsis was impaired (Fig. 4I), chiasmata were absent, ten univalents were observed rather than five bivalents (Fig. 4J,K) and the chromosomes missegregated (Fig. 4L). We determined chiasma frequency by studying the shape of metaphase I bivalents, as described in several previous studies (Sanchez Moran et al. 2001; Higgins et al. 2004; Mercier et al. 2005). The short duration of metaphase I (with respect to prophase stages), together with the small number of meiocytes in vip3 mutants, due to the pleiotropic effects of the mutation on plant growth and development, made it difficult to isolate the required cells. However, chiasma frequency was similar in vip3 and the wild-type (9.17 and 9.2 chiasmata per meiosis, n = 12, n = 30, respectively).

View larger version (87K): [in this window] [in a new window]   Figure 4  Male meiosis in (A–D) wild-type, (E–H) vip3 and (I–L) spo11-1 mutants (Scale bar 10 µm).

In yeast, Ski8 directly interacts with Spo11 and the single (Gln376) or double (Arg377 and Glu378) substitution of certain amino acids in Spo11 specifically abolishes both Spo11-Ski8 interaction in a two-hybrid system and meiotic recombination (Arora et al. 2004). Interestingly, two of the three amino acids concerned are highly conserved in the three species in which Ski8 has been implicated in meiosis (asterisks on Fig. 5 (Keeney 2001)), but not in the Arabidopsis SPO11-1 protein, suggesting, in accordance with our results, that AtSPO11-1 may not interact with VIP3. These amino acids are also not conserved in several Ascomycetes, in the tested Basidiomycetes and animals (Fig. 5).

View larger version (49K): [in this window] [in a new window]   Figure 5  Spo11 protein alignment (fragment). Identical amino acids are shaded in black and similar amino acids, in gray. Amino acids involved in the Ski8-Spo11 interaction are indicated by asterisks (Arora et al. 2004).

	Discussion

Top Abstract Introduction Results Discussion Experimental procedures References

Vip3 mutations cause massive development defects, affecting both somatic growth and fertility. Such defects were expected, as the VIP3/Ski8 gene is ubiquitously expressed in Arabidopsis and other organisms, and as the ski8 mutants in S. pombe (rec14) and S. macrospora also display growth defects (Evans et al. 1997; Tesse et al. 2003). In yeast, the Ski complex, composed of Ski8, Ski2 and Ski3, has been implicated in the regulation of exosome-mediated 3'–5' degradation of non-poly(A) and double-stranded RNA (Masison et al. 1995; Jacobs Anderson & Parker 1998; Brown et al. 2000; van Hoof et al. 2000; Araki et al. 2001), and cells lacking both Ski8 and Xrn1, which are involved in the 5'–3' degradation of mRNA, are not viable (Jacobs Anderson & Parker 1998). Putative homologs of Ski2 and Ski3 can be identified in the Arabidopsis genome (AT3G46960 and At1g76630, respectively) but have not yet been characterized. Thus, the widespread expression of Ski8 and the somatic defects induced by ski8 mutations may reflect similar roles in RNA metabolism in both S. macrospora (Tesse et al. 2003) and Arabidopsis. Nevertheless, the growth problems observed in Arabidopsis are much more dramatic than the growth defects seen in fission yeast and in Sordaria, suggesting that development is more heavily dependent on Ski8-dependent RNA metabolism in Arabidopsis than in these other two species.

Role of Ski8/VIP3 in meiosis

Analyses of chromosome behavior showed that meiosis was unaffected in vip3 mutants. Moreover, neither synapsis, which depends on the initiation of meiotic recombination in Arabidopsis (Grelon et al. 2001), nor chiasma formation, the cytological counterpart of crossovers, is affected by vip3 mutations. Thus, VIP3 is clearly not required for the initiation of recombination in Arabidopsis, whereas Ski8 has been shown to be required for this function in three different fungi (Evans et al. 1997; Gardiner et al. 1997; Tesse et al. 2003). The possible role of this protein in meiosis has not yet been investigated in other eukaryotes. However, the amino acids of Spo11 involved in the Spo11–Ski8 interaction in S. cerevisiae (Arora et al. 2004) are conserved in S. pombe and S. macrospora, the two other species in which Ski8 has been implicated in meiosis, but not in several Ascomycetes, in the tested Basidiomycetes and in the other higher eukaryotes (Fig. 5), suggesting that this particular interaction is not widely conserved. Indeed, interaction between the mouse Spo11 and Ski8 proteins cannot be detected in a two-hybrid system or by co-immunoprecipitation from testis extracts (S. Keeney, personal communication; B. de Massy, personal communication) and Ski8 does not appear to be translocated from the cytoplasm to the nucleus during meiosis in mouse (S. Keeney, personal communication), whereas this translocation does occur in S. macrospora (Tesse et al. 2003) and S. cerevisiae (Arora et al. 2004). These results suggest that species may be classified into two groups: those in which Ski8 is involved in meiotic recombination initiation (S. cerevisiae, S. pombe, S. macrospora and possibly some other Ascomycetes) and those in which Ski8 is not involved in this process (A. thaliana, probably mouse and possibly some Ascomycetes, Basidyomycetes and other higher eukaryotes). However, direct functional analyses in a range of species would be required to demonstrate this conclusively and to shed light on the evolution of a meiotic role for Ski8.

Ski8 contains seven repeats of the "WD" motif (Cheng et al. 2004; Madrona & Wilson 2004), which is found in many proteins with diverse functions and is thought to be involved in protein–protein interactions (Smith et al. 1999). One interesting possibility is that Ski8 may be a scaffold, bringing proteins together, and that this basic function was initially used for formation of the mRNA decay complex and has since evolved for formation of the meiotic initiation complex.

	Experimental procedures

Top Abstract Introduction Results Discussion Experimental procedures References

 
Plant material

The wild-type used in this study was A. thaliana ecotype Columbia (Col-0). The vip3 mutants were obtained from the Salk Institute Genomic Analysis Laboratory (SIGnAL) collection of T-DNA mutants (Alonso et al. 2003) (Col-0 background).

Sequence analysis

Sequence analyses were carried out with DNAssist software <http://www.dnassist.org>. Protein homolog screening was performed at the National Center for Biotechnology Information web site <http://www.ncbi.nlm.nih.gov/Blast/> (Altschul et al. 1997) and at The Arabidopsis Information Resource (TAIR) web site <http://www.Arabidopsis.org/Blast>, using the BLOSUM45 matrix and default parameters. Multiple protein alignments were generated with CLUSTALW at the Kyoto University web site <http://www.genome.jp/>, using default parameters. A neighbor-joining phylogenic tree was constructed with Phylip version 3.65 from these multiple alignments, using a Dayhoff PAM matrix. 1000 bootstraps to test the robustness of nodes. Taf72, which is the closest S. pombe protein to the S. pombe Rec14/Ski8 and which is involved in unrelated mechanisms (Yamamoto et al. 1997), was used as an outgroup. Ski8 and Spo11 homolog sequences were identified from a range of genome databases <http://www.ncbi.nlm.nih.gov/>, <http://www.broad.mit.edu/cgi-bin/annotation/fgi/blast_page.cgi>, <http://mips.gsf.de/genre/proj/fusarium>, <http://www.genedb.org/genedb/pombe/index.jsp>, <http://podospora.igmors.u-psud.fr/blast_ol.html>, <http://www.broad.mit.edu/annotation/fungi/ustilago_maydis/>, <http://www.wormbase.org/,http://www.yeastgenome.org/>.

Transcript analysis

Total RNA was prepared from wild-type prebolting buds with the RNAEasy® Plant Miniprep kit (Qiagen) and reverse transcription was performed with the SMART^TM. PCR cDNA Kit (Clontech), according to the manufacturers’ protocols. The full-length VIP3 cDNA was amplified by PCR on cDNA with the primers ski8#1 (5'- TGAGGAAACACAGTAAAAACC) and ski8#2 (5'- ACAACTAGATGCGTCTTGG). This cDNA was then sequenced.

Mutation analyses

The following primer combinations were used for amplification and sequencing of the Arabidopsis genomic DNA next to the T-DNA insertions:

Vip3-2 (SALK_083364): Border with LBsalk1 (5'-CATCAAACAGGATTTTCGCC/N583364L (5'-GCACTGATACTTGATAGTCACCAGG); wild-type allele with N583364U (5'-AGAGAAGACGCAAGAAGAAGAGTG)/N583364L. Vip3-3(SALK_117732): LB with LBsalk1/N617732U (5'-CTGGTGACTATCAAGTATCAGTGCA); wild-type allele with N617732U/N617732L (5'- TTTCGGAGCTGTCATGGATGTT).

Cytology

We assessed the viability of mature pollen grains as described elsewhere (Alexander 1969). Developing ovules and pollen grains were observed by differential interference contrast (DIC) microscopy, as described by Motamayor et al. (2000). Male meiotic chromosomes were stained with DAPI, as described by Ross et al. (1996) and images were captured with a coolSNAP camera (Roper Scientific), driven by Openlab software (Improvision). All images were then processed with Adobe Photoshop 6.0 to improve image quality.

	Acknowledgements

 
We thank Scott Keeney and Bernard de Massy for sharing unpublished data. We also thank Mathilde Grelon and Christine Mézard for very helpful discussions, Eric Jenczewski for help on phylogenic tree building and Veena Vhedatale for critical reading of the manuscript.

	Footnotes

 
Communicated by: Scott Keeney

^* Correspondence: E-mail: rmercier{at}versailles.inra.fr

	References

Top Abstract Introduction Results Discussion Experimental procedures References

 
Alexander, M.P. (1969) Differential staining of aborted and nonaborted pollen. Stain Technol. 44, 117–122.[Medline]

Alonso, J.M., Stepanova, A.N., Leisse, T.J., et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301, 653–657.[Abstract/Free Full Text]

Altschul, S.F., Madden, T.L., Schaffer, A.A., et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402.[Abstract/Free Full Text]

Araki, Y., Takahashi, S., Kobayashi, T., Kajiho, H., Hoshino, S. & Katada, T. (2001) Ski7p G protein interacts with the exosome and the Ski complex for 3'-to-5" mRNA decay in yeast. EMBO J. 20, 4684–4693.[CrossRef][Medline]

Arora, C., Kee, K., Maleki, S. & Keeney, S. (2004) Antiviral protein Ski8 is a direct partner of Spo11 in meiotic DNA break formation, independent of its cytoplasmic role in RNA metabolism. Mol. Cell 13, 549–559.[CrossRef][Medline]

Brown, J.T., Bai, X. & Johnson, A.W. (2000) The yeast antiviral proteins Ski2p, Ski3p, and Ski8p exist as a complex in vivo. RNA 6, 449–457.[Abstract]

Cheng, Z., Liu, Y., Wang, C., Parker, R. & Song, H. (2004) Crystal structure of Ski8p, a WD-repeat protein with dual roles in mRNA metabolism and meiotic recombination. Protein Sci. 13, 2673–2684.[CrossRef][Medline]

Evans, D.H., Li, Y.F., Fox, M.E. & Smith, G.R. (1997) A WD repeat protein, Rec14, essential for meiotic recombination in Schizosaccharomyces pombe. Genetics 146, 1253–1264.[Abstract]

Gardiner, J.M., Bullard, S.A., Chrome, C. & Malone, R.E. (1997) Molecular and genetic analysis of REC103, an early meiotic recombination gene in yeast. Genetics 146, 1265–1274.[Abstract]

Grelon, M., Vezon, D., Gendrot, G. & Pelletier, G. (2001) AtSPO11-1 is necessary for efficient meiotic recombination in plants. EMBO J. 20, 589–600.[CrossRef][Medline]

Higgins, J.D., Armstrong, S.J., Franklin, F.C. & Jones, G.H. (2004) The Arabidopsis MutS homolog AtMSH4 functions at an early step in recombination: evidence for two classes of recombination in Arabidopsis. Genes Dev. 18, 2557–2570.[Abstract/Free Full Text]

van Hoof, A., Staples, R.R., Baker, R.E. & Parker, R. (2000) Function of the ski4p (Csl4p) and Ski7p proteins in 3' to 5' degradation of mRNA. Mol. Cell. Biol. 20, 8230–8243.[Abstract/Free Full Text]

Jacobs Anderson, J.S. & Parker, R.P. (1998) The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17, 1497–1506.[CrossRef][Medline]

Keeney, S. (2001) Mechanism and control of meiotic recombination initiation. Curr. Top. Dev. Biol. 52, 1–53.[Medline]

Madrona, A.Y. & Wilson, D.K. (2004) The structure of Ski8p, a protein regulating mRNA degradation: implications for WD protein structure. Protein Sci. 13, 1557–1565.[CrossRef][Medline]

Masison, D.C., Blanc, A., Ribas, J.C., Carroll, K., Sonenberg, N. & Wickner, R.B. (1995) Decoying the cap-mRNA degradation system by a double-stranded RNA virus and poly(A)-mRNA surveillance by a yeast antiviral system. Mol. Cell. Biol. 15, 2763–2771.[Abstract/Free Full Text]

Mercier, R., Jolivet, S., Vezon, D., et al. (2005) Two meiotic crossover classes cohabit in Arabidopsis: one is dependent on MER3, whereas the other one is not. Curr. Biol. 15, 692–701.[CrossRef][Medline]

Motamayor, J.C., Vezon, D., Bajon, C., et al. (2000) Switch (swi1), an Arabidopsis thaliana mutant affected in the female meiotic switch. Sex. Plant Reprod. 12, 209–218.[CrossRef]

Nilsson, J., Sengupta, J., Frank, J. & Nissen, P. (2004) Regulation of eukaryotic translation by the RACK1 protein: a platform for signalling molecules on the ribosome. EMBO Rep. 5, 1137–1141.[CrossRef][Medline]

Ross, K.J., Fransz, P. & Jones, G.H. (1996) A light microscopic atlas of meiosis in Arabidopsis thaliana. Chromosome Res. 4, 507–516.[CrossRef][Medline]

Sanchez Moran, E., Armstrong, S.J., Santos, J.L., Franklin, F.C.H. & Jones, G.H. (2001) Chiasma formation in Arabidopsis thaliana accession Wassileskija and in two meiotic mutants. Chromosome Res. 9, 121–128.[CrossRef][Medline]

Smith, T.F., Gaitatzes, C., Saxena, K. & Neer, E.J. (1999) The WD repeat: a common architecture for diverse functions. Trends Biochem. Sci. 24, 181–185.[CrossRef][Medline]

Tesse, S., Storlazzi, A., Kleckner, N., Gargano, S. & Zickler, D. (2003) Localization and roles of Ski8p protein in Sordaria meiosis and delineation of three mechanistically distinct steps of meiotic homolog juxtaposition. Proc. Natl. Acad. Sci. USA 100, 12865–12870.[Abstract/Free Full Text]

Wysocka, J., Swigut, T., Milne, T.A., et al. (2005) WDR5 associates with histone H3 methylated at K4 and is essential for H3, K4 methylation and vertebrate development. Cell 121, 859–872.[CrossRef][Medline]

Yamamoto, T., Poon, D., Weil, P.A. & Horikoshi, M. (1997) Molecular genetic elucidation of the tripartite structure of the Schizosaccharomyces pombe 72 kDa TFIID subunit which contains a WD40 structural motif. Genes Cells 2, 245–254.[Abstract]

Zhang, H., Ransom, C., Ludwig, P. & van Nocker, S. (2003) Genetic analysis of early flowering mutants in Arabidopsis defines a class of pleiotropic developmental regulator required for expression of the flowering-time switch flowering locus C. Genetics 164, 347–358.[Abstract/Free Full Text]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Jolivet, S. Articles by Mercier, R. Search for Related Content PubMed PubMed Citation Articles by Jolivet, S. Articles by Mercier, R.