GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2006) 11, 1085-1096. doi:10.1111/j.1365-2443.2006.01004.x
© 2006 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kawai-Noma, S.
Right arrow Articles by Taguchi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawai-Noma, S.
Right arrow Articles by Taguchi, H.

Dynamics of yeast prion aggregates in single living cells

Shigeko Kawai-Noma1,a, Satoru Ayano2,a, Chan-Gi Pack3, Masataka Kinjo3, Masasuke Yoshida4, Kenji Yasuda2 and Hideki Taguchi1,*

1 Department of Medical Genome Sciences, Graduate School of Frontier Sciences, University of Tokyo, FSB401, 5-1-5 Kashiwanoha, Kashiwa, Chiba, 277-8562, Japan
2 Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo, 153-8902 Japan
3 Laboratory of Supramolecular Biophysics, Research Institute of Electronic Sciences, Hokkaido University, N-12 W-6, Kita-ku, Sapporo, 060-0812, Japan
4 Chemical Resources Laboratory, Tokyo Institute of Technology, 4259 Nagatsuta, Yokohama, 226-8503 Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Prions are propagating proteins that are ordered protein aggregates, in which the phenotypic trait is retained in the altered protein conformers. To understand the dynamics of the prion aggregates in living cells, we directly monitored the fate of the aggregates using an on-chip single-cell cultivation system as well as fluorescence correlation spectroscopy (FCS). Single-cell imaging revealed that the visible foci of yeast prion Sup35 fused with GFP are dispersed throughout the cytoplasm during cell growth, but retain the prion phenotype. FCS showed that [PSI+] cells, irrespective of the presence of foci, contain diffuse oligomers, which are transmitted to their daughter cells. Single-cell observations of the oligomer-based transmission provide a link between previous in vivo and in vitro analyses of the prion and shed light on the relationship between the protein conformation and the phenotype.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Prions are infectious proteins (Prusiner 1998; Weissmann 2004). In the prion, the altered conformers of a protein autocatalytically convert the normal structure to the altered form, resulting in deposits of amyloid aggregates. Originally developed from mammalian neurodegenerative diseases, the prion concept has been extended to several non-Mendelian genetic elements in yeast, such as [PSI+] and [URE3] (Tuite & Cox 2003; Chien et al. 2004; Wickner et al. 2004; Shorter & Lindquist 2005). Extensive studies over the past decade have revealed that yeast prions are tractable experimental model to investigate prion phenomena.

The budding yeast Saccharomyces cerevisiae prion [PSI+] (Cox 1965) is a self-propagating altered conformation of the translation termination factor Sup35 (eRF3). The altered polymerized conformation of Sup35 leads to an increased readthrough of stop codons detected as nonsense suppression (Cox 1965). Propagation of [PSI+] is dependent on the glutamine/asparagines-rich N-terminal domain of Sup35. In vivo, expression of the prion-forming domain of Sup35 fused to GFP (Sup35NM-GFP) in [PSI+] cells generates punctate fluorescent aggregates (called foci) (Patino et al. 1996), which are often thought to be a hallmark of the prions (Tuite & Cox 2003; Chien et al. 2004; Wickner et al. 2004; Shorter & Lindquist 2005). In vitro, Sup35 fragments containing the N domain form ß-sheet rich amyloid aggregates (e.g. Glover et al. 1997; King et al. 1997; DePace et al. 1998; Kishimoto et al. 2004; Krzewska & Melki 2006).

Since prions are transmissible, they inherently replicate themselves in order to propagate the transmissible entities. Many attempts have been made to elucidate the transmissible entities in the yeast prion [PSI+]. First, several genetic analyses combined with fluorescent microscopic observations have suggested that the fluorescent foci do not directly represent [PSI+], since the foci are not always visible in the [PSI+] cells (Borchsenius et al. 2001; Wegrzyn et al. 2001; Zhou et al. 2001; Song et al. 2005; Wu et al. 2005). Second, number of the entities that propagate the [PSI+] in yeast (called propagons) has been calculated from studies on the kinetics of [PSI+] elimination in the presence of guanidine HCl (Eaglestone et al. 2000; Cox et al. 2003). Finally, recent in vitro agarose gel electrophoresis of the [PSI+] lysates have shown that prion aggregates are formed by small Sup35 polymers (8- to 50-mers of Sup35) (Kryndushkin et al. 2003).

Although these accumulating studies have illuminated the mechanism by which the prion entities propagate, their conclusions are ambiguous, even confusing, since the conclusions have been based on ensemble experiments. For example, the descriptions of the fluorescent foci have been fluctuating (Wegrzyn et al. 2001; Song et al. 2005; Wu et al. 2005). In addition, there should be a link between the in vivo and in vitro observations regarding to the molecular entities of the prion. Although recombinant Sup35 amyloid fibrils formed in vitro can induce the [PSI+] phenotype, the molecular entities critical to the prion propagation as well as relationship between the recombinant Sup35 fibrils and the polymers in the [PSI+] lysates revealed by the electrophoresis are unclear.

To overcome the limitation of the ensemble methods, here we monitored the fate of the aggregates using an on-chip single-cell cultivation system together with fluorescence correlation spectroscopy (FCS) (Lippincott-Schwartz et al. 2001; Hess et al. 2002). Single-cell imaging revealed that the visible foci of yeast prion Sup35 fused with GFP were diffused into the cytoplasm during cell growth, while retaining the prion phenotype. FCS revealed that oligomers of Sup35-GFP were diffused in the cells irrespective of the presence of foci, and then transmitted to their daughter cells as the phenotypic trait. Single-cell observations reveal the dynamical nature of the prion aggregates, which then provides a link between previous in vivo and in vitro analyses and sheds light on the molecular entities that connect the protein conformation and the phenotype.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
On-chip single cultivation system to monitor the fate of the prion aggregates

To monitor the fate of the foci directly we took a single-cell approach using a self-equipped live cell imaging apparatus (Inoue et al. 2001a; Umehara et al. 2003; Ayano et al. 2004), in which individual cells can be continuously observed for long periods of time and the media can be exchanged during cultivation. Microchambers for individual yeast cells were fabricated using 30-µm-thick photoresist on 0.2 mm thick glass slides (Supplementary Fig. S1).

We used the 74D-694 [PSI+] strain (Tuite & Cox 2003; Wickner et al. 2004; Shorter & Lindquist 2005) and transiently induced the expression of Sup35-GFP using the GAL1 galactose responsive promoter. Single-cell imaging revealed that a typical 4 h induction led to the formation of Sup35-GFP foci in the cytoplasm of [PSI+] cells (data not shown). After stopping further induction of Sup35-GFP by exchanging the medium for one lacking galactose, we monitored the fate of the fluorescent foci in real time. Individual live cell imaging showed that the diameter of the foci gradually decreased, and the foci eventually disappeared (Fig. 1A). A statistical analysis revealed that 86% of the foci observed (185 out of 230 cells) were lost, and the half time for disappearance was approximately 2 h (Fig. 1C).


Figure 1
View larger version (56K):
[in this window]
[in a new window]
 
Figure 1  Dynamics of the Sup35NM-GFP foci in individual living cells detected using the on-chip cultivation system. (A, B) Time-lapse imaging of living [PSI+] cells cultured in (A) SC medium and (B) an isotonic nutrient-free buffer. Phase contrast (Ph) and fluorescent images are shown. After the formation of Sup35NM-GFP foci induced by SC containing galactose, the medium was exchanged to SC or the isotonic buffer. Images show single z-sections, but we confirmed the absence of the foci in all z-sections when the foci disappeared in the section being observed. (C) Foci size measurements in individual [PSI+] cells cultured in SC (closed symbols) or isotonic buffer (open symbols). Cross-sectional areas of the fluorescent foci were digitally determined. Sizes of the foci at 0 min from the medium exchange were set to 100%. (D) The Sup35NM-GFP fusion protein was not degraded during the observation time. The cultured [PSI+] cells in rich medium were collected before (–) and after (0, 2, 4 h) the induction of Sup35NM-GFP. After cell lysis, the lysates were separated by 10% SDS-PAGE. Sup35NM-GFP and a loading control, enolase were detected with anti-Sup35NM serum and anti-yeast enolase serum, respectively. Only the bands of Sup35NM-GFP are shown.

 
The disappearance of the foci was not due to GFP photobleaching. Even 10 h after we stopped cell growth, by exchanging the synthetic complete (SC) medium with a nutrient-free isotonic buffer, the foci maintained their sizes (Fig. 1B,C). The non-growing cells were not dead, because exchange of the isotonic buffer with SC medium restored growth, and, as in Fig. 1A, the foci disappeared (data not shown). These results, combined with the lack of degradation of the intact Sup35-GFP polypeptides during cell growth (Fig. 1D), indicate that the disappearance of foci is not due to photobleaching or degradation, but due to the dispersal of the foci and Sup35 throughout the cytoplasm of the cell.

The dynamic nature of the foci was not restricted to [PSI+] cells. When we conducted similar studies using another yeast prion, [RNQ1] (Sondheimer & Lindquist 2000) also known as [PIN+] (Derkatch et al. 2001; Osherovich & Weissman 2001), cells expressing Rnq1-GFP also lost the Rnq1-GFP foci during cell growth (Supplementary Fig. S2).

Retention of [PSI+] phenotype after the dispersion of the foci

The disappearance of the foci during cell growth raised the question of whether the yeast cells reverted to the non-prion [psi] phenotype during the experimental manipulations, since we cannot distinguish between cells without foci and [psi] cells, because both display diffuse green fluorescence. Thus, we investigated whether the cells maintained the [PSI+] phenotype using several approaches. First, a classical genetic test using a [PSI+]-mediated nonsense suppression was conducted (Cox 1965). Typically, [PSI+] cells grow in medium lacking adenine (SC-Ade) and the colonies appear white on SC medium, whereas [psi] cells cannot grow in SC-Ade and the colonies appear red on SC. Under conditions in which the foci disappeared, the colony color was white, and the cells were viable on SC-Ade (Fig. 2A), indicating that the [PSI+] phenotype was maintained after the foci disappeared. Secondly, we developed a nonsense suppression assay to distinguish the prion phenotype in individual living cells, as shown schematically in Fig. 2B. [PSI+] cells were transformed with a plasmid encoding a Cu2+-inducible monomeric red fluorescent protein (mRFP) (Campbell et al. 2002), with an N-terminal nuclear localization signal (NLS-mRFP) and a stop codon in the coding region, to monitor nonsense suppression. Although this fluorescent reporter assay is similar to that developed by Satpute-Krishnan & Serio (2005) using GST-DsRed fusion protein, our assay system results in an accumulation of red fluorescence in the nucleus in [PSI+] cells. After the foci disappeared in [PSI+] cells (as shown in Fig. 1A), the addition of Cu2+ resulted in red fluorescence in more than 10% of the nuclei, whereas no red fluorescence was observed in [psi] cells (Fig. 2C). Finally, the punctate foci reappeared when Sup35-GFP was re-induced (Fig. 2D), indicating that the nucleating sites of the foci were not lost in cells after the foci disappeared. Moreover, Fig. 2D also shows the appearance of the foci in the daughter cell at almost same time as when the foci re-appeared in the mother cell, indicating that the nucleating sites are transmitted from the mother to daughter cell. We conclude that the [PSI+] prion phenotype was maintained in cells even in the absence of foci, and therefore we refer to the [PSI+] cells without foci as [PSI+(–foci)] cells.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
 
Figure 2  Maintenance of the [PSI+] phenotype after disappearance of the foci. (A) Conventional assay for nonsense suppressor phenotype. Yeast cells were plated on either SC or SC without adenine (SC-Ade) plates. Photographs were taken after cultivation for 3 days at 30 °C. The [psi] cells were also plated as a control. (B,C) Single-cell read-through assay. (B) Schematic representation of the assay. A stop codon was introduced in a Cu2+-inducible monomeric RFP fused to an N-terminal nuclear localization signal (NLS-mRFP). After induction of the NLS-mRFP, the [PSI+]-dependent read-through leads to the accumulation of red fluorescence in the nucleus. (C) Typical results of the read-through assay. In the [PSI+] cells, Cu2+ was added after the Sup35-GFP foci disappeared. (D) Re-appearance of the Sup35-GFP foci. First, [PSI+] cells bearing fluorescent foci were cultured in SC medium to allow the foci to disappear, as shown in Fig. 1A. After confirmation of the disappearance, the medium was exchanged to SC containing galactose to induce Sup35-GFP. To show the re-appearance of foci, which appeared at almost the same time in both daughter and mother cells, two fluorescent images at different focal planes are shown from 345 min.

 
Fluorescence correlation spectroscopy (FCS) to analyze the size of prion aggregates in living cells

Next, we measured the size of the diffused Sup35-GFP aggregates in the [PSI+(–foci)] cells by exploiting fluorescence correlation spectroscopy (FCS). FCS is a technique to determine the diffusion times of fluorescence molecules by calculating the autocorrelation function in a microscopic detection volume under 10–15 L (1 femtoliter) defined by a tightly focused laser beam and pinhole (Lippincott-Schwartz et al. 2001; Hess et al. 2002), providing us an estimation of the size of aggregates. Since FCS is usually combined with confocal laser scanning microscopy (LSM), we can define the detection volume at any position of interest inside a living cell in a non-invasive manner (Lippincott-Schwartz et al. 2001; Hess et al. 2002).

Prior to the application of FCS to the yeast prion, we tested whether FCS is applicable to living yeast cells since published FCS data are not available for the budding yeast system. Typical fluorescence autocorrelation functions (FAFs) of monomeric GFP (not fused to Sup35) in yeast lysates (solutions) and living cells of [PSI+] and [psi] are shown in Fig. 3A. FAFs of monomeric GFP in the lysates of [PSI+] and [psi] were well fitted by an one-component model. Estimated diffusion times of monomeric GFP in the lysates (~80 µs) were consistent with those described in a previous FCS result (Saito et al. 2003). Compared with the FAFs of GFP in lysates, FAFs of GFP in living cells were shifted to the right, indicating slower diffusional mobility within the cell, which was mainly due to the high viscosity of the yeast cytoplasm. Diffusion profiles of GFP molecules in [PSI+] and [psi] cells were almost the same, reflecting indistinguishable viscosities in the cytoplasm of [PSI+] and [psi]. FAFs of GFP in the cell were fitted by a two-component model. More than 90% of the species were fast-moving, corresponding to the monomeric form of GFP with diffusion times of 300-400 µs.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
 
Figure 3  Fluorescence correlation spectroscopy (FCS) measurement of yeast prion aggregates. (A) Normalized autocorrelation curves of monomeric GFP (not fused with Sup35NM) in lysates and living yeast cells. Diffusion profiles of GFP in the lysates and cytoplasm of [psi] and [PSI+] cells were measured. The autocorrelation curves in the lysates and cells are fitted by one-component model and two-component model, respectively (dotted lines). The ratios of diffusion times in the cells (major component) to those in the lysates (solutions) ({tau}cell/{tau}sol), which allows calculation of the apparent viscosity ratio, {eta}cell/{eta}sol (Equation 4 in Experimental procedures), were approximately 4.3 for [psi] cell and 5.5 for [PSI+] cell, respectively. (B) Normalized autocorrelation curves of Sup35-GFP in living yeast cells. Diffusion profiles of Sup35-GFP in the cytoplasm of [psi], [PSI+(+foci)], and [PSI+(–foci)] cells were measured. The mean ± standard deviations of six independent measurements are shown. (C) Comparison of FCS data with aggregate size measured by semidenaturing agarose gel electrophoresis (inset) of yeast lysates. Yeast lysates obtained from [PSI+] (lane 1) and [psi] (lane 3) cells, and the supernatant from [PSI+] lysate centrifuged at 300 kg (lane 2) were analyzed either by FCS or by electrophoresis. Anti-Sup35NM was used for Western blotting detection. The arrowhead shows the position of the Sup35-GFP monomer. In each panel, the amplitudes of autocorrelation functions were normalized to 2 in order to easily compare the diffusion profiles.

 
After confirming that FCS was applicable to living yeast cells, we measured the fluorescence fluctuations of Sup35-GFP in the cytoplasm of individual cells (Fig. 3B). The autocorrelation decays of Sup35-GFP in [psi] cells (Fig. 3B) were almost the same as those in cells expressing the GFP monomer alone (Fig. 3A), indicating that the [psi] cells contain mostly monomers of Sup35-GFP. In [PSI+(+foci)] cells, we focused the laser on a cytoplasmic region lacking foci. We could not determine the diffusion profiles of the foci themselves. The principle of FCS, in which only freely diffusing molecules are subjects for the measurements, does not allow the measurement of virtually immobilized molecules, such as the foci. The autocorrelation decays of the [PSI+(+foci)] cells exhibited slower profiles than those of the [psi] cells, indicating that the Sup35-GFP species in [PSI+(+foci)] cells were much larger than those in [psi] cells. We then measured the autocorrelation functions of [PSI+(–foci)] cells and found that the autocorrelation profiles of [PSI+(–foci)] cells were indistinguishable from those of [PSI+(+foci)] cells (Fig. 3B). Moreover, we also examined other [PSI+] cells, [GPSI+], in which GFP is inserted between the N and M domains of the endogenous Sup35 (Sup35-NGMC) (Song et al. 2005; Wu et al. 2005), with FCS. Again, the Sup35-NGMC in [GPSI+] cells was larger than that in [Gpsi] cells, confirming that endogenous Sup35 also exists in an oligomeric state (Supplementary Fig. S3). These results indicate that the larger species, referred to here as diffuse oligomers, are dispersed in the cytoplasm of [PSI+] cells, regardless of the presence of foci.

In addition to the live cell FCS analyses, in vitro FCS measurements using the cell lysates also gave different diffusion profiles between [PSI+] and [psi] (Fig. 3C). We found that the Sup35-GFP molecules in the [PSI+] lysate moved much more slowly than those in the [psi] lysate (Fig. 3C), indicating that larger aggregates of Sup35-GFP exist in the [PSI+] lysate. Since a recent biochemical analysis using agarose gel electrophoresis suggested that relatively small Sup35 oligomers are responsible for prion propagation (Kryndushkin et al. 2003), we analyzed the lysates by electrophoresis. As described by Kryndushkin et al. (2003), we also observed 740–4200 kDa Sup35-GFP oligomers in the [PSI+] lysate (Fig. 3C inset, lane 1), which were almost entirely removed by centrifugation at 300 kg for 25 min (Fig. 3C inset, lane 2). In the FCS analysis, the supernatant of the centrifuged sample shifted the diffusion profile of the [PSI+] lysate to the left, and it almost overlapped with the [psi] lysate (Fig. 3C). Therefore, we concluded that the slower diffusion of Sup35-GFP in the [PSI+] lysate was due to the 740–4200 kDa oligomers identified by the electrophoresis.

Direct observation of the oligomer-based transmission to the daughter cells revealed by time-lapse FCS

The non-invasive character of FCS allowed us to focus the laser in daughter cells. We developed a time-lapse FCS system, using the on-chip cultivation system to measure the size of the Sup35-GFP in the daughter cells immediately after transmission from the mother [PSI+] cells. Autocorrelation functions of both the mother and daughter cells were measured as the [PSI+(+foci)] cell was budding (Fig. 4A), under the conditions shown in Fig. 1A). Strikingly, the autocorrelation function of Sup35-GFP in the daughter cell in an early budding step (Fig 4A, 100 min) was almost the same as that in the mother cell, indicating that the diffuse oligomers are transmissible to daughter cells. On average, the diffusion profiles of Sup35-GFP in the daughter cells were almost identical to those of the mother [PSI+] cells (Fig. 4B). These time-lapse FCS results, combined with the retention of the nucleating sites in the daughter cells (Fig. 2D), demonstrate that the oligomeric species dispersed in the mother cells are directly transmitted to their daughter cells.


Figure 4
View larger version (39K):
[in this window]
[in a new window]
 
Figure 4  Transmission of the diffuse oligomers from mother to daughter cell. (A) Autocorrelation functions of mother (blue) and daughter (red) cells obtained by time-lapse FCS measurements. An FCS apparatus equipped with the on-chip microculture system was used to cultivate yeast cells. FCS data of a single [PSI+ (+foci)] cell were repeatedly measured during the cell growth. The formation of the [PSI+(+foci)] cell was as in Fig. 1A. Images in insets show the confocal and light microscopic images (merged) of the growing yeast cell used for the time-lapse FCS analysis. The cross hairs (+) show the positions of the FCS measurements. The averaged autocorrelation function of Sup35-GFP in [psi] cells is shown as a reference (dotted line). (B) Averaged autocorrelation functions of Sup35-GFP in the mother (blue) and daughter (red) [PSI+] cells. FCS data were measured after the appearance of the foci.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Since prions are propagating proteins, how the prion entity is transmitted from cell to cell is central to prion biology. To address the central question, we took two powerful approaches, an on-chip microcultivation system and FCS. The introduction of the two single-cell approaches enabled us to visualize the dynamic nature of prion entities, which cannot be extracted from the experiments based on ensembles of cells in a population. Furthermore, using the time-lapse FCS technique, we directly observed the oligomer-based transmission of yeast prion from the mother to the daughter cell. Although some earlier studies have described the related issue we focused in this study, we consider that our study has decisive advances over the earlier studies as discussed below.

Previous ensemble experiments have suggested that the fluorescent foci are not responsible for [PSI+] (Borchsenius et al. 2001; Wegrzyn et al. 2001; Zhou et al. 2001; Song et al. 2005; Wu et al. 2005). Using the single-cell approaches we directly demonstrated that this is the case. In addition, we clearly observed that the dynamics of the foci, in which the foci were dispersed into the cytoplasm during the cell growth. Relating to this issue, Wu et al. (2005) have recently reported the dynamics of the Sup35-GFP foci after the addition of guanidine HCl, which is known to cure [PSI+]. Our single-cell analysis of Sup35 aggregates clearly revealed that, even in the absence of guanidine HCl, the foci dynamically dispersed into the oligomers, which are large enough to maintain their phenotypical characteristics.

The general understanding on the foci based on the ensemble experiments is one of logical consequences, and thus there is some confusion in the earlier papers. For example, one of the papers has suggested that the foci are dead-end products (Wegrzyn et al. 2001) which is obviously contrary to our conclusion. Another is that the descriptions of the fluorescent foci in two recent publications by the same authors have been different (Song et al. 2005; Wu et al. 2005). The confusion was settled by our clear-cut observations, providing further progress in the prion field.

The findings that the "visible" aggregates (the foci) are not necessary for the prion propagation, suggested by the previous papers, would imply the potential importance of the "invisible" species. We successfully extracted information from the "invisible" entities by using state-of-the-art FCS technique. Dynamical character of the "invisible" fluorescent molecules in cells can be also measured by other technique, fluorescent recovery after photobleaching (FRAP), which has been already applied to Sup35-GFP analysis (Song et al. 2005; Wu et al. 2005). FCS has several advantages such as high sensitivity, broad dynamic range and potential quantitative analysis, compared to FRAP. In particular, FCS has a potential to measure a total number of fluorescent molecules contained in the defined volume, although we did not analyze it because of several technical difficulties at present status. In the near future, FCS is promising to quantitate the number of the prion entities, leading to a direct demonstration of previously estimated number of propagating entities called propagons (Eaglestone et al. 2000; Cox et al. 2003).

Since FCS enables us to extract the information on the prion entities even in living cells, we can investigate the propagating prions at the molecular level. A growing number of studies have analyzed the prion aggregates in the lysates using the semidenaturing agarose gel electrophoresis (Kryndushkin et al. 2003; Bagriantsev & Liebman 2004; Salnikova et al. 2005; Borchsenius et al. 2006; Shkundina et al. 2006). As shown in Fig. 3, FCS analyses shown here provided a link between the in vivo and in vitro observations, and shed new light on the relationship between the altered conformations and the phenotype in living cells. One of the most intriguing questions is that the size of the diffused oligomers in vivo. Although FCS can approach this important question by fitting the autocorrelation curves, we have failed to obtain reliable values on the sizes of the oligomers, due to possible heterogeneous populations with unknown shape of the oligomers. Relating to this question, purified Sup35 easily forms long fibrils that can reach a length longer than the diameter of a yeast cell (e.g. Glover et al. 1997; Inoue et al. 2001b), but so far, such filaments have not been observed in vivo. Future quantitative FCS analysis, such as a distribution analysis of diffusion constants, might provide answers for several basic questions about the sizes and shapes of Sup35 aggregates inside the living cells.

The conclusions presented here are not restricted to yeast prions, but are also related to recent studies on other protein aggregates. The dynamic nature of polyglutamine aggregates has been reported (Kim et al. 2002), and there is a growing body of evidence that the inherent toxicity of protein aggregates is caused by the oligomeric forms, not large aggregates (Bucciantini et al. 2002; Kayed et al. 2003; Cleary et al. 2005; Silveira et al. 2005). The single-cell approach described here is a useful tool for further characterization of the oligomeric forms of proteins inside living cells, which is essential to understand the cellular function of the protein aggregates.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Yeast strains and media

The strains used in this study were 74-D694 (MATa ade1-14 leu2-3112 his3-{Delta}200 trp1-289 ura3-52 [PSI+] or [psi]). Standard rich medium (YPD) and synthetic complete medium (using Difco yeast nitrogen base) lacking leucine (SC-Leu), lacking uracil (SC-Ura), and lacking leucine and uracil (SC-Leu-Ura) were used (Sherman 2002). SRaf-Leu and SRaf-Leu-Ura media contained 2% raffinose instead of glucose. To induce expression of the GAL1 and CUP1 promoters, galactose and CuSO4 were added to final concentrations of 2% and 50 µM, respectively. Yeast strains were grown at 30 °C.

Plasmids

The yeast plasmid YCp-GAL1p-SUP35 (NM)–GFP [LEU2], expressing the Sup35NM domain conjugated to GFP by the galactose inducible GAL1 promoter, was previously described (Ayano et al. 2004). To analyze nonsense suppression at a single-cell level, the yeast plasmid YCp-CUP1-NLS-mRFP [URA3] containing nonsense mutations was constructed. To construct YCp-CUP1-NLS-mRFP, we introduced nonsense mutations into pRSET-B-mRFP (a gift from Dr Roger Tsien) with the QuikChangeTM Site-directed Mutagenesis Kit (Stratagene) using the two sets of primer pairs: mRFP-ochre-F, GAGGACGTCATCAAGTAATTCATGCGCTTCAAG, mRFP-ochre-R, CTTGAAGCGCATGAATTACTTGATGACGTCCTC and mRFP-opal-F, GAGGACGTCATCAAGTGATTCATGCGCTTCAAG, mRFP-opal-R, CTTGAAGCGCATGAATCACTTGATGACGTCCTC and mRFP-amber-F, GAGGACGTCATCAAGTAGTTCATGCGCTTCAAG, mRFP-amber-R, CTTGAAGCGCATGAACTACTTGATGACGTCCTC (underlines are nonsense mutations), and digested them with BamHI and EcoRI. The resulting BamHI-EcoRI fragments were inserted into the yeast plasmid YCp-CUP1p (King 2001) digested with BamHI and EcoRI (YCp-CUP1p-mRFP). The NLS (Nuclear location signal) sequence amplified from the yeast plasmid pYO2568 (a gift from Dr Yoshikazu Ohya) with the two sets of primer pairs: F-BamHINLSGAP, CGCGGATCCATGGATAAAGC and R-BamHINLSGAD, GCGGGATCCCTCTTTTTTTG was digested with BamHI, and inserted into YCp-CUP1p-mRFP. The yeast plasmid YCp-CUP1p-SUP35 (NM)–GFP [URA3], expressing Sup35NM-GFP from a copper inducible CUP1 promoter, is described below. The NM domain region of the entire SUP35 ORF was amplified with primers GCGGGATCCACAATGTCGGATTCAAACCA and CCGGCCGAGCTCTATCGTTAACAAC. The PCR products were digested with BamHI and SacI and inserted into YCp-CUP1p. The GFP fragment was amplified with primers CCGAGCTCCCATGGCTAGCAAAGGAGAAGAA and CCGGCCGAATTCCCACCGCTGCCATG, digested with SacI and EcoRI, and inserted into YCp-CUP1p-SUP35NM.

Single-cell imaging

The on-chip microculture system (Supplementary Fig. 1A) is the same as that previously described (Ayano et al. 2004), except for the microchamber design (Supplementary Fig. S1B), which was designed for long-term cultivation of individual, isolated yeast cells and for efficient exchange of fresh medium. The microcultivation chamber array chip consisted of microchambers positioned on 0.2-mm-thick glass slides. By enclosing the cells in the microchambers, we were able to observe them in liquid medium for a long time without them leaving the field of vision of the objective lens (Inoue et al. 2001a; Umehara et al. 2003; Ayano et al. 2004). The microchamber array, which was made of negative photo-resist SU-8 10 (Microlithography Chemical Co. Newton, MA, USA), was photolighographically microfabricated on a glass slide (Ayano et al. 2004). Each microchamber in the array was designed with a surface area of 1500 µm2 and a 10-µm-high wall. The cultivation system was used with a bright-field optical microscopy system (IX-70 inverted microscopy with a 100x objective lens, Olympus) with a cooled CCD camera (ORCA II-ER, Hamamatsu Photonics) to obtain phase contrast (or differential interference contrast) and fluorescent images. A 10 µL aliquot of a 1 mg/mL bovine serum albumin solution was spread on the microchamber array plate, to prevent the cells from adhering to the microchamber surface. After a 10 min incubation, 10 µL of a mid-log phase yeast culture was dispensed on to the microchamber array plate. The cover was then placed on the microchamber array plate and sealed with polydimethylsiloxane (Dow Corning, Midland, MI, USA). The covered chamber was then connected to the medium tanks and positioned on the stage of the microscope.

During on-chip cultivation, fresh medium was continuously supplied to the chamber system at constant rate of 1 mL/min by a peristaltic pump. A syringe was used for the immediate exchange of medium. Yeast cells were grown in SC-Leu. To induce the expression of Sup35NM-GFP, 2% galactose was used instead of 2% glucose in synthetic medium (SGal-Leu). To stop yeast growth, an isotonic nutrient-free buffer (10 mM potassium phosphate, pH 7.0 and 1.2 M sorbitol) was used. The temperature of the system was maintained at 30 °C throughout the observations by a heated chamber surrounding the microscope.

Nonsense suppressor analysis

For the conventional nonsense suppressor analysis, yeast cells with or without Sup35-GFP foci were plated on SC-Leu and SC-Leu-Ade for 3 days (Serio et al. 1999). For the single-cell translational read-through assay, [PSI+] cells bearing Sup35-GFP foci were transferred to a culture without the inducer (CuSO4). After the disappearance of the GFP-Sup35 foci, NLS-mRFP containing a nonsense mutation (from the YCp-CUP1p-NLS-mRFP plasmid) was induced by adding 50 mM CuSO4. The appearance of mRFP in the nucleus was observed by fluorescence microscopy (IX-71 inverted microscope with an objective lens, x100, Olympus) at 10 h postinduction.

Cell lysis

Yeast strains containing YCp-GAL1p-SUP35(NM)–GFP were grown to mid-log phase in SRaf-Leu. After 2% galactose was added, the yeast were incubated for 4 h at 30 °C. Cells were collected by centrifugation, broken with glass beads (Sigma) by vortexing for 1 min at 4 °C in lysis buffer (50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 10 mM KCl, 0.1 mM EDTA, pH 8.0, 1 mM DTT, CompleteTM protease inhibitor cocktail EDTA-free (Roche)), and incubated for 2 min on ice. This procedure was repeated for 4–6 cycles. The crude lysates were clarified by centrifugation.

Semi-denaturing agarose gel electrophoresis

Yeast lysates were incubated in sample buffer (0.5x TAE, 2% SDS, 5% glycerol and 0.05% bromophenol blue) for 5 min at 37 °C (Kryndushkin et al. 2003), and were fractionated by electrophoresis using horizontal 1.8% agarose gels in Tris-Acetate-EDTA (TAE) buffer containing 0.1% SDS.

Western blotting

Proteins were transferred to a polyvinylidene fluoride membrane (ImmobilonTM, MILLIPORE) and were analyzed by Western blotting. The bound antibody (anti-GFP antibody, a gift from Dr Takayoshi Kuno, anti-Sup35 peptide antibody (Patino et al. 1996), and anti-yeast enolase antibody, a gift from Dr Hidetoshi Iida) was detected using by chemiluminescence (ECL, Amersham Biosciences).

Fluorescence correlation spectroscopy

FCS measurements were all performed at 25 °C with a ConfoCor 2 (Carl Zeiss) microscope as described (Saito et al. 2003; Weisshart et al. 2004). GFP fluorescence was excited at 488 nm with a 6.3 micro W in total power by adjusting the acousto-optical tunable filter (AOTF) to 0.1%. The fluorescence autocorrelation functions (FAF; G({tau})), from which the average residence time ({tau}i) and the absolute number of fluorescent proteins in the detection volume are calculated, are obtained as follows;



Formula

( (eq. 1))

where I(t{tau}) is the fluorescence intensity obtained by the single photon counting method in a detection volume at a delay time {tau} (brackets denote ensemble averages). The curve fitting for the multicomponent model is given by:



Formula

( (eq. 2))

where yi and {tau}i are the fraction and the diffusion time of the component i, respectively, N is the number of fluorescent molecules in the detection volume defined by the beam waist w0 and the axial radius z0, s is the structure parameter representing the ratio of w0 and z0. The detection volume made by w0 and z0 was approximated to that of a cylinder.

All FAFs in aqueous solutions were measured three times for 30 s at 5 s intervals. In the case of intracellular measurements, FAFs were measured one or three times for 15 s. The effect of photobleaching on FCS analysis was minimized by lowering the excitation intensity and by selecting cells with a low to medium GFP expression level. The measurement position was chosen in the confocal image. Because the optical paths of laser-scanning microscopy (LSM) and FCS are not the same, the real position of the FCS measurement was tuned to the position on the LSM images with a cover glass coated with dried rhodamine 6G (Rh6G), which was the protocol provided by the manufacturer (Weisshart et al. 2004). Immediately after each FCS measurement, the cell was again imaged by LSM and checked for displacement. In cases where a cell appeared to have moved, the measurements were discarded. The detection pinhole for FCS was fixed to a diameter of 70 µm and the emission was recorded through a 505–550 nm band pass filter for measurements on living cells. All measured FAFs were fitted by the software installed on the ConfoCor 2 system using the model (eq. 2). FAFs of monomeric GFP in aqueous solution were fitted by a one-component model (i = 1). FAFs of monomeric GFP in living cells and of Sup35-GFP in solutions and living cells were fitted by a two-component model (i = 2) to estimate a fraction of oligomers. The pinhole adjustment of the FCS setup, the structure parameter, and the detection volume were calibrated for 488 nm excitation each day with a Rh6G solution at a concentration of 10–7 M.

Average values of the structure parameter, ranging from 4 to 8, were fixed for FCS analysis throughout this study. The diffusion time of component i, {tau}i, is related to the translational diffusion constant D of component i by



Formula

( (eq. 3))

The diffusion of a spherical molecule is related to various physical parameters by the Stokes-Einstein equation as follows.



Formula

( (eq. 4))

where T is the absolute temperature, ri is the hydrodynamic radius of the spherical molecule, {eta} is the fluid-phase viscosity of the solvent, and {kappa}B is the Boltzman constant. Because {tau}i is proportional to viscosity, the relative viscosity ({tau}cell/{tau}solution) can be easily estimated.


    Acknowledgements
 
We thank K. Tanaka and T. Yamamoto for the cultivation of yeast before the FCS measurement, D. Masison, Y. Kimura, B. Ono, R, Tsien, H. Iida and Y. Ohya for the yeast strains and plasmids, S. Kimura for the gift of molecular weight markers and advice about agarose gel electrophoresis, T. Kuno for the gift of anti-GFP antibody, H. Iida for the gift of anti-enolase antibody, and T. Ueda, B.-W. Ying, S. Saito for stimulating discussions. This work was partly supported by a Grant-in aid for Scientific Research no. 16041207 and 17370034 (to H. T.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and a Japan Society for the Promotion of Science (JSPS) postdoctoral fellowship for foreign researchers (to C.G.P.).


    Footnotes
 
aThese authors contributed equally. Back

Communicated by: Yoshikazu Nakamura

* Correspondence: E-mail: taguchi{at}k.u-tokyo.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Ayano, S., Noma, S., Yoshida, M., Taguchi, H. & Yasuda, K. (2004) On-chip single-cell observation assay for propagation dynamics of yeast Sup35 prionlike proteins. Jpn. J. Appl. Phys. 43, 1429–1432.[CrossRef]

Bagriantsev, S. & Liebman, S.W. (2004) Specificity of prion assembly in vivo. [PSI+] and [PIN+] form separate structures in yeast. J. Biol. Chem. 279, 51042–51048.[Abstract/Free Full Text]

Borchsenius, A.S., Muller, S., Newnam, G.P., Inge-Vechtomov, S.G. & Chernoff, Y.O. (2006) Prion variant maintained only at high levels of the Hsp104 disaggregase. Curr. Genet. 49, 21–29.[CrossRef][Medline]

Borchsenius, A.S., Wegrzyn, R.D., Newnam, G.P., Inge-Vechtomov, S.G. & Chernoff, Y.O. (2001) Yeast prion protein derivative defective in aggregate shearing and production of new "seeds." EMBO J. 20, 6683–6691.[CrossRef][Medline]

Bucciantini, M., Giannoni, E., Chiti, F., Baroni, F., Formigli, L., Zurdo, J., Taddei, N., Ramponi, G., Dobson, C.M. & Stefani, M. (2002) Inherent toxicity of aggregates implies a common mechanism for protein misfolding diseases. Nature 416, 507–511.[CrossRef][Medline]

Campbell, R.E., Tour, O., Palmer, A.E., Steinbach, P.A., Baird, G.S., Zacharias, D.A. & Tsien, R.Y. (2002) A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99, 7877–7882.[Abstract/Free Full Text]

Chien, P., Weissman, J.S. & DePace, A.H. (2004) Emerging principles of conformation-based prion inheritance. Annu. Rev. Biochem. 73, 617–656.[CrossRef][Medline]

Cleary, J.P., Walsh, D.M., Hofmeister, J.J., Shankar, G.M., Kuskowski, M.A., Selkoe, D.J. & Ashe, K.H. (2005) Natural oligomers of the amyloid-ß protein specifically disrupt cognitive function. Nat. Neurosci. 8, 79–84.[CrossRef][Medline]

Cox, B.S. (1965) [PSI], a cytoplasmic suppressor of supersuppression in yeast. Heredity 20, 505–521.[CrossRef]

Cox, B., Ness, F. & Tuite, M. (2003) Analysis of the generation and segregation of propagons: entities that propagate the [PSI+] prion in yeast. Genetics 165, 23–33.[Abstract/Free Full Text]

DePace, A.H., Santoso, A., Hillner, P. & Weissman, J.S. (1998) A critical role for amino-terminal glutamine/asparagine repeats in the. Cell 93, 1241–1252.[CrossRef][Medline]

Derkatch, I.L., Bradley, M.E., Hong, J.Y. & Liebman, S.W. (2001) Prions affect the appearance of other prions: the story of [PIN (+)]. Cell 106, 171–182.[CrossRef][Medline]

Eaglestone, S.S., Ruddock, L.W., Cox, B.S. & Tuite, M.F. (2000) Guanidine hydrochloride blocks a critical step in the propagation of the prion-like determinant [PSI (+)] of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 97, 240–244.[Abstract/Free Full Text]

Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J. & Lindquist, S. (1997) Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae. Cell 89, 811–819.[CrossRef][Medline]

Hess, S.T., Huang, S., Heikal, A.A. & Webb, W.W. (2002) Biological and chemical applications of fluorescence correlation spectroscopy: a review. Biochemistry 41, 697–705.[CrossRef][Medline]

Inoue, Y., Kishimoto, A., Hirao, J., Yoshida, M. & Taguchi, H. (2001b) Strong growth polarity of yeast prion fiber revealed by single fiber imaging. J. Biol. Chem. 276, 35227–35230.[Abstract/Free Full Text]

Inoue, I., Wakamoto, Y., Moriguchi, H., Okano, K. & Yasuda, K. (2001a) On-chip culture system for observation of isolated individual cells. Laboratory Chip 1, 50–55.

Kayed, R., Head, E., Thompson, J.L., McIntire, T.M., Milton, S.C., Cotman, C.W. & Glabe, C.G. (2003) Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science 300, 486–489.[Abstract/Free Full Text]

Kim, S., Nollen, E.A., Kitagawa, K., Bindokas, V.P. & Morimoto, R.I. (2002) Polyglutamine protein aggregates are dynamic. Nat. Cell Biol. 4, 826–831.[CrossRef][Medline]

King, C.Y. (2001) Supporting the structural basis of prion strains: induction and identification of [PSI] variants. J. Mol. Biol. 307, 1247–1260.[CrossRef][Medline]

King, C.Y., Tittmann, P., Gross, H., Gebert, R., Aebi, M. & Wuthrich, K. (1997) Prion-inducing domain 2–114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc. Natl. Acad. Sci. USA 94, 6618–6622.[Abstract/Free Full Text]

Kishimoto, A., Hasegawa, K., Suzuki, H., Taguchi, H., Namba, K. & Yoshida, M. (2004) ß-Helix is a likely core structure of yeast prion Sup35 amyloid fibers. Biochem. Biophys. Res. Commun. 315, 739–745.[CrossRef][Medline]

Kryndushkin, D.S., Alexandrov, I.M., Ter-Avanesyan, M.D. & Kushnirov, V.V. (2003) Yeast [PSI+] prion aggregates are formed by small Sup35 polymers fragmented by Hsp104. J. Biol. Chem. 278, 49636–49643.[Abstract/Free Full Text]

Krzewska, J. & Melki, R. (2006) Molecular chaperones and the assembly of the prion Sup35p, an in vitro study. EMBO J. 25, 822–833.[CrossRef][Medline]

Lippincott-Schwartz, J., Snapp, E. & Kenworthy, A. (2001) Studying protein dynamics in living cells. Nat. Rev. Mol. Cell Biol. 2, 444–456.[CrossRef][Medline]

Osherovich, L.Z. & Weissman, J.S. (2001) Multiple Gln/Asn-rich prion domains confer susceptibility to induction of the yeast [PSI(+)] prion. Cell 106, 183–194.[CrossRef][Medline]

Patino, M.M., Liu, J.J., Glover, J.R. & Lindquist, S. (1996) Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273, 622–626.[Abstract]

Prusiner, S.B. (1998) Prions. Proc. Natl. Acad. Sci. USA 95, 13363–13383.[Abstract/Free Full Text]

Saito, K., Ito, E., Takakuwa, Y., Tamura, M. & Kinjo, M. (2003) In situ observation of mobility and anchoring of PKCbetaI in plasma membrane. FEBS Lett. 541, 126–131.[CrossRef][Medline]

Salnikova, A.B., Kryndushkin, D.S., Smirnov, V.N., Kushnirov, V.V. & Ter-Avanesyan, M.D. (2005) Nonsense suppression in yeast cells overproducing Sup35 (eRF3) is caused by its non-heritable amyloids. J. Biol. Chem. 280, 8808–8812.[Abstract/Free Full Text]

Satpute-Krishnan, P. & Serio, T.R. (2005) Prion protein remodelling confers an immediate phenotypic switch. Nature 437, 262–265.[CrossRef][Medline]

Serio, T.R., Cashikar, A.G., Moslehi, J.J., Kowal, A.S. & Lindquist, S.L. (1999) Yeast prion [psi+] and its determinant, Sup35p. Methods Enzymol. 309, 649–673.[Medline]

Sherman, F. (2002) Getting started with yeast. Methods Enzymol. 350, 3–41.[Medline]

Shkundina, I.S., Kushnirov, V.V., Tuite, M.F. & Ter-Avanesyan, M.D. (2006) The role of the N-Terminal ologopeptide repeats of the yeast Sup35 prion protein in propagation and transmission of prion variants. Genetics 172, 827–835.[Abstract/Free Full Text]

Shorter, J. & Lindquist, S. (2005) Prions as adaptive conduits of memory and inheritance. Nat. Rev. Genet. 6, 435–450.[Medline]

Silveira, J.R., Raymond, G.J., Hughson, A.G., Race, R.E., Sim, V.L., Hayes, S.F. & Caughey, B. (2005) The most infectious prion protein particles. Nature 437, 257–261.[CrossRef][Medline]

Sondheimer, N. & Lindquist, S. (2000) Rnq1: an epigenetic modifier of protein function in yeast. Mol. Cell 5, 163–172.[CrossRef][Medline]

Song, Y., Wu, Y.X., Jung, G., Tutar, Y., Eisenberg, E., Greene, L.E. & Masison, D.C. (2005) Role for Hsp70 chaperone in Saccharomyces cerevisiae prion seed replication. Eukaryot. Cell 4, 289–297.[Abstract/Free Full Text]

Tuite, M.F. & Cox, B.S. (2003) Propagation of yeast prions. Nature Rev. Mol. Cell Biol. 4, 878–890.[CrossRef][Medline]

Umehara, S., Wakamoto, Y., Inoue, I. & Yasuda, K. (2003) On-chip single-cell microcultivation assay for monitoring environmental effects on isolated cells. Biochem. Biophys. Res. Commun. 305, 534–540.[CrossRef][Medline]

Wegrzyn, R.D., Bapat, K., Newnam, G.P., Zink, A.D. & Chernoff, Y.O. (2001) Mechanism of prion loss after Hsp104 inactivation in yeast. Mol. Cell. Biol. 21, 4656–4669.[Abstract/Free Full Text]

Weisshart, K., Jungel, V. & Briddon, S.J. (2004) The LSM 510 META—ConfoCor 2 system: an integrated imaging and spectroscopic platform for single-molecule detection. Curr. Pharm. Biotechnol. 5, 135–154.[CrossRef][Medline]

Weissmann, C. (2004) The state of the prion. Nat. Rev. Microbiol. 2, 861–871.[CrossRef][Medline]

Wickner, R.B., Edskes, H.K., Ross, E.D., Pierce, M.M., Baxa, U., Brachmann, A. & Shewmaker, F. (2004) Prion genetics: new rules for a new kind of gene. Annu. Rev. Genet. 38, 681–707.[CrossRef][Medline]

Wu, Y.X., Greene, L.E., Masison, D.C. & Eisenberg, E. (2005) Curing of yeast [PSI+] prion by guanidine inactivation of Hsp104 does not require cell division. Proc. Natl. Acad. Sci. USA 36, 12789–12794.

Zhou, P., Derkatch, I.L. & Liebman, S.W. (2001) The relationship between visible intracellular aggregates that appear after overexpression of Sup35 and the yeast prion-like elements [PSI(+)] and [PIN(+)]. Mol. Microbiol. 39, 37–46.[CrossRef][Medline]

Received: 17 May 2006
Accepted: 11 June 2006




This article has been cited by other articles:


Home page
GENES CELLSHome page
S. Kawai-Noma, C.-G. Pack, T. Tsuji, M. Kinjo, and H. Taguchi
Single mother-daughter pair analysis to clarify the diffusion properties of yeast prion Sup35 in guanidine-HCl-treated [PSI+] cells
Genes Cells, September 1, 2009; 14(9): 1045 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. A. Pezza, S. X. Langseth, R. Raupp Yamamoto, S. M. Doris, S. P. Ulin, A. R. Salomon, and T. R. Serio
The NatA Acetyltransferase Couples Sup35 Prion Complexes to the [PSI+] Phenotype
Mol. Biol. Cell, February 1, 2009; 20(3): 1068 - 1080.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. Fujiwara and H. Taguchi
Filamentous Morphology in GroE-Depleted Escherichia coli Induced by Impaired Folding of FtsE
J. Bacteriol., August 15, 2007; 189(16): 5860 - 5866.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kawai-Noma, S.
Right arrow Articles by Taguchi, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawai-Noma, S.
Right arrow Articles by Taguchi, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS