| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institut Jacques Monod, CNRS UMR 7592, Universités Paris 6/Paris 7, Tour 43, 2 place Jussieu, 75251 Paris, cedex 05, France
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
The Drosophila wing imaginal disc provides a powerful model for investigating the pathways that connect growth, proliferation and patterning during development (Neufeld et al. 1998). Genes of the E2F family are the main regulators of proliferation and cell cycle control (Harbour & Dean 2000). The binding of dE2F1 to the DP subunit provides a heterodimeric transcription factor whose target genes ensure the G1/S transition (Ohtani & Nevins 1994; Duronio et al. 1995). During the G1 phase, expression of these genes is repressed by the binding of the RBF-related pocket proteins (Retinoblastoma Family) to dE2F1. At late G1, RBF phosphorylation by Cyclin-CDK complexes releases free dE2F1-DP which up-regulates genes involved in the DNA replication machinery as well as cell cycle progression (Du et al. 1996). In Drosophila, the Cyclin-dependent Kinase Inhibitor (CKI) dacapo (dap, a p21CIP1 homolog) inhibits the core cell cycle machinery through the binding and down-regulation of Cyclin-CDK enzymatic activities. This restriction of the G1/S transition often accompanies the switch from proliferation to differentiation (Lane et al. 1996; de Nooij et al. 1996). Recently, reports identified respective feedback regulations involving dE2F1 and dap expression that prevent unbalanced cell cycle progression (Reis & Edgar 2004).
The Drosophila wing originates during embryogenesis from a primordium of cells that proliferate rapidly and homogeneously until the end of the third instar. Growth of the wing disc is patterned by the establishment of Anterior/Posterior (A/P) and Dorsal/Ventral (D/V) compartments that define the two axes of the wing (Blair 1995).
The vestigial (vg) gene is one of the main targets defined by these two axes. vg encodes a nuclear protein expressed in the wing presumptive region (wing pouch) of the imaginal disc (Williams et al. 1991). All vg homozygous mutants are characterized by a wing phenotype and heterozygotes display nicks in the wings with a weak penetrance (Goux & Paillard 1976). A complete absence of wing structures is observed in vgnull homozygotes (Paumard-Rigal et al. 1998; Zider et al. 1998). During larval development, vg expression in the wing disc relies on the sequential activation of two intronic enhancers. The boundary enhancer (vgBE) is activated at mid-second larval instar and mediates the transcription of vg, at the D/V boundary, under the direct control of the Notch (N) pathway. At the beginning of third instar, the quadrant enhancer (vgQE) directs vg expression in the remainder of the wing pouch. Thus, vg integrates inputs from the two axes that control patterned wing development (Williams et al. 1994; Kim et al. 1996).
In the wing pouch, the VG and Scalloped (SD) proteins co-localize and interact molecularly. The VG–SD dimer is a functional transcription factor, in which VG provides the transcription activator function, while SD binds DNA via its Transcriptional Enhancer Activator (TEA) domain (Halder et al. 1998; Simmonds et al. 1998; Vaudin et al. 1999).
Previous results have suggested that VG–SD is required for wing growth and cell proliferation (Martin-Castellanos & Edgar 2002; Kolzer et al. 2003). vgnull cell clones do not proliferate in the wing pouch and ectopic expression of vg in other imaginal discs induces ectopic proliferation of wing tissue (Kim et al. 1996). Moreover, vg induces cell cycle progression from G1 to S and G2 to M phases, through the activation of key genes involved in proliferation, such as dE2F1 and the G2/M transition regulator string (yeast cdc25 homolog) (Delanoue et al. 2004). Since VG–SD controls cell proliferation and growth of the wing, we tested the hypothesis that feedback loops link cell cycle genes to the VG–SD dimer. Such homeostatic regulations would, in turn, ensure correct growth and proliferation. To address this issue, we assessed the possible effect of two proliferation regulators, dE2F1 and the antagonist dap, on the regulation of VG–SD activity. In this study, the critical requirement for exquisite VG/SD stoichiometry regulation is confirmed. In addition, our results demonstrate that respective expressions of vg and sd, as well as VG–SD activity, are finely tuned according to feedback loops that connect cell cycle genes and the VG–SD dimer in vivo.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
vg and sd mutants display strong wing mutant phenotypes (Fig. 1A) and VG–SD dimerization is required for normal wing formation. Moreover, ectopic vg induces sd expression (Halder et al. 1998; Simmonds et al. 1998). In addition, SD DNA target selectivity is modified in vitro when VG is dimerized with SD (Halder & Carroll 2001), suggesting that an unbalanced VG/SD ratio would significantly modify the expression of VG–SD targets. Previous results have shown that sd over-expression is deleterious for endogenous wing growth (Simmonds et al. 1998). Therefore, to understand the physiological relevance of the VG/SD ratio during development, it was important to evaluate the effect of VG/SD imbalance on wing growth and development, by using both mutants and over-expression of vg or sd.
|
Cell cycles genes regulate VG–SD transcriptional activity
In the wing disc, wing pouch growth is known to be a highly homeostatic process (de la Cova et al. 2004; Reis & Edgar 2004). The ability of VG–SD to drive proliferation and cell cycle progression largely relies on the regulation of dE2F1 and its target genes by the dimer (Delanoue et al. 2004). So far, however, the effects of cell cycle regulators on VG–SD activity in feedback loops have not been investigated. To assess the potential action of cell cycle genes on the VG–SD dimer, we tested the effect of reducing the dosage of two antagonist regulators, dE2F1 and dap, on the dimer, using a VG–SD transcriptional activity reporter strain (Fig. 2). This strain contains a sensor transgene, "hsp70-GAL4db-sd", in which the sd TEA DNA binding domain has been replaced by the GAL4 DNA binding domain. After a heat shock, a UAS-LacZ reporter gene is expressed only where SD::GAL4 dimerizes with a transcriptional coactivator (e.g. VG) (Vaudin et al. 1999). This strain thus provides a sensitive tool for observing VG–SD activity in the wing pouch. As a first positive test, we evaluated the effect of a VG decrease on VG–SD activity. Indeed, in vgnull/+ wing discs, a significant down-regulation of the VG–SD activity reporter construct was observed compared to control (Fig. 2A,B); vg is therefore not fully haplo-sufficient. In addition, we performed quantitative real time RT-PCR experiments and measured vg and sd transcript expression in vgnull heterozygous wing discs (Fig. 2E). Compared to the w1118 control strain (vg and sd arbitrary levels = 1), we observed a significant decrease in the amount of vg (0.38 ± 0.05), whereas the level of sd remained comparable to that in the wild-type strain (0.96 ± 0.07), leading to a decrease in the vg/sd ratio. The diminution of the dimer activity observed (Fig. 2B) is therefore likely due to competition between the SD::GAL4 chimeric construct and endogenous SD for a lower amount of the available VG transcriptional activator. Conversely, in a sd1/+ heterozygote background, VG–SD activity was greater than that in the control, probably due to a lower quantity of endogenous SD protein for the same amount of VG and SD::GAL4 protein (data not shown). This is in agreement with the hypothesis that a precise VG/SD stoichiometry is required during wing development.
|
Since DAP is an inhibitor of cell cycle progression, the level of VG–SD sensor activity was also assessed in heterozygotes for the dap04454 amorph allele (de Nooij et al. 1996). Although no significant modulation of VG–SD activity could be detected (Fig. 2A,D), RT-PCR experiments revealed a strong decrease in both vg (0.44 ± 0.01) and sd (0.36 ± 0.07) expression levels compared to control. Thus, dap is required for normal vg and sd expression. Despite the reduced vg and sd levels, the vg/sd ratio remained similar to the control in this case (Fig. 2E), and VG–SD activity was thus unmodified. Therefore, to some extent, the vg/sd ratio, rather than absolute expression levels of vg and sd, directs the reporter strain and VG–SD activities. Moreover, genetic interactions showed that both VG–SD activity and a normal vg/sd ratio were greatly restored, in the dE2F191/+; dap04454/+, double heterozygotes (data not shown). Our results demonstrate that cell cycle gene down-expression modulates expression of vg and sd and VG–SD activity. Moreover, dap and dE2F1 loss of function display opposite effects on VG–SD activity and, strikingly, on sd expression. As a whole, this sheds light on a process of feedback regulation between cell cycle regulators and VG–SD.
Ectopic dap induces sd and disrupts VG–SD activity
We next investigated whether the modulation of the respective expressions of vg and sd by cell cycle genes affects the regulation of wing disc growth and cell proliferation. We observed the strong requirement of dap for both vg and sd normal expression (see above and Fig. 2). The next step was to test how dap intervenes in the process. The role of DAP protein in G1 arrest has been clearly demonstrated in Drosophila and dap ectopic expression induces cell cycle arrest without triggering apoptosis (Lane et al. 1996; Van de Bor et al. 1999). dap over-expression along the wing D/V boundary decreases proliferation and induces nicks at the wing margin (Delanoue et al. 2004). Accordingly, using the patched-GAL4 (ptc-GAL4) driver, we found that ectopic dap restricts G1/S transition in BrdU pulse experiments (Fig. 3D), and decreases the number of ptc-expressing cells in the wing disc (Fig. 3A,C), and the adult wing blade (Fig. 3B,C).
|
|
We hypothesized that, if dap slows down proliferation by inducing sd, thus decreasing the VG/SD ratio, this might result in a wing phenotype that should be strengthened by further VG reduction. We tested this hypothesis by over-expressing dap at the margin (vg-GAL4 driver) of wild-type and vgnull/+ wings. As expected, nicks were observed in a wild type context (Fig. 4A) and this phenotype was greatly enhanced in vg heterozygotes (Fig. 4B) suggesting that dap inhibits cell proliferation through impairment of VG/SD. Next, we tested the fate of cut (ct) at the D/V boundary of the disc as an assay of a VG–SD downstream target gene (Fig. 3G) (Guss et al. 2001). CT expression was specifically lost in cells in which sd was induced in response to dap (Fig. 3H). Both ct and wingless (wg) are also D/V-specific N targets. Nevertheless, wg remained unaffected, suggesting that dap does not affect the N pathway. We concluded that dap over-expression leads to sd induction, VG–SD dimer imbalance and impairment of its function in wing development.
|
The results we obtained with dap led us to test whether dE2F1, which is required for VG–SD normal activity and antagonizes DAP, could possibly restore wing growth in a vg83b27mutant that displays no wing structures (Fig. 1A). This mutant carries a complete deletion of the vg 2nd intron that spans the vgBE enhancer required for vg expression in the wing pouch, the remainder of the vg sequence being normal (Williams et al. 1994).
Ectopic expression of both dE2F1-DP and P35, a caspase inhibitor that prevents E2F-induced apoptosis (Neufeld et al. 1998), was monitored in a vg83b27 mutant, using the vg-GAL4 driver that allowed the recovery of adults flies. dE2F1-DP expression restored growth of vg83b27 wing appendages, which often displayed distinct veins and margin (compare Fig. 5B insets and 1A). Neither the expression of P35 itself nor that of dIAP1, another caspase inhibitor, was sufficient to rescue the vg83b27 phenotype (Van de Bor et al. 1999). Consistently, dE2F1-DP induced a massive over-growth of the vg83b27 wing pouch (Fig. 5C,D) that was associated with significant proliferation. Nevertheless, in vgnull mutants for which the entire vg sequence is deleted, no such phenotypic rescue could be detected, and dE2F1-DP led to only a slight increase in hinge growth (compare Figs 1A and 5A,B). This vgnull wing phenotype was rescued by vg-GAL4 driven expression of vg as expected (data not shown). Therefore, we concluded that the partial wing rescue of the vg83b27 mutant (but not of the vgnull mutant) by dE2F1-DP, required the vg sequence but not the vgBE enhancer.
|
In addition, using the sdETX4 enhancer trap, we found that ectopic dE2F1-DP also induced sd expression in the wing pouch (Fig. 5C,G). Given the role of VG–SD in cell proliferation (Delanoue et al. 2004), this up-regulation of expression of both vg and sd is consistent with the wing growth rescue induced by dE2F1. Therefore, we tested again the expression of CT, the dimer target, upon dE2F induction, as a read-out of the dimer activity. In the vg83b27 mutant, no CT expression was observed at the D/V boundary (Fig. 5E). When dE2F1-DP was over-expressed, CT was induced in the wing pouch, although in a different pattern than in a wild-type disc (Fig. 3G). In addition, we often observed ectopic proliferating wing pouches that partly matched the wing marker CT, although these morphogenetic events might not give rise to viable rescued adults (Fig. 5H).
We concluded that vg-GAL4 driven dE2F1-DP-P35 ectopic expression, in a vg83b27 mutant, rescues vg/sd expression and VG–SD activity, which allow pouch cell proliferation and wing growth. All together, our results show that not only dE2F1 is required for normal VG–SD activity in a vg+ background (Fig. 2), but that ectopic dE2F1 rescues VG–SD activity in a vg hypomorphic context.
Ectopic dE2F1 modulates sd expression in a homeostatic feedback loop
It has been shown that VG–SD induces dE2F1 (Delanoue et al. 2004) and here, we observed that dE2F1 can also induce VG–SD activity in a vg hypomorphic genetic context. Such a positive feedback loop might trigger uncontrolled wing pouch growth in a wild type context. So, since wing growth is known to proceed homeostatically, a compensatory mechanism must exist. To address this possibility, we assayed the effects of over-expressing dE2F1-DP +P35 driven by ptc-GAL4, in vg+ wing discs. dE2F1 induced folding of the epithelium layer and sd ectopic expression along the A/P boundary but mainly in the wing pouch (Fig. 6A',B',C'), without any obvious effect on VG expression in vg+ discs (Fig. 6A,B), unlike previous observations in the vg83b27 mutant. The P35 protein per se had no effect. Moreover, dE2F1 over-expression with the vg-GAL4 driver, which allowed the recovery of adult flies, yielded nicks in the wings (Fig. 4C). These results demonstrate that dE2F1 over-expression induces sd and decreases the VG/SD ratio, which most probably impairs the dimer function in wing development. Thus, an excess of ectopic dE2F1 in vg+ discs is deleterious for wing development (Fig. 4C), whereas in a vg83b27 mutant it rescues wing growth (Fig. 5B).
Next, to further understand how this cross-talk depends on the vg genetic context, we compared the response to dE2F1 expression in vg+ or vgnull/+. In this latter genotype, which provided an intermediate vg expression level (see Fig. 2), sd is less induced by dE2F1 than in vg+ discs (data not shown). This shows that a decrease in VG modifies the effect of ectopic dE2F1 on sd. Consistently, wing nicks induced by dE2F1 over-expression according to the vg-GAL4 driver (Fig. 4C) were partially rescued in a vgnull/+ heterozygote (Fig. 4D). Therefore, a decrease in VG attenuates the deleterious effect of over-expressed dE2F1.
Interestingly, even if in a vg+ background expression of both dap and dE2F1 alters wing development (Fig. 4A,C), clear opposite behaviors are observed in vgnull/+ flies where the dap induced phenotype is enhanced, while dE2F1 one is partially rescued (Fig. 4B,D). We concluded that sd induction and VG–SD impairment in response to dE2F1 expression are clearly dependent on the VG expression level.
These results favor the hypothesis that sensor regulations coordinate VG–SD and cell proliferation effectors like dE2F1, and tend to ensure normal wing development. Our data suggest that in vivo, moderate excess in the proliferation regulator dE2F1 decreases VG–SD activity in a negative feedback loop. This may reflect a homeostatic regulation of wing growth.
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
VG/SD ratio and wing growth
Modulation of the relative expression levels of vg and sd as an endogenous means of fine-tuning wing growth, had previously been suggested (Simmonds et al. 1998). Combined loss and gain of function experiments ascertained the requirement of a precise VG/SD ratio for normal wing development and showed that an excess in SD disrupts VG–SD function in wing growth (Fig. 1), and probably acts as a dominant-negative through titration of functional VG–SD dimers. Therefore, sd induction may efficiently restrain VG–SD function in vivo, and a similar effect may also be physiologically achieved down-regulating vg. Moreover, since SD DNA target selectivity is modified upon binding of VG to SD in vitro (Halder & Carroll 2001), we cannot discard the hypothesis that, in vivo too, VG–SD targets might be different from the targets of SD alone. This could explain to some extent the phenotypes observed when sd is induced.
dap induces sd and impairs VG–SD activity
Our results show that the CKI member DAP, homogeneously expressed in the wing disc (Reis & Edgar 2004), regulates VG–SD function. dap heterozygotes display a wild type wing phenotype, reduced levels of both vg and sd transcripts, but an almost normal vg/sd ratio, thus VG–SD activity is normal (Fig. 2). Consistently, no abnormal wing phenotype could be detected. Therefore, the relative vg/sd stoichiometry, rather than absolute vg and sd expression levels, determines wing growth. Interestingly, it had been previously observed that dap homozygous mutant adult escapers display duplication of the wing margin (Lane et al. 1996), indicating a role of DAP at the D/V boundary. This phenotype could be linked to an enhanced proliferation due to the absence of CKI function. Moreover, D/V-specific over-expression of dap alters wing margin structures (Van de Bor et al. 1999). This dap over-expression triggers both ectopic expression of sd and subsequent impairment of VG–SD activity associated with a proliferation decrease (Fig. 3).The associated wing phenotype is clearly enhanced in vg heterozygous flies (Fig. 4), providing evidence that dap over-expression affects VG/SD stoichiometry and represses VG–SD activity in wing development. This reveals a model in which, in the wing pouch, cell proliferation down-regulation through cyclin/CDK inhibition by DAP, may be enhanced by an additive reduction of VG–SD proliferation function. Such a mechanism probably participates in vivo in the control of balanced wing growth.
dE2F1 over-expression in different vg backgrounds
Our results also demonstrate that dE2F1-DP regulates VG–SD: the dE2F1 heterozygote displays a reduced vg/sd ratio due to a decrease in vg and an increase in sd transcripts, associated with reduced dimer activity, comparable to the vgnull/+ context (Fig. 2). Thus, dE2F1 is required for vg normal expression. This supports the hypothesis that the slower proliferation observed in these contexts is linked to an imbalance in the dimer ratio.
Conversely, over-expressing dE2F1-DP-P35, in a vg83b27 hypomorphic mutant context, rescued expression of both vg and sd and normal VG–SD function, wing appendage specification and growth (Fig. 5). This was not observed in vgnull flies implying the necessity for vg sequences, but the second intron, missing in the vg83b27 mutant (Williams et al. 1994). In addition, we ascertained that not all the genes triggering cell cycle progression or cell proliferation can induce vg expression. Neither ectopic expression of CYC E, which promotes dE2F1-induced G1/S cell cycle transition, nor the growth regulator Insulin receptor (InR) was sufficient to elicit VG expression and wing growth in the vg83b27 mutant (data not shown). These results demonstrate that vg induction is a prerequisite for vg83b27 wing pouch growth in response to dE2F1 activity.
In a vg+ genetic background, dE2F1 over-expression induced only sd, disrupting VG/SD stoichiometry (Fig. 6). Consistently, at the D/V boundary, wing notching was observed (Fig. 4). Therefore, although dE2F1 basically displays a positive role in proliferation, this sd induction in response to dE2F1 over-expression was clearly associated with wing growth impairment. This effect was significantly weaker in a vg heterozygote background (Fig. 4), and a rescue of the wing phenotype was observed, supporting the hypothesis that VG/SD stoichiometry is restored. Therefore, sd induction by dE2F1 depends on the vg genetic context. This indicates that the effects of over-expressing dE2F1 differ depending on the growth-state of the wing pouch, which is tightly linked with the vg genotype.
Homeostatic regulations between dE2F1 and VG–SD
Clearly, feedback regulations rule the growth of the wing disc. We have reported regulations in three different vg genetic contexts that can be analyzed in the light of a homeostasis hypothesis. In the vg83b27under-proliferative wing pouch, ectopic dE2F1 expression coordinately increases vg and sd expressions in a positive feedback loop. This triggers VG–SD activity, and induces both cell proliferation and wing specification in the mutant. Conversely, no such crosstalk occurs in a correctly grown vg+ disc, where over-growth should be prevented. In this latter case, sd induction (VG/SD decrease) probably restrains the proliferation function of dE2F1. Consistently, wings were not overgrown, but notches were observed. This phenotype was partially suppressed in a vg heterozygote background. As a whole, these results support the hypothesis that VG–SD/dE2F1 coordination tends to ensure normal wing growth and that the dimer does not trigger unrestricted cell proliferation in a vg+ context, since an excess in dE2F1 attenuates VG–SD function in a negative feedback loop. Thus, molecular interactions between dE2F1, vg and sd, display a clear plasticity depending on the vg genetic context.
Fine-tuning wing cell proliferation
Establishing and maintaining homeostasis is critical during development. This is achieved in part through a balance between cell proliferation and death. In mammals E2F1 and p21, the dacapo homolog, play a key role in this process. In the wing disc compensatory proliferation induced by cell death has been observed (Huh et al. 2004). However, the role of cell cycle genes in this process has not yet been established. How patterns of cell proliferation are generated during development is still unclear. It seems nevertheless likely that the gene responsible for regulating differentiation also regulates proliferation and growth (Skaer 1998). For instance, Hedgehog (HH) induces the expression of Cyclins D and E. This mediates the ability of HH to drive growth and proliferation (Duman-Scheel et al. 2002). In the same way, other data support a direct regulation of dE2F1 by the Caudal homeodomain protein required for anterio-posterior axis formation and gut development (Hwang et al. 2002). Wingless (WG) also displays both patterning and a cell cycle regulator function during Drosophila development (Johnston & Sanders 2003).
Here we show that growth control in the wing pouch seems to be achieved through both positive and negative feedback regulations linking dE2F1 and VG–SD, but also via additive impairment of VG–SD by DAP. In fact, in a vg+ background, over-expression of both dap and dE2F1 induces sd, impairs VG–SD and alters wing development. Nevertheless, clear opposite behaviors are observed in vgnull/+ flies where dap-induced nicks are enhanced, while those of dE2F1 are partially rescued (Fig. 4). This highlights the functional discrepancy between these two types of feedback regulation. We suggest that dap expression inhibits cell proliferation through a process involving both Cyclin-CDK inhibition and VG–SD impairment in the wing pouch. On the other hand, we propose that dE2F1 over-expression triggers a homeostatic response. It will either induce vg and sd to ensure proliferation (in a vg83b27 genotype), or decrease the VG/SD ratio in a vg+ context. In this latter genotype, down-regulation probably counteracts fundamental proliferative properties of dE2F1 and governs homeostatic wing disc growth.
At late third instar, wing discs display a Zone of Non-proliferating Cells (ZNC) along the wing pouch D/V boundary (O’Brochta & Bryant 1985). It has been shown that, although dE2F1-DP is expressed in this area, its proliferative function is inactivated late, because of RBF1-induced G1 arrest (Johnston & Edgar 1998; Duman-Scheel et al. 2004). Accordingly, although expression of vg and sd presents a peak at the D/V boundary, in late third instar, VG–SD activity is decreased in D/V cells, and it was suggested to result from an excess of SD (Vaudin et al. 1999). Therefore, the ZNC setting may also reflect a VG–SD/dE2F1 coordinated dialogue that triggers a decrease in proliferation signals in this area.
Previous studies of homeostatic control of cell proliferation in the wing reported that, to some extent, over-expression of positive or negative cell cycle regulators only weakly affects the overall division rate (Reis & Edgar 2004). For instance, although dap over-expression alters dE2F1 function in G1-S cell cycle transition, it also promotes dE2F1 expression and function in G2-M transition, preventing a decrease in the overall rate of cell division. Strikingly, the cells seemed able to monitor each phase length and maintain cell cycle duration and normal proliferation in the wing pouch of the disc. Therefore, dE2F1 is a central component that enables cells to ensure normal proliferation in the wing disc and prevents imbalance in the process (Reis & Edgar 2004). The fact that dE2F1 triggers quite different or opposite responses in vg+ or vg hypomorphic contexts suggests that the VG–SD/dE2F1 crosstalk plays a role in the same sort of homeostatic process that ensures entire wing growth.
We believe that such regulations are likely to reveal a precise physiological fine-tuning of vg and sd by cell cycle effectors, promoting an exquisite control of wing growth. Feedback loops between the developmental selector VG–SD and cell cycle effectors may stand for a control mechanism to guarantee that the tissue can sustain balanced growth and a reproducible size. Such a subtle mechanism, on a local scale, would correct the alterations in cell proliferation that may occur during development.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
The following strains were used: vgnull and UAS-vg (Paumard-Rigal et al. 1998; Zider et al. 1998), vg-GAL4 (gift from S. Carroll), vg83b27 (gift from J. Bell) vgBE-LacZ and vgQE-LacZ (Kim et al. 1996; Williams et al. 1994), sd58 and the sdETX4 P[LacZ] enhancer trap mutant that do not display any wing phenotype in the heterozygous state (Campbell et al. 1992), UAS-sd (Varadarajan & VijayRaghavan 1999), dE2F191 (Duronio et al. 1996), UAS-E2F1, UAS-DP, UAS-P35 (Neufeld et al. 1998), dap04454 (de Nooij et al. 1996), UAS-dap (Lane et al. 1996), hsp-GAL4db-sd (Vaudin et al. 1999). Heat shocks (38 °C, 30 min) were performed 36 h before puparium formation and wing discs were stained 24 h after the heat shock. All other stocks come from the Bloomington Drosophila Stock center (Indiana University).
Scanning electron microscopy (SEM)
Adult flies were anesthetized with ethyl acetate (Sigma), mounted on stages and covered with a 40 nm layer of gold salts. Preparations were observed under a JEOL JSM 6100 Scanning Electron Microscope. Images were acquired using Genesis software.
Histology
Images were acquired with a DMR (Leica) microscope and processed with Adobe Photoshop. 5-Bromo-2'-deoxyuridine (BrdU) and 4'-6-Diamidino-2-phenylindole (DAPI) labeling of imaginal discs were performed as described (Delanoue et al. 2004). Antibody staining: rabbit anti-phospho-Histone H3 antibody (Upstate Biotechnology), anti-VG (gift from S. Carroll), anti-DAP (gift from C. Lehner) anti-ßgalactosidase (Biodesign) antibodies, and mouse anti-ßgalactosidase (Jackson Immuno Laboratories), anti-CT (Developmental Studies Hybridoma Bank (DSHB), University of Iowa) antibodies. We assessed the activity of the VG–SD transcriptional reporter strain 5 times independently, using both anti-ßgalactosidase antibodies or the X-gal enzymatic reaction.
Quantitative real time RT-PCR
Total RNA of 20 wing discs from third instar larvae was isolated by using tri reagent (Molecular Research Center Inc.) according to the manufacturer's instructions. One microgram of RNA was used for reverse transcription into cDNA according to the supplier's instructions (Roche). Real time PCR was conducted in a Light Cycler (Roche) with 45 cycles (15 s, 95 °C; 15 s, 60 °C for vg, RP49, 65 °C for sd; 15 s, 72 °C) 1 µL cDNA, and PCR reaction mix from Roche. The following primers were used for amplification: sd: aatattgcaagtaatgagggccc/gacggtataatgtgatgggtggtg; RP49: ccgcttcaagggacagtatctg/cacgttgtgcaccaggaactt; vg: cggcccactatggttcctatg/agcctgaggagactgccgtact. Differences in cDNA concentrations were adjusted by normalizing to RP49. For each gene, values were averaged over at least three independent measurements. The expression levels were calculated relative to the wild-type genotype (w1118) (the expression in this genotype was set to 1). Two independent RNA isolation experiments were performed for all genotypes and means were calculated.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Communicated by: Claude Desplan * Correspondence: E-mail: silber{at}ccr.jussieu.fr
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Campbell, S., Inamdar, M., Rodrigues, V., Raghavan, V., Palazzolo, M. & Chovnick, A. (1992) The scalloped gene encodes a novel, evolutionarily conserved transcription factor required for sensory organ differentiation in Drosophila. Genes Dev.
6, 367–379.
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. & Johnston, L.A. (2004) Drosophila myc regulates organ size by inducing cell competition. Cell 117, 107–116.[CrossRef][Medline]
Delanoue, R., Legent, K., Godefroy, N., et al. (2004) The Drosophila wing differentiation factor Vestigial-Scalloped is required for cell proliferation and cell survival at the dorso–ventral boundary of the wing imaginal disc. Cell Death. Differ. 11, 110–122.[CrossRef][Medline]
Dimova, D.K., Stevaux, O., Frolov, M.V. & Dyson, N.J. (2003) Cell cycle-dependent and cell cycle-independent control of transcription by the Drosophila E2F/RB pathway. Genes Dev
17, 2308–2320.
Du, W., Vidal, M., Xie, J.E. & Dyson, N. (1996) RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev.
10, 1206–1218.
Duman-Scheel, M., Du Johnston, L.A., Weng, L. & Du Xin, S.W. (2002) Hedgehog regulates cell growth and proliferation by inducing Cyclin D and Cyclin E. Nature 417, 299–304.[CrossRef][Medline]
Duman-Scheel, M., Johnston, L.A. & Du, W. (2004) Repression of dMyc expression by Wingless promotes Rbf-induced G1 arrest in the presumptive Drosophila wing margin. Proc. Natl. Acad. Sci. USA
101, 3857–3862.
Duronio, R.J., Brook, A., Dyson, N. & O’Farrell, P.H. (1996) E2F-induced S phase requires cyclin E. Genes Dev.
10, 2505–2513.
Duronio, R.J., O’Farrell, P.H., Xie, J.E., Brook, A. & Dyson, N. (1995) The transcription factor E2F is required for S phase during Drosophila embryogenesis. Genes Dev.
9, 1445–1455.
Goux, J.M. & Paillard, M. (1976) Incomplete penetrance at the vestigal locus of Drosophila. C. R. Hebd. Seances Acad. Sci. D 283, 667–669.
Guss, K.A., Nelson, C.E., Hudson, A., Kraus, M.E. & Carroll, S.B. (2001) Control of a genetic regulatory network by a selector gene. Science
292, 1164–1167.
Halder, G. & Carroll, S.B. (2001) Binding of the Vestigial co-factor switches the DNA-target selectivity of the Scalloped selector protein. Development
128, 3295–3305.
Halder, G., Polaczyk, P., Kraus, M.E., et al. (1998) The Vestigial and Scalloped proteins act together to directly regulate wing-specific gene expression in Drosophila. Genes Dev.
12, 3900–3909.
Harbour, J.W. & Dean, D.C. (2000) The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev.
14, 2393–2409.
Huh, J.R., Guo, M. & Hay, B.A. (2004) Compensatory proliferation induced by cell death in the Drosophila wing disc requires activity of the apical cell death caspase Dronc in a nonapoptotic role. Curr. Biol. 14, 1262–1266.[CrossRef][Medline]
Hwang, M.S., Kim, Y.S., Choi, N.H., et al. (2002) The caudal homeodomain protein activates Drosophila E2F gene expression. Nucleic Acids Res.
30, 5029–5035.
Johnston, L.A. & Edgar, B.A. (1998) Wingless and Notch regulate cell-cycle arrest in the developing Drosophila wing. Nature 394, 82–84.[CrossRef][Medline]
Johnston, L.A. & Sanders, A.L. (2003) Wingless promotes cell survival but constrains growth during Drosophila wing development. Nat. Cell Biol. 5, 827–833.[CrossRef][Medline]
Kim, J., Sebring, A., Esch, J.J., et al. (1996) Integration of positional signals and regulation of wing formation and identity by Drosophila vestigial gene. Nature 382, 133–138.[CrossRef][Medline]
Kolzer, S., Fuss, B., Hoch, M. & Klein, T. (2003) defective proventriculus is required for pattern formation along the proximodistal axis, cell proliferation and formation of veins in the Drosophila wing. Development
130, 4135–4147.
Lane, M.E., Sauer, K., Wallace, K., Jan, Y.N., Lehner, C.F. & Vaessin, H. (1996) Dacapo, a cyclin-dependent kinase inhibitor, stops cell proliferation during Drosophila development. Cell 87, 1225–1235.[CrossRef][Medline]
Martin-Castellanos, C. & Edgar, B.A. (2002) A characterization of the effects of Dpp signaling on cell growth and proliferation in the Drosophila wing. Development 129, 1003–1013.
Muller, H., Bracken, A.P., Vernell, R., et al. (2001) E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis. Genes Dev
15, 267–285.
Neufeld, T.P., de la Cruz, A.F., Johnston, L.A. & Edgar, B.A. (1998) Coordination of growth and cell division in the Drosophila wing. Cell 93, 1183–1193.[CrossRef][Medline]
de Nooij, J.C., Letendre, M.A. & Hariharan, I.K. (1996) A cyclin-dependent kinase inhibitor, Dacapo, is necessary for timely exit from the cell cycle during Drosophila embryogenesis. Cell 87, 1237–1247.[CrossRef][Medline]
O’Brochta, D.A. & Bryant, P.J. (1985) A zone of non-proliferating cells at a lineage restriction boundary in Drosophila. Nature 313, 138–141.[CrossRef][Medline]
Ohtani, K. & Nevins, J.R. (1994) Functional properties of a Drosophila homolog of the E2F1 gene. Mol. Cell. Biol.
14, 1603–1612.
Paumard-Rigal, S., Zider, A., Vaudin, P. & Silber, J. (1998) Specific interactions between vestigial and scalloped are required to promote wing tissue proliferation in Drosophila melanogaster. Dev. Genes Evol. 208, 440–446.[CrossRef][Medline]
Reis, T. & Edgar, B.A. (2004) Negative regulation of dE2F1 by cyclin-dependent kinases controls cell cycle timing. Cell 117, 253–264.[CrossRef][Medline]
Simmonds, A.J., Liu, X., Soanes, K.H., Krause, H.M., Irvine, K.D. & Bell, J.B. (1998) Molecular interactions between Vestigial and Scalloped promote wing formation in Drosophila. Genes Dev.
12, 3815–3820.
Skaer, H. (1998) Who pulls the string to pattern cell division in Drosophila? Trends Genet. 14, 337–339.[CrossRef][Medline]
Van de Bor, V., Delanoue, R., Cossard, R. & Silber, J. (1999) Truncated products of the vestigial proliferation gene induce apoptosis. Cell Death Differ. 6, 557–564.[CrossRef][Medline]
Varadarajan, S. & VijayRaghavan, K. (1999) scalloped functions in a regulatory loop with vestigial and wingless to pattern the Drosophila wing. Dev. Genes Evol. 209, 10–17.[CrossRef][Medline]
Vaudin, P., Delanoue, R., Davidson, I., Silber, J. & Zider, A. (1999) TONDU (TDU), a novel human protein related to the product of vestigial (vg) gene of Drosophila melanogaster interacts with vertebrate TEF factors and substitutes for Vg function in wing formation. Development 126, 4807–4816.[Abstract]
Williams, J.A., Bell, J.B. & Carroll, S.B. (1991) Control of Drosophila wing and haltere development by the nuclear vestigial gene product. Genes Dev.
5, 2481–2495.
Williams, J.A., Paddock, S.W., Vorwerk, K. & Carroll, S.B. (1994) Organization of wing formation and induction of a wing-patterning gene at the dorsal/ventral compartment boundary. Nature 368, 299–305.[CrossRef][Medline]
Zider, A., Paumard-Rigal, S., Frouin, I. & Silber, J. (1998) The vestigial gene of Drosophila melanogaster is involved in the formation of the peripheral nervous system: genetic interactions with the scute gene. J. Neurogenet. 12, 87–99.[Medline]
Received: 8 December 2005
Accepted: 10 May 2006
This article has been cited by other articles:
|
|
 |
|
  I. Dworkin, E. Kennerly, D. Tack, J. Hutchinson, J. Brown, J. Mahaffey, and G. Gibson Genomic Consequences of Background Effects on scalloped Mutant Expressivity in the Wing of Drosophila melanogaster Genetics, March 1, 2009; 181(3): 1065 - 1076. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
