HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Seki, T. Articles by Sakai, N. Search for Related Content PubMed PubMed Citation Articles by Seki, T. Articles by Sakai, N.

¹ Department of Molecular and Pharmacological Neuroscience, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima 734–8551, Japan
² Laboratory of Molecular Pharmacology, Biosignal Research Center, Kobe University, Kobe 657-8501, Japan
³ Division of Diabetes, Digestive and Kidney Disease, Department of Clinical Molecular Medicine, Kobe University Graduated School of Medicine, Kobe 650-0017, Japan
⁴ Department of Molecular Pharmacology, Graduate School of Medical Science, Kumamoto University, Kumamoto 860-8556, Japan

	Abstract

Top Abstract Introduction Results Discussion Experimental procedures References

 
To elucidate the role of 3-phosphoinositide-dependent protein kinase-1 (PDK1) in cellular signaling, we constructed and expressed a pseudosubstrate of PDK1, designated as AL-PIF, and characterized its properties in cultured cells. AL-PIF consists of two fused proteins of the protein kinase C (PKC) activation loop (AL) and PDK1-interacting fragment (PIF). The phosphorylation of AL-PIF was detected with anti-PKC phospho-Thr⁵⁰⁵-specific antibody and was increased in proportion to the expression level of co-expressed GST-PDK1, indicating that it acts as a pseudosubstrate of PDK1. In cells expressing AL-PIF, basal phosphorylation level at the activation loop of PKB, PKC and PKC was reduced, compared with that in control cells, suggesting that AL-PIF functions as an inhibitory molecule for PDK1. AL-PIF affected the stability, translocation and endogenous activity of PKCs. These effects of AL-PIF on PKC properties were confirmed by investigation using conditioned PDK1 knockout cells. Furthermore, apoptosis frequently occurred in cells expressing AL-PIF for 3 days. These findings revealed that AL-PIF served as an effective pseudosubstrate and an inhibitory molecule for PDK1, suggesting that this molecule can be used as a tool for investigating PDK-mediated cellular functions as well as being applicable for anti-cancer therapy.

	Introduction

Top Abstract Introduction Results Discussion Experimental procedures References

 
Members of the AGC (cAMP-dependent, cGMP-dependent and protein kinase C) serine/threonine kinase family are important for various signal transduction pathways and regulate many cellular functions, including growth, differentiation and apoptosis. The activities of AGC kinases are regulated by phosphorylation at the activation loop, which commonly exists in the kinase domain of these kinases. 3-Phosphoinositide-dependent protein kinase-1 (PDK1) is an enzyme that phosphorylates the activation loop of many AGC kinases and regulates their activities (Belham et al. 1999; Toker & Newton 2000). PDK1 was first identified as the kinase that phosphorylates the threonine residue at the activation loop (Thr³⁰⁸) of protein kinase B (PKB) in a phosphatidylinositol 3,4,5-triphosphate (PIP₃)-dependent manner, leading to the activation of PKB (Alessi et al. 1997b; Stephens et al. 1998). PIP₃ is produced by the phosphoinositide 3-kinase (PI3K), which is activated by stimulation with growth factors. Therefore, PDK1 is a molecular mediator that links stimulations of growth factors with PKB/Akt activation. Later studies revealed that PDK1 also phosphorylates other AGC kinases, including protein kinase C (PKC) (Le Good et al. 1998), p70 ribosomal S6 protein kinase (S6K) (Pullen et al. 1998), p90 ribosomal S6 kinase (RSK) (Jensen et al. 1999) and serum and glucocorticoid-induced kinase (SGK) (Kobayashi & Cohen 1999). The essential role of PDK1 in activating AGC kinases was further confirmed by studies using mouse embryonic stem (ES) cells lacking PDK1 (Balendran et al. 2000; Williams et al. 2000). Furthermore, Lawlor et al. (2002) demonstrated that mice genetically lacking PDK1 were embryonic lethal, indicating that PDK1 is essential for mouse embryonic development. Additional studies using conditional PDK1 knockout mice have revealed that PDK1 is involved in viability and tolerance to hypoxia of cardiomyocytes (Mora et al. 2003), regulation of glyconeogenesis in the liver (Mora et al. 2005), T cell development in the thymus (Hinton et al. 2004) and glucose uptake in adipocytes (Sakaue et al. 2003). These findings suggest that PDK1 is indispensable for various cellular functions probably via its regulation of AGC kinases.

Among the various PDK1-mediated signaling pathways, the PI3K-PDK1-PKB/Akt pathway is the most intensively investigated. This pathway is activated by various growth factors and is known to regulate various cellular functions such as glucose uptake, glyconeogenesis, protein synthesis, transcription and cell survival (Alessi 2001). Aberrant regulation of PI3K-PDK1-PKB pathway is thought to be involved in oncogenesis (Fresno Vara et al. 2004; Osaki et al. 2004). Indeed, Kim et al. (2003) have recently demonstrated that RET/PTC (rearranged in transformation/papillary thyroid carcinomas) tyrosine kinase, a product from gene rearrangement frequently observed in thyroid cancers, activated PDK1 by directly phosphorylating its tyrosine residue in a PI3K-independent manner. Therefore, PDK1 has been focused on as a target for cancer therapy (Fresno Vara et al. 2004; Osaki et al. 2004).

In contrast to the PI3K-PDK1-PKB pathway, the role of PDK1 in PKC regulation has not been fully elucidated yet. The phosphorylation of PKC activation loop constitutively occurs in a PIP₃-independent manner (Sonnenburg et al. 2001), which is different from the phosphorylation of PKB by PDK1. Furthermore, PDK1-induced phosphorylation at the activation loop does not directly activate PKC but causes the autophosphorylation of two serine/threonine residues (turn and hydrophobic motifs) by PKC and makes PKC catalytically competent (Behn-Krappa & Newton 1999). This catalytically competent PKC is fully activated by a phorbol ester or G_q protein-coupled receptor stimulation. Previous live imaging studies using green fluorescent protein (GFP)-tagged PKC (PKC-GFP) demonstrated that PKCs are translocated to several cellular organelles in a subtype- and stimulation-specific manner when activated by various stimulations (Sakai et al. 1997; Shirai et al. 1998, 2000). Thereafter, PKCs recognize and phosphorylate their target substrates and cause subsequent cellular responses (PKC targeting) (Ohmori et al. 1998, 2000). These findings suggest that the isoform- and stimulation-specific translocation of PKC provides the molecular basis underlying the multiplicity of PKC functions. However, little is known about the role of PDK1 in PKC targeting.

To investigate how PDK1 regulates AGC kinases, including PKC and PKB/Akt, we attempted to determine the properties of these kinases under the condition in which PDK1 function was attenuated. For this purpose, we constructed a pseudosubstrate for PDK1 and over-expressed it in cultured cells as an inhibitory molecule of PDK1. In this report, we present results showing that the pseudosubstrate of PDK1 (AL-PIF) actually inhibited PDK1 activity, affected the stability, kinase activity and targeting mechanism of PKC and PKC and induced apoptosis. We also discuss the experimental benefits and therapeutic utility of this pseudosubstrate.

	Results

Top Abstract Introduction Results Discussion Experimental procedures References

 
Confirmation of AL-PIF as a pseudosubstrate for PDK1

For constructing a pseudosubstrate for PDK1, we considered that the peptide around the activation loop of PKC would be an artificial substrate for PDK1. Furthermore, Biondi et al. (2000) demonstrated that a PDK1-interacting fragment (PIF), which was derived from the carboxyl terminus of PKC-related kinase-2, interacted with PDK1 with high affinity. In addition, the PDK1-induced phosphorylation of the peptide around the activation loop of PKB (T308tide), a PDK1 substrate, was increased by the attachment of PIF to T308tide. Therefore, in the present study, we constructed AL-PIF, consisting of two pairs of the peptide around the PKC activation loop (AL) and PIF in tandem, as a pseudosubstrate for PDK1 (Fig. 1A).

View larger version (22K): [in this window] [in a new window]   Figure 1  Structures of GFP- or DsRed2-fused proteins. (A) AL-PIF was constructed as a PDK1 pseudosubstrate. AL peptide consists of 20 amino acid residues around the activation loop of PKC. Thr indicates a threonine residue that is phosphorylated by PDK1. PIF (PDK1-interacting fragment) is the carboxyl terminal peptide of PKC-related kinase 2, which can potently bind to PDK1 (Balendran et al. 1999). AL-PIF consists of two pairs of these two fragments, which are connected in tandem. To visualize AL-PIF in living cells, a fluorescent protein, GFP or DsRed2, is additionally fused to its carboxyl terminal. (B) GFP is fused to the carboxyl terminus of PKB, PKC and PKC. Thr indicates the threonine residue at the activation loop, which is phosphorylated by PDK1 (PKB: Thr308, PKC: Thr514, PKC: Thr505). (C) Myristoylated alanine-rich protein kinase C substrate (MARKCS) is a PKC substrate that is localized on the plasma membrane. It binds to the membrane via a myristate chain that is attached to a glycine residue around the amino terminus (Gly2). MARCKS is phosphorylated by PKC at three serine residues (Ser152, Ser156, Ser163) when PKC is activated and translocated to the plasma membrane by various stimulations. MARCKS-G2A is a mutant MARCKS whose Gly2 is replaced with alanine. This mutation makes MARCKS a non-myristoylated form, which is localized in the cytoplasm. MARCKS-G2A is an intracellular substrate that is phosphorylated by constitutive activity of PKC.

View larger version (46K): [in this window] [in a new window]   Figure 2  AL-PIF-GFP was phosphorylated by PDK1 in COS-7 cells. COS-7 cells were transfected with indicated amounts of plasmids and were harvested 2 days after transfection. Upper, middle and lower images show the results of immunoblotting with anti-GFP, anti-PKC phosphor-Thr505 and anti-PDK1 antibodies, respectively. Anti-GFP and anti-PKC phosphor-Thr505 antibodies detected AL-PIF-GFP with a molecular weight of around 40 kDa. Anti-PDK1 antibody detected GST-PDK1 with a molecular weight of around 90 kDa. The extent of AL-PIF-GFP phosphorylation is augmented in accordance with increasing amount of transfected GST-PDK1. The images are representative of three experiments.

Influence of AL-PIF on phosphorylation of the PKB activation loop

Next, we examined whether AL-PIF-GFP over-expression affects PDK1-regulated AGC kinases including PKB or PKC family members. Since it is known that PDK1 enhances phosphorylation of the PKB activation loop at Thr³⁰⁸ after insulin-like growth factor-1 (IGF-1) stimulation (Williams et al. 2000), COS-7 cells expressing PKB-GFP plus GFP (control) or PKB-GFP plus AL-PIF-GFP were treated with 50 ng/mL IGF-1 for 15 min, and amounts of expressed PKB-GFP and phosphorylated PKB-GFP at Thr³⁰⁸ was examined by immunoblotting with anti-GFP and anti-PKB phosphor-Thr³⁰⁸ antibodies, respectively (Fig. 3). Phosphorylation level at Thr³⁰⁸ of PKB-GFP (Fig. 3C) was evaluated by the ratio of the amount of phosphorylated PKB-GFP to that of expressed PKB-GFP. As shown in Fig. 3C, in cells expressing PKB-GFP plus GFP, the phosphorylation level of Thr³⁰⁸ was significantly increased by 15-min treatment with 50 ng/mL IGF-1 (145.3 ± 13.4% of that in non-treated cells). In cells expressing PKB-GFP plus AL-PIF-GFP, the IGF-1-induced enhancement of phosphorylation was not affected by AL-PIF-GFP (145.8 ± 15.7% of that in non-treated cells) (Fig. 3C). However, in cells without IGF-1 treatment, the basal phosphorylation level of Thr³⁰⁸ was significantly decreased by AL-PIF-GFP (68.2 ± 8.4% of that in cells expressing PKB-GFP plus GFP). In all experimental conditions, neither IGF-1 treatment nor expression of AL-PIF-GFP affected the expression level of PKB-GFP (Fig. 3A,B). These results indicate that AL-PIF reduced basal phosphorylation level of PKB-GFP at Thr³⁰⁸ but did not affect either the IGF-1-induced phosphorylation or the expression level of PKB-GFP.

View larger version (32K): [in this window] [in a new window]   Figure 3  AL-PIF-GFP inhibited basal phosphorylation but not IGF-1 (50 ng/mL)-induced phosphorylation of the PKB-GFP activation loop in COS-7 cells. COS-7 cells were transfected with PKB-GFP (10 µg) and GFP/AL-PIF-GFP (10 µg). One day after the transfection, FBS was eliminated from the culture medium. After an additional one day of cultivation, cells were stimulated with IGF-1 (50 ng/mL) for 15 min at 37 °C, immediately followed by cell harvest. The expression of GFP-fused protein and the phosphorylation of PKB-GFP were detected by immunoblotting. (A) Representative immunoblotting images of six experiments with anti-GFP (left) and anti-PKB phosphor-Thr308 (right) antibodies. AL-PIF-GFP was also detected with anti-PKB phosphor-Thr308 antibody (right). The immunoreactive bands around 75 kDa in left image would be the degradation product of PKC-GFP. (B) Relative amount of expressed (left) and Thr308-phosphorylated (right) PKB-GFP was quantified by the intensities of approximately 90-kDa-immunoreactive bands detected with anti-GFP antibody or anti-phosphor-Thr308 antibody, respectively. (C) The phosphorylation level is indicated as the ratio of the amount of phosphorylated PKB-GFP to that of expressed PKB-GFP in each sample. Data are presented as the percentage of the value obtained from cells transfected with PKB-GFP and GFP without IGF-1 treatment (mean ± SEM of six experiments). *P < 0.05, **P < 0.01 vs. non-stimulated cells, #P < 0.05 (unpaired t-test).

Influence of AL-PIF on the properties of PKC and PKC

We examined whether AL-PIF affects the expression and phosphorylation levels of two subtypes of PKC, PKC and PKC. As shown in Fig. 4A,B, as the amount of co-expressed AL-PIF-GFP was increasing, the expression level of PKC-GFP tended to be decreased, although the statistical significance was not obtained. In contrast, AL-PIF-GFP strongly and significantly reduced the phosphorylation at Thr⁵⁰⁵ of PKC-GFP (Fig. 4A,B). When 4 and 8 µg of AL-PIF-GFP plasmid was transfected, the phosphorylation level (the ratio of phosphorylated to expressed PKC-GFP) was reduced to 39.6 ± 3.2% and 32.2 ± 6.1% of that in the absence of AL-PIF-GFP, respectively (Fig. 4C). In the case of PKC-GFP, however, AL-PIF-GFP strongly decreased the amount of expressed PKC-GFP (Fig. 5A). When 4 and 8 µg AL-PIF-GFP plasmid was transfected, the amount was significantly decreased by 21.4 ± 1.9% and 60.1 ± 3.7%, respectively (Fig. 5B). Likewise, the phosphorylation level of PKC-GFP at Thr⁵¹⁴ was decreased by 36.0 ± 3.3% and 58.0 ± 9.6%, respectively (Fig. 5C). These results suggest that AL-PIF strongly inhibited phosphorylation of the PKC and PKC activation loop, while it decreased the expression level of PKC more prominently than that of PKC.

View larger version (29K): [in this window] [in a new window]   Figure 4  AL-PIF-GFP significantly inhibited the phosphorylation at Thr505 of PKC-GFP but not the expression of PKC-GFP in COS-7 cells. COS-7 cells were transfected with a total of 24 µg plasmids (indicated amounts of plasmids plus empty vector) and were harvested 2 days after transfection. The expression of GFP-fused proteins and the phosphorylation of PKC-GFP were detected by immunoblotting. (A) Representative immunoblotting images of four experiments with anti-GFP (left) and anti-PKC phosphor-Thr505 (right) antibodies. AL-PIF-GFP was also detected with anti-PKC phosphor-Thr505 antibody (right). (B) Relative amount of expressed (left) and Thr505-phosphorylated (right) PKC-GFP was quantified by the intensities of approximately 110-kDa-immunoreactive bands detected with anti-GFP antibody and anti-PKC phosphor-Thr505 antibody, respectively. (C) The phosphorylation level is indicated as the ratio of the amount of phosphorylated to expressed PKC-GFP in each sample. Data are presented as the percentage of the value obtained from cells transfected with PKC-GFP alone (mean ± SEM of four experiments). **P < 0.01, ***P < 0.001 vs. PKC-GFP alone (unpaired t-test).

View larger version (31K): [in this window] [in a new window]   Figure 5  AL-PIF-GFP significantly decreased the amount of expressed PKC-GFP as well as the phosphorylation level at Thr514 of PKC-GFP in COS-7 cells. COS-7 cells were transfected with a total of 24 µg plasmids (indicated amounts of plasmids plus empty vector) and were harvested 2 days after transfection. The expression of GFP-fused proteins and the phosphorylation of PKC-GFP were detected by immunoblotting. (A) Representative immunoblotting images of five experiments with anti-GFP (left) and anti-PKC phosphor-Thr514 (right) antibodies. AL-PIF-GFP was also slightly detected with anti-PKC phosphor-Thr514 antibody (right). (B) Relative amount of expressed (left) and Thr514-phosphorylated (right) PKC-GFP was measured by the intensities of approximately 120-kDa-immunoreactive bands detected with anti-GFP antibody and anti-PKC phosphor-Thr514 antibody, respectively. (C) The phosphorylation level is indicated as the ratio of phosphorylated to expressed PKC-GFP in each sample. Data are presented as the percentage of the value obtained from cells transfected with PKC-GFP alone (mean ± SEM of five experiments). **P < 0.01, ***P < 0.001 vs PKC-GFP alone (unpaired t-test).

View larger version (24K): [in this window] [in a new window]   Figure 6  AL-PIF-GFP inhibited endogenous PKC activity. Effect of AL-PIF-GFP on phosphorylation level of non-myristoylated MARCKS mutant (MARCKS-G2A), a substrate of PKC, was examined. MARCKS-G2A-GFP (10 µg) plus AL-PIF-GFP (10 µg) or MARCKS-G2A-GFP (10 µg) plus an empty vector (10 µg) was transfected into COS-7 cells. After 3-day cultivation, the expression of GFP-fused proteins and the phosphorylation of MARCKS-G2A-GFP were detected by immunoblotting. (A) Representative immunoblotting images of four experiments with anti-GFP (left) and anti-phospho-MARCKS (right) antibodies. The immunoreactive bands around 60 kDa in right image were considered to be nonspecific band since endogenous MARCKS would be detected around 80 kDa. (B) Relative amount of expressed (left) and phosphorylated (right) MARCKS-G2A-GFP was quantified by the intensities of approximately 140-kDa-immunoreactive bands detected with anti-GFP antibody and anti-phospho-MARCKS antibody, respectively. (C) The phosphorylation level is indicated as the ratio of phosphorylated to expressed MARCKS-G2A-GFP in each sample. Data are presented as the percentage of the value obtained from cells transfected with MARCKS-G2A-GFP alone (mean ± SEM of five experiments). *P < 0.05, ***P < 0.001 vs. MARCKS-G2A-GFP alone (unpaired t-test).

View larger version (26K): [in this window] [in a new window]   Figure 7  ATP (1 mM)-induced translocation of PKC-GFP co-expressed with (A) DsRed2 and (B) AL-PIF-DsRed2 in CHO cells. CHO cells were transfected with 0.5 µg of a plasmid encoding PKC-GFP together with 2 µg of a plasmid encoding (A) DsRed2 or (B) AL-PIF-DsRed2 and cultured for 2 days on a 3.5-cm-diameter glass-bottom dish. ATP was used as an agonist for endogenous P2Y receptor in CHO cells. Sequential fluorescence images of GFP- and DsRed2-fusion protein in response to 1 mM ATP were monitored for 5 min using a confocal laser microscope. Images before (pre) and 0.5, 1, 1.5, 2 and 3 min after ATP stimulation are shown. In DsRed2-expressed cells, PKC-GFP completely returned to the cytoplasm 1 min after ATP treatment, while it was still retained at the plasma membrane in cells expressing AL-PIF-DsRed2. Images are representative of at least 5 experiments. Bar = 10 µm.

View larger version (33K): [in this window] [in a new window]   Figure 8  ATP (1 mM)-induced translocation of PKC-GFP co-expressed with (A) DsRed2 and (B) AL-PIF-DsRed2 in CHO cells. CHO cells were transfected with 0.5 µg of a plasmid encoding PKC-GFP together with 2 µg of a plasmid encoding (A) DsRed2 or (B) AL-PIF-DsRed2 and cultured for 2 days on a 3.5-cm-diameter glass-bottom dish. Sequential fluorescence images of GFP- and DsRed2-fusion protein in response to 1 mM ATP were monitored for 5 min using a confocal laser microscope. Images before (pre) and 0.5, 1, 1.5, 2 and 3 min after ATP stimulation are shown. In DsRed2-expressed cells, PKC-GFP completely returned to the cytoplasm 1 min after ATP treatment, while it was still retained at the plasma membrane in cells expressing AL-PIF-DsRed2. Images are representative of at least five experiments. Bar = 10 µm.

Effects of AL-PIF on binding between PKC and PDK1

It has been reported that PDK1 binds to PKC through the carboxyl terminus region of PKC (Gao et al. 2001). We next examined whether AL-PIF influences the interaction between PKC and PDK1. GST-PDK1 was transiently co-expressed with PKC-GFP or PKC-GFP in COS-7 cells. AL-PIF-GFP or GFP was additionally expressed in COS-7 cells expressing GST-PDK1 and PKC-GFP. Interaction between PKC-GFP and GST-PDK1 in cells expressing AL-PIF-GFP was compared with that in cells expressing GFP by GST pull-down assay. In cells expressing GFP (control cells), PKC-GFP and PKC-GFP were precipitated with GST-PDK1 (Fig. 9, lanes 1 and 3). However, in cells expressing AL-PIF-GFP, PKC-GFP and PKC-GFP were not detected in the precipitated sample (Fig. 9, lanes 2 and 4), although AL-PIF-GFP did not affect the expression level of PKC-GFP and PKC-GFP (Fig. 9, lanes 5–8). Instead of PKC-GFP, AL-PIF-GFP was precipitated with GST-PDK1 in these cells (Fig. 9, lanes 2 and 4). These results indicate that AL-PIF competitively prevented the binding between PDK1 and PKC, resulting in reduction of phosphorylation at the PKC activation loop.

View larger version (39K): [in this window] [in a new window]   Figure 9  AL-PIF-GFP disturbed the interaction between PKC and PDK1 in COS-7 cells. COS-7 cells were transfected with combinations of PKC-GFP (10 µg), PKC-GFP (10 µg), GST-PDK1 (10 µg), GFP (10 µg) and AL-PIF-GFP (10 µg) plasmids as indicated in the figure. Transfected cells were harvested 3 days after transfection. To investigate the binding between PKC and PDK1, GST-PDK1 in the cell lysate was pulled down with glutathione-sepharose, followed by immunoblotting with anti-GFP antibody. Lanes 1–4 indicate the results for precipitated samples with glutathione-sepharose. Lanes 5–8 indicate the results for input samples (5% of total lysates). The immunoreactive bands around 75 kDa in lane 7 and 8 would be the degradation product of PKC-GFP. The image is representative of three experiments.

Induction of apoptosis by AL-PIF over-expression

In the present series of studies, we were aware that treatment with AL-PIF for more than 2 days caused cell death. We examined whether the expression of AL-PIF induced apoptosis in COS-7 cells by observing chromatin condensation. Three days after the transfection of AL-PIF-GFP or GFP, cell nuclei were stained with Hoechst33342. Cells with condensed or fragmented nuclei were considered to be apoptotic cells (Fig. 10A, arrows). Most of the COS-7 cells transfected with GFP alone did not have apoptotic nuclei (Fig. 10A, upper), while condensed or fragmented nuclei were frequently observed in cells expressing AL-PIF-GFP alone (Fig. 10A, middle). However, additional expression of GST-PDK1 decreased the frequency of apoptotic cells in cells expressing AL-PIF-GFP (Fig. 10A, lower). We calculated the percentages of apoptotic cells in GFP fluorescing cells (Fig. 10B). In control GFP-expressing cells, 12.7 ± 3.1% of the cells were apoptotic and the extent of apoptosis was not affected by the coexpression of GST-PDK1 (12.1 ± 2.4%). In AL-PIF-GFP-expressing cells, the percentage of apoptotic cells was significantly increased (40.8 ± 3.2%, P < 0.01) compared with the percentage of apoptotic cells expressing GFP alone. This effect of AL-PIF-GFP was significantly reversed by the co-expression of GST-PDK1 (20.6 ± 1.8%, P < 0.01). These results suggest that AL-PIF induced apoptosis by inhibiting the activity of PDK1 in COS-7 cells.

View larger version (20K): [in this window] [in a new window]   Figure 10  AL-PIF-GFP functions as an apoptosis inducer in COS-7 cells. COS-7 cells were transfected with GFP alone (0.5 µg), AL-PIF-GFP alone (0.5 µg) and AL-PIF-GFP (0.5 µg) plus GST-PDK1 (2 µg). Three days after transfection, cells were stained with Hoechst 33342 (50 µg/mL). The fluorescence of GFP and Hoechst 33342 was observed using a confocal laser microscope. Apoptotic cells were evaluated by chromatin condensation and fragmentation of nuclei stained by Hoechst 33342. A, Representative GFP (left) and Hoechst 33342 (right) fluorescence images of cells transfected with GFP alone (upper), AL-PIF-GFP alone (middle) and AL-PIF-GFP plus GST-PDK1 (lower). Arrows in the middle images indicate apoptotic cells having condensed or fragmented nuclei. The images are representative of three experiments. Bar = 10 µm. B, Percentage of apoptotic cells in total GFP-fluorescing cells. Each value is the mean ± SEM of three experiments. AL-PIF-GFP significantly increased the percentage of apoptotic cells, and this effect was reversed by co-expression of GST-PDK1. **P < 0.01 (unpaired t-test).

Confirmatory studies on AL-PIF properties using PDK1 knockout cells

In this study, we found that AL-PIF reduced the basal phosphorylation level of PKB, affected the stability, phosphorylation, kinase activity and receptor-mediated translocation of PKC and induced apoptosis. These findings strongly suggest that AL-PIF exerted these effects by inhibiting the PDK1-mediated signaling. To further confirm that AL-PIF prevents PDK1 functions, we examined whether the findings obtained in AL-PIF-expressed cells were also observed in cells in which PDK1 was deficient. For that purpose, we used conditional PDK1 knockout cells. We established immortalized mouse embryo fibroblast (MEF) cells derived from PDK1^lox/lox and PDK1^+/+ (wild-type) mice by the 3T3 protocol (Todaro & Green 1963) and designated them F/F MEF and WT MEF cells, respectively. To disrupt the PDK1 gene in F/F MEF cells, we introduced Cre recombinase into cells by using an adenoviral vector (Ad-Cre). Infection of Ad-Cre (MOI = 50) greatly decreased the expression level of endogenous PDK1 in F/F cells 4 days after infection, compared with that in cells infected with the control adenoviral vector, Ad-tTA (adenoviral vector to express tetracycline transactivator) (Fig. 11C, lower). In contrast, the amount of PDK1 in WT MEF cells was not affected by infection of Ad-Cre (Fig. 11B, lower). To examine whether PDK1 deficiency affects the stability of PKC, we selected PKC-GFP whose expression level was affected by AL-PIF, and expressed it into WT and F/F MEF cells. We infected F/F MEF cells with Ad-PKC-GFP (adenoviral vector to express PKC-GFP) on the day after the first infection with Ad-Cre or Ad-tTA (Fig. 11A). Three days after the infection of Ad-PKC-GFP, the amount of expressed PKC-GFP was decreased in F/F MEF cells infected with Ad-Cre compared with that in cells infected with Ad-tTA (Fig. 11C, upper). The expression level of PKC-GFP in WT MEF cells infected with Ad-Cre was similar to that in WT MEF cells infected with Ad-tTA, suggesting that the result was not due to the difference in adenoviral vectors (Fig. 11B, upper).

View larger version (39K): [in this window] [in a new window]   Figure 11  Amount of expressed PKC-GFP was decreased in PDK1 (–/–) MEF cells compared with that in wild-type MEF cells. A, Schedule of viral infection and cell harvest. Wild-type (WT) or PDK1 F/F MEF cells (2 x 105) were seeded on to a 6-cm-diameter dish on day 0. On day 1, cells were infected with either Ad-Cre or Ad-tTA, a control adenovirus vector. On day 2, cells were infected with Ad-PKC-GFP and cultured for a further 3 days. All infections were conducted at 50 multiplicity of infection (MOI). B, C, Representative immunoblotting images of three experiments. Expressed PKC-GFP and endogenous PDK1 were detected with anti-GFP (upper) and anti-PDK1 (lower) antibodies, respectively, in WT MEF (B) and PDK1 F/F (C) cells.

View larger version (31K): [in this window] [in a new window]   Figure 12  Glutamate (1 mM)-induced translocation of PKC-GFP in WTCre and F/FCre cells.WTCre and F/FCre (PDK1(–/–)) cells were transfected with a plasmid encoding PKC-GFP (0.5 µg) together with a plasmid encoding metabotropic glutamate receptor type 1 (mGluR1, 2 µg) and cultured for 2 days on a 3.5-cm-diameter glass bottom dish. Sequential images of PKC-GFP in response to 1 mM glutamate were monitored for 5 min using a confocal laser microscopy. Images before (pre) and 0.5, 1, 2 and 3 min after glutamate stimulation are shown. In WT Cre cells, PKC-GFP completely returned to the cytoplasm 2 or 3 min after glutamate treatment, while it was still retained at the plasma membrane in F/F Cre cells. Images are representative of at least five experiments. Bar = 10 µm.

	Discussion

Top Abstract Introduction Results Discussion Experimental procedures References

In the present study, AL-PIF dose-dependently decreased the amount of expressed PKC-GFP (Fig. 4). However, it did not significantly alter the amount of PKC-GFP, although it tended to be decreased (Fig. 5), suggesting that unphosphorylated PKC-GFP is more stable than unphosphorylated PKC-GFP. The instability of unphospho-PKC-GFP was confirmed by experiments using PDK1 knockout MEF cells (Fig. 11). It has been reported that mutant PKC, whose threonine residue at the activation loop (Thr⁵¹⁴) was replaced with alanine, almost completely lacked kinase activity (Seki et al. 2005). In contrast, the kinase activity of PKC was retained even if its threonine residue at the activation loop (Thr⁵⁰⁵) was replaced with alanine (Stempka et al. 1997; Seki et al. 2005). It is generally accepted that the phosphorylation of turn and hydrophobic motifs around the carboxyl terminus is involved in the stability of kinase to high temperature, oxidation and phosphatase (Bornancin & Parker 1996; Edwards & Newton 1997). Since autophosphorylation of these two sites requires the activity of PKC itself, the difference between the stability of AL-PIF-affected PKC-GFP and that in PKC-GFP might be derived from their remaining kinase activities.

To explore whether AL-PIF affect the basal activities of endogenous PKCs, we used MARCKS-G2A, which is a non-myristoylated MARCKS and is localized in the cytoplasm, as a PKC substrate. We have previously reported that phosphorylation of MARCKS-G2A-GFP was independent of the stimulations which lead to PKC translocation and activation (Ohmori et al. 2000), indicating that phosphorylation of MARCKS-G2A represents the basal kinase activity of PKC. As shown in Fig. 6, the basal kinase activity of endogenous PKC in COS-7 cells was significantly decreased by AL-PIF. This result suggests that AL-PIF inhibits phosphorylation of the activation loop of endogenous PKC as well as co-expressed PKC-GFP and subsequently reduces PKC-mediated cellular functions.

Live imaging experiments revealed that AL-PIF did not inhibit P2Y receptor-mediated translocation of PKC-GFP and PKC-GFP from the cytoplasm to plasma membrane that was triggered by stimulation with 1 mM ATP but significantly prolonged the retention period of the PKC-GFP at the plasma membrane following translocation (Figs 7 and 8). In addition, the translocation of PKC-GFP and PKC-GFP occurred more remarkably in AL-PIF-DsRed2-coexpressed cells than in DsRed2-coexpressed cells. This is consistent with our recent finding that the mutant PKC-GFP and PKC-GFP with an unphospho-activation loop were retained at the plasma membrane for a longer period than the wild-type in the case of receptor-mediated translocation (Seki et al. 2005). Similar results were also obtained in PDK1 knockout MEF cells (Fig. 12). Taken together, the results of the present study suggest that AL-PIF affects PKC targeting by its interfering actions on PDK1.

Based on the previous investigations (Sakai et al. 1997; Oancea & Meyer 1998), it is considered that PKC movement is driven by diffusion, but not by ATP-dependent motor protein. In other words, translocation of PKC is considered to be a phenomenon that freely moving PKC molecules in the cytoplasm are trapped at the plasma membrane where diacylglycerol (DG) are accumulated after the receptor activation. We have previously demonstrated that kinase-negative PKC-GFP retained at the plasma membrane for longer than wild-type, suggesting that PKC activation accelerates the DG degradation (Seki et al. 2005). As shown in the present study, AL-PIF decreased PKC kinase activity by inhibiting the activation loop phosphorylation by PDK1. Attenuation of PKC kinase activity would prevent the DG degradation and subsequently cause the intense accumulation of DG at the plasma membrane, resulting in the remarkable PKC translocation from cytoplasm to membrane and the prolonged retention of PKC at plasma membrane.

We found that AL-PIF induced apoptosis in COS-7 cells 3 days after the transfection of AL-PIF. Similar results were obtained in PC12 cells, a neuronal cell line (data not shown). Since this effect was significantly reversed by the co-expression of GST-PDK1 (Fig. 10), AL-PIF induced apoptosis by inhibiting PDK1. As PKB has an anti-apoptotic effect and is involved in cell survival and proliferation (Downward 1998), these results might reflect the inhibitory effect of AL-PIF on PKB. However, AL-PIF inhibited basal phosphorylation of the PKB activation loop by about 30% but did not inhibit IGF-1-induced phosphorylation (Fig. 3). On the other hand, AL-PIF strongly inhibited the activation loop phosphorylation of PKC (Figs 4 and 5). Many studies have revealed that PKC activation suppresses the apoptosis and cell death (Ruvolo et al. 1998; Bronisz et al. 2002). Therefore, it is possible that apoptosis induced by AL-PIF might result from reduction of PKC activity.

Since PDK1 regulates the activities of many AGC kinases, including PKB and PKC, PDK1 is thought to play a key role in cell growth, survival and proliferation (Vanhaesebroeck & Alessi 2000; Mora et al. 2004), leading to the idea that PDK1 is a target for cancer therapy (Fresno Vara et al. 2004; Osaki et al. 2004). Indeed, reagents that inhibit PDK1 would be useful candidates for therapy against cancer (Ballif et al. 2001; Arico et al. 2002; Sato et al. 2002); however, specific PDK1 inhibitors have not been found yet. In addition, it is possible that systemic application of PDK1 inhibitors causes generalized severe side-effects. Considering the fact that AL-PIF is a strong apoptosis inducer, regional gene therapy using a virus vector carrying AL-PIF would be effective for solid cancers.

In addition to its therapeutic utility, the present study demonstrated that AL-PIF would be a convenient and beneficial tool to elucidate the roles of PDK1 in various types of cells and tissues. If AL-PIF is applied for generating region-specific and inducible transgenic mice using a tetracycline-regulated system (Sakai et al. 2004), temporal and regional functions of PDK1 in vivo could be investigated.

In conclusion, we revealed that AL-PIF served sufficiently as a pseudosubstrate and an inhibitory molecule for PDK1. This molecule would be an effective material for anti-cancer therapy as a potent inducer of apoptosis as well as a beneficial tool for investigating PDK-mediated cellular functions in a variety of tissues.

	Experimental procedures

Top Abstract Introduction Results Discussion Experimental procedures References

 
Materials

ATP was purchased from Research Biochemical International (Natick, MA, USA). Insulin-like growth factor 1 (IGF-1) was from Invitrogen (Carlsbad, CA, USA). Anti-GFP rabbit polyclonal antibody was from Molecular Probes (Leiden, Netherlands). Anti-phospho-PKB (Thr³⁰⁸) rabbit polyclonal antibody was from Upstate Cell Signaling Solutions (Charlottesville, VA, USA). Anti-phospho-PKC (Thr⁵¹⁴) rabbit polyclonal antibody was from Biosource International (Camarillo, CA, USA). Anti-phospho-PKC (Thr⁵⁰⁵) rabbit polyclonal antibody was from Cell Signaling Technology (Beverly, MA, USA). Anti-phospho-MARCKS (myristoylated alanine-rich C-kinase substrate) rabbit polyclonal antibody was generated as previously described (Yamamoto et al. 1998). Anti-PDK1 mouse monoclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG and anti-mouse IgG antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA, USA). Hoechst 33342 was from Sigma Chemical Co. (St Louis, MO, USA).

Plasmid construction

We constructed a plasmid encoding PDK1 pseudosubstrate, designated as AL-PIF (Fig. 1A), which consists of two pairs of two fragments, AL and PIF, in tandem. AL is a 20-residue peptide around the activation loop of PKC (GENRASTFCGTPDYIAPEIR), which contains a threonine residue (Thr⁵⁰⁵) phosphorylated by PDK1. PIF (PDK1-interacting fragment) is the carboxyl terminal 24 peptide of PKC-related kinase 2 (REPRILSEEEQEMFRDFDYIADWC), which interacts with PDK1 (Biondi et al. 2000). Double-strand cDNA of AL-PIF was made by hybridizing sense and anti-sense oligonucleotides corresponding to AL-PIF amino acids sequences. The sense and anti-sense oligonucleotides used were 5'-aattaggggagaaccgggccagcacattctgcggcactcctgactacatcgcccctgagatccgacgagaaccaaggatactttcggaagaggagcaggaaatgttcagagattttgactacattgctgattggtgta-3' and 5'-agcttacaccaatcagcaatgtagtcaaaatctctgaacatttcctgctcctcttccgaaagtatccttggttctcgtcggatctcaggggcgatgtagtcaggagtgccgcagaatgtgctggcccggttctccccg-3', respectively. Hybridization of oligonucleotide was performed in the presence of T4 kinase (TOYOBO, Osaka, Japan) and 10 mM ATP at 37 °C for 1 h. Hybridized cDNA was identified by agarose gel electrophoresis and purified by using a Gel extraction kit (Qiagen, Hilden, Germany), which was used for subsequent subcloning.

To construct a plasmid encoding AL-PIF-GFP, cDNAs of AL-PIF and GFP were subcloned into pTB701, an expression plasmid for mammalian cells (Ono et al. 1988), as shown in Fig. 1. To construct the plasmid encoding AL-PIF-DsRed2, we subcloned AL-PIF cDNA into the expression vector pDsRed2-N1 (BD Biosciences Clontech, Palo Alto, CA, USA). cDNAs for rat PKC, PKC and PKB were fused with GFP cDNA to their C terminus (Fig. 1B) and subcloned into the expression vector pTB701 as previously described (Sakai et al. 1997; Ohmori et al. 1998). A plasmid encoding non-myristoylated mutant MARCKS-GFP (MARCKS-G2A-GFP, Fig. 1C) was constructed as previously described (Ohmori et al. 2000). A plasmid encoding GST (glutathione S-transferase)-PDK1 was a gift from Dr Dario Alessi. All cDNAs were verified by sequencing.

Cell culture

COS-7 cells were purchased from Riken Cell Bank (Tsukuba, Japan). The CHO-K1 cell strain was a gift from Dr Nishijima (National Institute of Health, Tokyo, Japan). COS-7 and CHO-K1 cells were cultured in Dulbecco's modified Eagle's medium and Ham's F12 medium (Sigma Chemical Co.), respectively, supplemented with 10% fetal bovine serum (FBS), 100 units/mL of penicillin and 100 µg/mL of streptomycin in a humidified atmosphere containing 5% CO₂ at 37 °C.

Immunoblotting

Transient transfection of COS-7 cells was performed by electroporation. Plasmids (16–30 µg) were transfected into 6-10⁶ cells using a Gene Pulser (975 µF, 220 V; Bio-Rad Laboratories, Hercules, CA, USA). Transfected cells were cultured in 9-cm-diameter culture dishes.

For immunoblotting, transfected cells were cultured for 2 days and then harvested by 500 g centrifugation. The cell pellet was washed with 1 mL of homogenate buffer (250 mM sucrose, 10 mM EGTA, 2 mM EDTA and 50 mM Tris/HCl, pH 7.4) and resuspended in 300 µL of lysis buffer (homogenate buffer containing 1% Triton X-100, 200 µg/mL of leupeptin, 1 mM PMSF, 1 mM sodium orthovanadate, 1 mM NaF and 100 nM Calyculin A) and then sonicated (UR-20P, TOMY SEIKO, Tokyo, Japan). Twenty to 30 µg of protein of each sample was subjected to 7.5% SDS-PAGE, and the separated proteins were electrophoretically transferred on to polyvinylidene difluoride (PVDF) filters (Millipore, Bedford, MA, USA). Nonspecific binding sites on PVDF filters were blocked by incubation with 5% skim milk in PBS-T (0.01 M phosphate-buffered saline containing 0.03% Triton X) for > 1 h at room temperature (RT). After being washed with PBS-T, the PVDF filters were incubated with anti-GFP (diluted 1: 2000), anti-PKB phosphor-Thr³⁰⁸ (1 : 500), anti-PKC phospho-Thr⁵¹⁴ (1 : 1000), anti-PKC phospho-Thr⁵⁰⁵ (1 : 1000) or anti-phospho-MARCKS (1 : 500) rabbit polyclonal antibodies or anti-PDK1 (1 : 2000) mouse monoclonal antibody for > 1 h at RT. After further washing, the filters were incubated with HRP-conjugated anti-rabbit IgG (1 : 10000) or anti-mouse IgG (1 : 10000) antibodies for > 30 min at RT. After three more washes, the immunoreactive bands were visualized with a chemiluminescence detection kit (ECL^TM. Western Blotting Detection Reagents, Amersham Biosciences, Little Chalfont, UK). The band densities were quantified with Fluor-S MultiImager (Bio-Rad Laboratories). The phosphorylation level of each protein was evaluated by the ratio of band intensities of phosphorylated protein per totally expressed protein detected by anti-GFP antibody.

Pull-down assay

The expression plasmid encoding GST-PDK1 was co-transfected with objective plasmids (PKC-GFP, PKC-GFP, GFP or AL-PIF-GFP) into COS-7 cells by electroporation. Three days after transfection, cells were harvested and lyzed in 500 µL of lysis buffer and sonicated. The lysate was cleared by centrifugation at 19 000 g for 10 min at 4 °C. After quantification of protein level, the cell lysate containing 1.5 mg protein was diluted to 500 µL. Five percent of the cell lysate was kept as an input sample. The remainder of the cell lysate was incubated with glutathione-sepharose (Amersham Biosciences) at 4 °C overnight. After three washes with PBS, the glutathione-sepharose binding proteins (precipitate) were eluted by heating at 95 °C for 3 min in a sample loading buffer containing SDS and ß-mercaptoethanol and were analyzed by immunoblotting.

Observation of translocation

Plasmids (2.5 µg) were transfected into CHO cells (1-10⁵ cells) by lipofection using Fugene^TM6. transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN, USA) according to the manufacturer's directions. Transfected CHO cells were spread on to poly D-lysine-coated glass-bottom culture dishes (MatTek Corp., Ashland, MA, USA) and cultured for 2 days. Before the observation, the culture medium was replaced with 0.9 mL of HEPES buffer (135 mM NaCl, 5.4 mM KCl, 1 mM MgCl₂, 1.8 mM CaCl₂, 5 mM HEPES and 10 mM glucose, pH 7.3).

The fluorescence of GFP and DsRed2 was monitored with a confocal laser scanning fluorescent microscope (LSM510META, Carl Zeiss, Esslingen, Germany) at 488-nm argon laser excitation using a 505–530-nm band pass barrier filter and 542-nm HeNe laser excitation using a 560-nm-long pass barrier filter, respectively. Translocations of GFP or DsRed2-fused proteins were triggered by direct application of 0.1 mL of ATP solution at a 10-times higher concentration into HEPES buffer to obtain the appropriate final concentration. Images were recorded every 5 s for 5 min before and after the stimulation. All experiments were performed at RT.

Detection of apoptotic cells by nuclear staining

Various sets of plasmids encoding GFP, AL-PIF-GFP, GST-PDK1 or an empty vector (Fig. 10B) were transfected into 1 x 10⁵ COS-7 cells by lipofection, followed by cultivation for 3 days. Cells were stained with 50 µg/mL Hoechst 33342 for 30 min and harvested using a cell scraper. The fluorescence of Hoechst 33342 was monitored with a confocal laser scanning fluorescent microscope at 364-nm ultraviolet laser excitation using a 385–470-nm band pass barrier filter. We considered that cells with condensed or fragmented nuclei were apoptotic (Fig. 10A). We counted the number of such cells in 50–60 GFP-positive cells and calculated the percentage of apoptotic cells.

Studies using PDK1 knockout cells

Conditional knockout mice using a Cre/loxP system were generated by Inoue et al. (2006). Mice homozygous for a floxed PDK1 gene in which exons 3 and 4 were flanked by LoxP sequences were developed (PDK1^lox/lox). Mouse embryonic fibroblast (MEF) cells from wild-type and PDK1^lox/lox mice were isolated and immortalized according to the 3T3 protocol (Todaro & Green 1963) and were designated as WT MEF and F/F MEF cells, respectively. To disrupt the PDK1 gene, we generated F/F MEF cells that stably express Cre recombinase using a retroviral vector (F/FCre MEF cells). In F/FCre MEF cells, no expression of PDK1 was confirmed by immunoblotting (data not shown). We also developed WT MEF cells that stably express Cre recombinase as control cells (WT Cre MEF cells).

To determine whether the expression level of PKC-GFP was affected by PDK1 knockout, WT MEF and F/F MEF cells were infected with adenoviral vectors encoding Cre recombinase (Ad-Cre). We used an adenoviral vector encoding a tetracycline transactivator (Ad-tTA) as a control vector. One day after the infection of Ad-Cre or Ad-tTA, the cells were infected with an adenoviral vector encoding PKC-GFP (Ad-PKC-GFP) (Fig. 11A). In all adenovirus vectors used, expression of the target gene was driven by a CMV promoter. All infections were conducted at 50 multiplicity of infection (MOI). After a further 3 days of cultivation, the expression of PKC-GFP and PDK1 was examined by immunoblotting.

To determine whether the receptor-mediated translocation of PKC-GFP was affected by PDK1 knockout, F/FCre MEF and WTCre MEF cells were transfected with two plasmids encoding PKC-GFP (0.5 µg) and metabotropic glutamate receptor type 1 (mGluR1) (2 µg) by magnetofection using FugeneT^TM6 and CombiMag (OZ Biosciences, Marseille, France). Two days after transfection, the translocation of PKC-GFP induced by 1 mM glutamate stimulation was observed as described above.

	Acknowledgements

 
We specially thank Dr Dario Alessi for the gift of a plasmid encoding GST-PDK1. This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan and by a grant from Takeda Science Foundation, the Uehara Memoryal Foundation and the Japanese Smoking Research Association. This work was carried out with equipments at the Analysis Center of Life Science, Hiroshima University and the Reserch Center for Molecular Medicine, Faculty of Medicine, Hiroshima University.

	Footnotes

 
Communicated by: Kozo Kaibuchi

^aPresent address: Department of Growth Regulation, Institute of Frontier Medical Sciences, Kyoto University, 53 Kawaharacho, Shogoin, Sakyo-ku, Kyoto 606–8507, Japan

^* Correspondence: E-mail: nsakai{at}hiroshima-u.ac.jp

	References

Top Abstract Introduction Results Discussion Experimental procedures References

 
Alessi, D.R. (2001) Discovery of PDK1, one of the missing links in insulin signal transduction. Colworth Medal Lecture. Biochem. Soc. Trans. 29, 1–14.[CrossRef][Medline]

Alessi, D.R., Deak, M., Casamayor, A., Caudwell, F.B., Morrice, N., Norman, D.G., Gaffney, P., Reese, C.B., MacDougall, C.N., Harbison, D., Ashworth, A. & Bownes, M. (1997a) 3-Phosphoinositide-dependent protein kinase-1 (PDK1): structural and functional homology with the Drosophila DSTPK61 kinase. Curr. Biol. 7, 776–789.[CrossRef][Medline]

Alessi, D.R., James, S.R., Downes, C.P., Holmes, A.B., Gaffney, P.R., Reese, C.B. & Cohen, P. (1997b) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase B. Curr. Biol. 7, 261–269.[CrossRef][Medline]

Arico, S., Pattingre, S., Bauvy, C., Gane, P., Barbat, A., Codogno, P. & Ogier-Denis, E. (2002) Celecoxib induces apoptosis by inhibiting 3-phosphoinositide-dependent protein kinase-1 activity in the human colon cancer HT-29 cell line. J. Biol. Chem. 277, 27613–27621.[Abstract/Free Full Text]

Balendran, A., Casamayor, A., Deak, M., Paterson, A., Gaffney, P., Currie, R., Downes, C.P. & Alessi, D.R. (1999) PDK1 acquires PDK2 activity in the presence of a synthetic peptide derived from the carboxyl terminus of PRK2. Curr. Biol. 9, 393–404.[CrossRef][Medline]

Balendran, A., Hare, G.R., Kieloch, A., Williams, M.R. & Alessi, D.R. (2000) Further evidence that 3-phosphoinositide-dependent protein kinase-1 (PDK1) is required for the stability and phosphorylation of protein kinase C (PKC) isoforms. FEBS Lett. 484, 217–223.[CrossRef][Medline]

Ballif, B.A., Shimamura, A., Pae, E. & Blenis, J. (2001) Disruption of 3-phosphoinositide-dependent kinase 1 (PDK1) signaling by the anti-tumorigenic and anti-proliferative agent N--tosyl-L-phenylalanyl chloromethyl ketone. J. Biol. Chem. 276, 12466–12475.[Abstract/Free Full Text]

Behn-Krappa, A. & Newton, A.C. (1999) The hydrophobic phosphorylation motif of conventional protein kinase C is regulated by autophosphorylation. Curr. Biol. 9, 728–737.[CrossRef][Medline]

Belham, C., Wu, S. & Avruch, J. (1999) Intracellular signalling: PDK1—a kinase at the hub of things. Curr. Biol. 9, R93–R96.[CrossRef][Medline]

Biondi, R.M., Cheung, P.C.F., Casamayor, A., Deak, M., Currie, R.A. & Alessi, D.R. (2000) Identification of a pocket in the PDK1 kinase domain that interacts with PIF and the C-terminal residues of PKA. EMBO J. 19, 979–988.[CrossRef][Medline]

Blackshear, P.J. (1993) The MARCKS family of cellular protein kinase C substrates. J. Biol. Chem. 268, 1501–1504.[Free Full Text]

Bornancin, F. & Parker, P.J. (1996) Phosphorylation of threonine 638 critically controls the dephosphorylation and inactivation of protein kinase C. Curr. Biol. 6, 1114–1123.[CrossRef][Medline]

Bronisz, A., Gajkowska, B. & Domanska-Janik, K. (2002) PKC and Raf-1 inhibition-related apoptotic signalling in N2a cells. J. Neurochem. 81, 1176–1184.[CrossRef][Medline]

Collins, B.J., Deak, M., Arthur, J.S., Armit, L.J. & Alessi, D.R. (2003) In vivo role of the PIF-binding docking site of PDK1 defined by knock-in mutation. EMBO J. 22, 4202–4211.[CrossRef][Medline]

Downward, J. (1998) Mechanisms and consequences of activation of protein kinase B/Akt. Curr. Opin. Cell Biol. 10, 262–267.[CrossRef][Medline]

Edwards, A.S. & Newton, A.C. (1997) Phosphorylation at conserved carboxyl-terminal hydrophobic motif regulates the catalytic and regulatory domains of protein kinase C. J. Biol. Chem. 272, 18382–18390.[Abstract/Free Full Text]

Fresno Vara, J.A., Casado, E., de Castro, J., Cejas, P., Belda-Iniesta, C. & Gonzalez-Baron, M. (2004) PI3K/Akt signalling pathway and cancer. Cancer. Treat. Rev. 30, 193–204.[CrossRef][Medline]

Gao, T., Toker, A. & Newton, A.C. (2001) The carboxyl terminus of protein kinase c provides a switch to regulate its interaction with the phosphoinositide-dependent kinase, PDK-1. J. Biol. Chem. 276, 19588–19596.[Abstract/Free Full Text]

Hinton, H.J., Alessi, D.R. & Cantrell, D.A. (2004) The serine kinase phosphoinositide-dependent kinase 1 (PDK1) regulates T cell development. Nat. Immunol. 5, 539–545.[CrossRef][Medline]

Inoue, H., Ogawa, W., Asakawa, A. et al. (2006) Role of hepatic STAT3 in brain-insulin action on hepatic glucose production. Cell. Metab. 3, 267–275.[CrossRef][Medline]

Jensen, C.J., Buch, M.B., Krag, T.O., Hemmings, B.A., Gammeltoft, S. & Frodin, M. (1999) 90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositide-dependent protein kinase-1. J. Biol. Chem. 274, 27168–27176.[Abstract/Free Full Text]

Kim, D.W., Hwang, J.H., Suh, J.M., Kim, H., Song, J.H., Hwang, E.S., Hwang, I.Y., Park, K.C., Chung, H.K., Kim, J.M., Park, J., Hemmings, B.A. & Shong, M. (2003) RET/PTC (rearranged in transformation/papillary thyroid carcinomas) tyrosine kinase phosphorylates and activates phosphoinositide-dependent kinase 1 (PDK1): an alternative phosphatidylinositol 3-kinase-independent pathway to activate PDK1. Mol. Endocrinol. 17, 1382–1394.[Abstract/Free Full Text]

Kobayashi, T. & Cohen, P. (1999) Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem. J. 339 (2), 319–328.[CrossRef][Medline]

Lawlor, M.A., Mora, A., Ashby, P.R., Williams, M.R., Murray-Tait, V., Malone, L., Prescott, A.R., Lucocq, J.M. & Alessi, D.R. (2002) Essential role of PDK1 in regulating cell size and development in mice. EMBO J. 21, 3728–3738.[CrossRef][Medline]

Le Good, J.A., Ziegler, W.H., Parekh, D.B., Alessi, D.R., Cohen, P. & Parker, P.J. (1998) Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281, 2042–2045.[Abstract/Free Full Text]

McManus, E.J., Collins, B.J., Ashby, P.R., Prescott, A.R., Murray-Tait, V., Armit, L.J., Arthur, J.S. & Alessi, D.R. (2004) The in vivo role of PtdIns (3,4,5) P (3) binding to PDK1 PH domain defined by knockin mutation. EMBO J. 23, 2071–2082.[CrossRef][Medline]

Mora, A., Davies, A.M., Bertrand, L., Sharif, I., Budas, G.R., Jovanovic, S., Mouton, V., Kahn, C.R., Lucocq, J.M., Gray, G.A., Jovanovic, A. & Alessi, D.R. (2003) Deficiency of PDK1 in cardiac muscle results in heart failure and increased sensitivity to hypoxia. EMBO J. 22, 4666–4676.[CrossRef][Medline]

Mora, A., Komander, D., van Aalten, D.M. & Alessi, D.R. (2004) PDK1, the master regulator of AGC kinase signal transduction. Semin. Cell Dev. Biol. 15, 161–170.[CrossRef][Medline]

Mora, A., Lipina, C., Tronche, F., Sutherland, C. & Alessi, D.R. (2005) Deficiency of PDK1 in liver results in glucose intolerance, impairment of insulin-regulated gene expression and liver failure. Biochem. J. 385, 639–648.[CrossRef][Medline]

Oancea, E. & Meyer, T. (1998) Protein kinase C as a molecular machine for decoding calcium and diacylglycerol signals. Cell 95, 307–318.[CrossRef][Medline]

Ohmori, S., Sakai, N., Shirai, Y., Yamamoto, H., Miyamoto, E., Shimizu, N. & Saito, N. (2000) Importance of protein kinase C targeting for the phosphorylation of its substrate, myristoylated alanine-rich C-kinase substrate. J. Biol. Chem. 275, 26449–26457.[Abstract/Free Full Text]

Ohmori, S., Shirai, Y., Sakai, N., Fujii, M., Konishi, H., Kikkawa, U. & Saito, N. (1998) Three distinct mechanisms for translocation and activation of the delta subspecies of protein kinase C. Mol. Cell. Biol. 18, 5263–5271.[Abstract/Free Full Text]

Ono, Y., Fujii, T., Igarashi, K., Kikkawa, U., Ogita, K. & Nishizuka, Y. (1988) Nucleotide sequences of cDNAs for alpha and gamma subspecies of rat brain protein kinase C. Nucleic Acids Res. 16, 5199–5200.[Free Full Text]

Osaki, M., Oshimura, M. & Ito, H. (2004) PI3K-Akt pathway: its functions and alterations in human cancer. Apoptosis 9, 667–676.[CrossRef][Medline]

Pullen, N., Dennis, P.B., Andjelkovic, M., Dufner, A., Kozma, S.C., Hemmings, B.A. & Thomas, G. (1998) Phosphorylation and activation of p70s6k by PDK1. Science 279, 707–710.[Abstract/Free Full Text]

Ruvolo, P.P., Deng, X., Carr, B.K. & May, W.S. (1998) A functional role for mitochondrial protein kinase C in Bcl2 phosphorylation and suppression of apoptosis. J. Biol. Chem. 273, 25436–25442.[Abstract/Free Full Text]

Sakai, N., Sasaki, K., Ikegaki, N., Shirai, Y., Ono, Y. & Saito, N. (1997) Direct visualization of the translocation of the gamma-subspecies of protein kinase C in living cells using fusion proteins with green fluorescent protein. J. Cell Biol. 139, 1465–1476.[Abstract/Free Full Text]

Sakai, N., Tsubokawa, H., Matsuzaki, M., Kajimoto, T., Takahashi, E., Ren, Y., Ohmori, S., Shirai, Y., Matsubayashi, H., Chen, J., Duman, R.S., Kasai, H. & Saito, N. (2004) Propagation of PKC translocation along the dendrites of Purkinje cell in PKC-GFP transgenic mice. Genes Cells 9, 945–957.[Abstract/Free Full Text]

Sakaue, H., Nishizawa, A., Ogawa, W., Teshigawara, K., Mori, T., Takashima, Y., Noda, T. & Kasuga, M. (2003) Requirement for 3-phosphoinositide-kependent dinase-1 (PDK-1) in insulin-induced glucose uptake in immortalized brown adipocytes. J. Biol. Chem. 278, 38870–38874.[Abstract/Free Full Text]

Sato, S., Fujita, N. & Tsuruo, T. (2002) Interference with PDK1-Akt survival signaling pathway by UCN-01 (7-hydroxystaurosporine). Oncogene 21, 1727–1738.[CrossRef][Medline]

Seki, T., Matsubayashi, H., Amano, T., Shirai, Y., Saito, N. & Sakai, N. (2005) Phosphorylation of PKC activation loop plays an important role in receptor-mediated translocation of PKC. Genes Cells 10, 225–239.[Abstract/Free Full Text]

Shirai, Y., Kashiwagi, K., Sakai, N. & Saito, N. (2000) Phospholipase A (2) and its products are involved in the purinergic receptor-mediated translocation of protein kinase C in CHO-K1 cells. J. Cell Sci. 113, 1335–1343.[Abstract]

Shirai, Y., Sakai, N. & Saito, N. (1998) Subspecies-specific targeting mechanism of protein kinase C. Jpn. J. Pharmacol. 78, 411–417.[CrossRef][Medline]

Sonnenburg, E.D., Gao, T. & Newton, A.C. (2001) The phosphoinositide-dependent kinase, PDK-1, phosphorylates conventional protein kinase C isozymes by a mechanism that is independent of phosphoinositide 3-kinase. J. Biol. Chem. 276, 45289–45297.[Abstract/Free Full Text]

Stempka, L., Girod, A., Muller, H.J., Rincke, G., Marks, F., Gschwendt, M. & Bossemeyer, D. (1997) Phosphorylation of protein kinase Cdelta (PKCdelta) at threonine 505 is not a prerequisite for enzymatic activity. Expression of rat PKCdelta and an alanine 505 mutant in bacteria in a functional form. J. Biol. Chem. 272, 6805–6811.[Abstract/Free Full Text]

Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G.F., Holmes, A.B., Gaffney, P.R., Reese, C.B., McCormick, F., Tempst, P., Coadwell, J. & Hawkins, P.T. (1998) Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase B. Science 279, 710–714.[Abstract/Free Full Text]

Todaro, G.J. & Green, H. (1963) Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J. Cell Biol. 17, 299–313.[Medline]

Toker, A. & Newton, A.C. (2000) Cellular signaling: pivoting around PDK-1. Cell 103, 185–188.[CrossRef][Medline]

Vanhaesebroeck, B. & Alessi, D.R. (2000) The PI3K-PDK1 connection: more than just a road to PKB. Biochem. J. 346, 561–576.[CrossRef][Medline]

Williams, M.R., Arthur, J.S.C., Balendran, A., van der Kaay, J., Poli, V., Cohen, P. & Alessi, D.R. (2000) The role of 3-phosphoinositide-dependent kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr. Biol. 10, 439–448.[CrossRef][Medline]

Yamamoto, H., Matsumura, T., Kugiyama, K., Oishi, Y., Ogata, N., Yasue, H. & Miyamoto, E. (1998) The antibody specific for myristoylated alanine-rich C kinase substrate phosphorylated by protein kinase C: activation of protein kinase C in smooth muscle cells in human coronary arteries. Arch. Biochem. Biophys. 359, 151–159.[CrossRef][Medline]

Received: 19 April 2006
Accepted: 8 June 2006

This article has been cited by other articles:

				K. Nakamura, H. Sakaue, A. Nishizawa, Y. Matsuki, H. Gomi, E. Watanabe, R. Hiramatsua, M. Tamamori-Adachi, S. Kitajima, T. Noda, et al. PDK1 Regulates Cell Proliferation and Cell Cycle Progression through Control of Cyclin D1 and p27Kip1 Expression J. Biol. Chem., June 20, 2008; 283(25): 17702 - 17711. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Seki, T. Articles by Sakai, N. Search for Related Content PubMed PubMed Citation Articles by Seki, T. Articles by Sakai, N.