GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2007) 12, 1101-1110. doi:10.1111/j.1365-2443.2007.01117.x
© 2007 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teneng, I.
Right arrow Articles by Ramos, K. S.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Teneng, I.
Right arrow Articles by Ramos, K. S.

Context-specific regulation of LINE-1

 Ivo Teneng, Vilius Stribinskis and Kenneth S. Ramos*

Department of Biochemistry and Molecular Biology, and Center for Genetics and Molecular Medicine, University of Louisville, School of Medicine, Louisville KY 40292, USA


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The present study was conducted to evaluate the contextual specificity of long interspersed nuclear element-1 (LINE-1 or L1) activation by cellular stress and the role of the aryl hydrocarbon receptor (AHR) transcription factor and oxidative stress in the gene activation response. Activation of the AHR by the genotoxic carcinogen benzo(a)pyrene (BaP) increased L1 expression in human cervical carcinoma (HeLa) cells, human microvascular endothelial cells (HMEC), mouse vascular smooth muscle cells (mVSMC) and mouse embryonic kidney cells (mK4). In contrast, challenge with a different AHR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), or UV irradiation (10–20 J/m2), induced L1 only in HeLa cells. Transactivation of the mouse L1Md-A5 promoter was observed in all cell types challenged with BaP, while TCDD was without effect, and UV only activated L1 in HeLa cells. Genetic and pharmacological experiments implicated the AHR and oxidative stress as contextual determinants of L1 inducibility by cellular stress.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Retrotransposons propagate throughout the genome via a copy and paste mechanism that involves reverse transcriptase and RNA intermediates. The most characterized and abundant retrotransposon in the mammalian genome is long interspersed nuclear element-1 (LINE-1 or L1). A full-length mammalian L1 is approximately 6 kb in length and contains three major components: a 5' untranslated region (5'UTR), two open reading frames (ORFs), and a 3'UTR with a polyadenylation signal and poly (A) tail (Dombroski et al. 1991). ORF 1 encodes a protein with RNA binding capacity (Yang et al. 2005), while ORF 2 encodes a protein with endonuclease and reverse transcriptase functions necessary for retrotransposition (Feng et al. 1996). The human L1 is transcribed from its internal promoter located within the 5'UTR (Minakami et al. 1992). The promoter of a mouse L1 (L1Md-A5) cloned in this laboratory contains three and two of three repeats (also known as monomers) in their 5'UTR regions (Lu & Ramos 2003). Two of these repeats contain antioxidant/electrophile response elements (ARE/EpREs) which respond to oxidative stress in mouse vascular smooth muscle cells (mVSMCs) (Lu & Ramos 2003).

After transcription, the L1 RNA transcript is exported to the cytoplasm where translation occurs and the RNA forms a ribonucleoprotein complex with its cognate ORF 1 and 2 proteins (Feng et al. 1996). L1 reinsertion involves target-primed reverse transcription in which ORF 2 nicks DNA at the target site, and uses the 3' OH to prime reverse transcription of L1 RNA (Morrish et al. 2002). Due to the non-processive nature of ORF 2, and the presence of premature cryptic polyadenylation sites on the L1 RNA, reverse transcriptase often fails to reach the 5' end during first-strand synthesis resulting in 5' truncated L1s (Han & Boeke 2004). At least 80–100 human (Brouha et al. 2003) and 400 mouse L1s (Goodier et al. 2001) are retrotransposition competent.

Compelling evidence has implicated L1 sequences in the regulation of genome-wide gene expression by acting as a molecular fine-tuner of the transcriptome. About 79% of mammalian genes contain at least one L1 segment in their transcription unit, mainly within intronic regions (Han & Boeke 2005). In a gene profiling analysis using the most highly and most poorly expressed genes, the top five percentile of highly expressed genes had small amounts of L1 elements, while poorly expressed genes had large amounts. In addition, fusion of ORF 2 sequence to the 3' end of a reporter gene significantly lowered steady-state gene expression and protein production by as much as 70-fold (Han & Boeke 2005), indicating that L1 may exert drastic effects on the genome.

Transcriptional regulatory control of L1 gene is not well understood. L1 promoter hypomethylation and associated increases in gene expression have been described in several cancers, including urothelial bladder carcinoma (Florl et al. 1999), testicular tumors (Bratthauer & Fanning 1992), hepatocellular carcinoma (Lin et al. 2001), chronic lymphocytic leukemia (Dante et al. 1992), prostate carcinoma (Santourlidis et al. 1999) and recently chronic myeloid leukemia (Roman-Gomez et al. 2005). Moreover, L1 promoter hypomethylation correlated strongly with progressive prostatic tumors and chromosomal abnormalities (Santourlidis et al. 1999). These data indicate that increased expression of L1 elements may play an important role in disease etiology. Determination of factors that regulate expression of L1 elements would be important in understanding the biology of mammalian L1s. Technically, L1 insertions can alter gene expression and function by insertional inactivation (Kazazian et al. 1988), deletions and rearrangements, and via non-allelic homologous recombination (Casavant et al. 1988), or by introduction of alternative splicing sites causing exon skipping (Takahara et al. 1996; Musova et al. 2006), or activation of cryptic splice sites.

L1 expression is activated as cells undergo de- differentiation or acquire features of malignant or embryonic phenotypes, suggesting that cellular context plays a major role in the regulation of gene expression. In this regard, we have recently shown that stressful environments increase L1 gene expression and retrotransposition competence in transformed HeLa cells (Stribinskis & Ramos 2006). Others have shown that L1 expression increases during UV irradiation-induced transformation in keratinocytes (Banerjee et al. 2005), hypothermic conditions and exposures to ethanol (Li et al. 1999), heat shock, cyclohexamide (Li & Schmid 2001), heavy metals (El-Sawy et al. 2005) and genomic stress by {gamma} irradiation (Farkash et al. 2006). In mouse cells, the activation of L1 may be mediated by proteins that bind in a redox-dependent manner to cis-acting regulatory elements located in the 5'UTR of the L1 gene (Lu & Ramos 2003). It is not yet known if these patterns of gene regulation are cell type- or species-specific.

Benzo(a)pyrene (BaP) and related hydrocarbons bind to the aryl hydrocarbon receptor (AHR) to activate transcription of genes, including those involved in cellular metabolism (Miller & Ramos 2001). The AHR is a basic helix-loop-helix (HLH) and PAS homology domain family transcription factor involved in developmental control and cellular homeostasis (Vogel et al. 2004). The relative expression of AHR is cell context-specific and regulated by ligand binding to the PAS domain (Brauze et al. 2006), and redox stress (Chen & Ramos 2000). Thus, the regulation of L1 by BaP and related hydrocarbon carcinogens may involve activation of AHR signaling and oxidative stress. The present studies were conducted to evaluate the contextual specificity of L1 regulation by environmental stressors and the role of AHR and redox stress in the gene activation response.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Constitutive AHR and L1 expression in mammalian cells

AHR is a basic HLH transcription factor involved in the regulation of mammalian cell differentiation and the cellular response to environmental stress. Therefore, initial studies were completed to evaluate AHR expression levels in human cervical carcinoma cells (HeLa), human microvascular endothelial cells (HMEC), mVSMC and mouse embryonic kidney cells (mK4). These cells are representative of normal (HMEC, mVSMC and mK4) and transformed (HeLa) phenotypes, and express relatively high levels of AHR under constitutive conditions, as measured by Western blotting (Fig. 1a). Protein levels decreased dramatically in cells challenged with the carcinogen BaP, a finding consistent with ubiquitination and subsequent degradation of AHR following ligand activation (Pollenz & Buggy 2006). Interestingly, AHR levels correlated with endogenous L1 mRNA levels, as measured by semiquantitative reverse transcriptase PCR (qRT-PCR), and were highest in mVSMCs and lowest in HMECs (Fig. 1b).


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		Figure 1  Constitutive expression of AHR and L1 mRNA levels in mammalian cells. Total protein was extracted from HeLa, HMEC, VSMC and mK4 cells under constitutive conditions or following treatment with vehicle (DMSO) or 3 µM BaP for 24 h. (a) About 20 µg of total protein from each sample was resolved on a denaturing SDS-PAGE and immunoblotted for AHR or GAPDH as loading controls. (b) Total RNA was extracted from replicating mammalian cells. RNA was quantified and DNAse treated followed by cDNA synthesis (from 0.2 µg starting RNA). After 30 cycles of amplification, PCR products were resolved on a 1% agarose gel.

 
Induction of endogenous L1 by BaP and UV irradiation

The differential expression of AHR and L1 in different mammalian cell types suggests that patterns of L1 regulation by cellular stressors may exhibit cell type and species specificity. To test this hypothesis, endogenous L1 mRNA levels were examined by quantitative real time PCR in HeLa, HMEC, mVSMC and mK4 cells challenged with 3 µM BaP (a genotoxic carcinogen/atherogen) or vehicle (DMSO) for 24 h. BaP binds and activates AHR and induces oxidative stress in mammalian cells (Miller & Ramos 2001). Endogenous L1 expression as measured by real time PCR was induced in all cell types upon carcinogen challenge (Fig. 2a). AHR may participate in context-specific regulation of L1 by BaP. Thus, we next studied whether 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), another potent AHR ligand, induces endogenous L1. Only HeLa cells were responsive to 10 nm TCDD challenge with no induction observed in HMEC, mVSMCs or mK4 cells (Fig. 2b). Indole 3 pyruvate (12.5 µM), an endogenous AHR ligand (Bittinger et al. 2003), did not induce endogenous L1 in any of the cell lines tested (not shown), pointing to cellular context-specific differences in response to different AHR ligands. To focus on the conserved elements of the L1 induction response, subsequent experimentation was carried out in cells treated with BaP.


Figure 2
View larger version (21K):
[in this window]
[in a new window]

  		Figure 2  L1 mRNA levels are up-regulated by BaP in human and murine cells and by TCDD in HeLa cells. Total RNA was isolated and 200 ng subjected to cDNA synthesis. (a) Cells were treated with 3 µM BaP for 24 h, RNA extracted and cDNA synthesized from 200 ng RNA. Samples were analyzed via quantitative real time using human or mouse L1-specific primers. (b) Cells were treated with 10 nM TCDD or toluene (Tol; vehicle) for 24 h and total RNA extracted, cDNA synthesized using 200 ng total RNA, and real time PCR analyses done using L1-specific primers. Normalizations for real time PCR experiments were carried out using ß-actin and GAPDH.

 
AHR ligands and UV irradiation share the ability to induce oxidative stress. Thus, we next determined if DNA damage and oxidative stress by UV was sufficient to induce L1. Induction of GADD45 was used as a positive control for DNA damage (not shown). HeLa, HMEC, mVSMC and mK4 cells each at 80% confluence were treated with 20 J/m2 of UV, RNA was extracted, cDNA synthesized and real time PCR analyses performed using L1-specific primers. A UV dose of 20 J/m2 induced endogenous L1 expression in HeLa cells, while no induction was observed in HMEC, mVSMC or mK4 cells (Fig. 3a). To determine whether activation by UV was redox regulated, HeLa cells were pre-incubated with 0.5 mM glutathione precursor N-acetylcysteine (NAC) for 3 h before UV exposure. Cells were harvested, RNA extracted and processed for real time PCR measurements of L1. Induction of L1 was inhibited by NAC pre-treatment (Fig. 3b).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		Figure 3  Induction of endogenous L1 by UV irradiation in HeLa cells. (a) Cells were harvested 24 h after UV exposure, RNA extracted, cDNA synthesized and real time PCR analyses performed. The DNA repair gene gadd45 was used as control for UV-induced DNA damage (results not shown). (b) The effects of NAC pre-treatment on UV challenge in HeLa cells is shown. NAC pre-treatment inhibits UV-induced L1 activation (n = 3).

 
Homologous and heterologous induction of L1 promoter

The mouse L1 promoter contains repeats of ARE/EpRE-like sequences which may be regulated by AHR-dependent transcriptional events (Lu & Ramos 2003). The 5' tandem monomer repeats of the mouse retrotransposon L1 promoter L1Md-A5, cloned into a luciferase reporter vector (Lu & Ramos 2003), were used in transient transfection assays to further examine contextual specificity of the gene induction response. mVSMCs, mK4 cells, human HeLa and HMEC cells were used in these experiments. About 1 x 104 cells/cm2 of each cell type were transfected at 70% confluence for 24 h with the above described reporter constructs, and later treated with 3 µM BaP for an additional 24 h. Luciferase activity was measured and normalized to Renilla activity. As shown in Fig. 4a, BaP treatment significantly induced promoter activity in all cell types (P < 0.05). These findings indicate that similar trans-regulatory factors participate in the regulation of the L1 promoter in these variant cell types, and that certain elements of the L1 regulatory response are conserved. TCDD did not activate the mouse L1 promoter in any of the cell types examined (not shown).


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		Figure 4  Inducibility of L1Md-A5 promoter in mammalian cells after BaP treatment and UV irradiation. Transient transfection assays showing the promoter activity of L1Md-A5 tandem repeats in HeLa, HMEC, VSMC and mK4 cells, respectively. (a) Triplicate cultures of 1 x 104 cells/cm2 were transfected at 70% confluence in 24-well plates with the L1Md-A5 promoter linked to a luciferase reporter as described (Lu & Ramos 2003). A day after transfection, the cells were treated with 3 µM BaP or DMSO for an additional 24 h, lysed and analyzed for luciferase activity. Luciferase activity was normalized against Renilla luciferase co-transfected with the L1Md-A5-luciferase construct and relative units plotted. Notice the differences in basal activity between the different cell types. (n = 3). (b) Triplicates of 1 x 104 HeLa cells/cm2 were transfected at 70% confluence in 24-well plates with the L1Md-A5-luciferase reporter construct and challenged 24 h later with 10 and 20 J/m2 of ultraviolet irradiation. Media was rinsed off after 24 h and a luciferase assay performed. About 3 µM BaP for 24 h was used as a positive control (n = 3).

 
To further evaluate promoter inducibility by UV, 1 x 104 HeLa cells/cm2 in 24-well plates were transfected at 70% confluence with the L1Md-A5 luciferase reporter construct. After 24 h, cells were challenged with 10 or 20 J/m2 of UV irradiation or BaP as a control for L1 induction. Both doses of UV transactivated the L1 promoter to levels comparable to BaP as shown in Fig. 4b (P < 0.05). These data indicate contextual specificity of the L1 induction response and suggest that L1 activation likely involves DNA damage and oxidative stress mechanisms.

Functional interactions between AHR and L1

Next, we sought to examine the role of AHR in L1 activation using pharmacological and genetic approaches. mVSMCs were pre-treated with the AHR antagonist {alpha}-naphthoflavone ({alpha}-NP) for 3 h followed by challenge with 3 µM BaP for 24 h. Titration experiments (0.1–50 µM) using CYP1A1 induction as a readout identified 5 µM as the optimum {alpha}-NP concentration for AHR inhibition (not shown). Cells pre-treated for 3 h with 5 µM {alpha}-NP showed significant inhibition of BaP-induced L1 expression in real time PCR analyses, suggesting that AHR signaling participates in the L1 induction response (Fig. 5a). A similar protective effect of {alpha}-NP was seen in HeLa cells (not shown).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		Figure 5  Influence of AHR phenotype on L1 activation profiles by BaP. Mouse AHR+/+ and AHR–/– VSMCs were treated with 3 µM BaP or an equal volume of DMSO in complete medium containing 10% serum for 24 h. Total RNA was isolated from cells and cDNA was synthesized from 200 ng of DNAase-treated RNA followed by real time PCR analyses (a). In experiments involving pharmacological inhibition of AHR, cells were pre-treated for 1 h with 5 µM {alpha}-NP followed by 3 µM BaP treatment for 24 h. Similar results were seen in two separate experiments. The AHR locus was PCR amplified to verify the genotype of AHR-null mVSMCs (b).

 
To investigate the hypothesis genetically, we challenged AHR-null mVSMCs with 3 µM BaP and compared endogenous L1 levels with DMSO and non-treated cells. Treatment with 3 µM BaP for 24 h had no effect on endogenous L1 expression in AHR-null cells in real time PCR analyses (Fig. 5a). The AHR locus was amplified by PCR to verify the genotype of AHR-null mVSMCs (Fig. 5b). Next, we used siRNA silencing experiments to examine the role of AHR in L1 induction in HeLa cells. Forty-eight hours post-transfection with 50 nM siRNA, HeLa cells were treated with BaP for 24 h, RNA was extracted, processed for cDNA synthesis and analyzed in 30 rounds of PCR for L1 expression. Silencing AHR decreased endogenous L1 mRNA levels in control, and DMSO- and BaP-treated HeLa cells, compared to cells treated with scrambled siRNA or left untreated (Fig. 6a). AHR knockdown was confirmed by Western blotting (Fig. 6b). In follow-up experiments, HeLa cells were pre-treated with AHR siRNA and then transiently co-transfected for 24 h with 1.0 µg pSPORT AHR and the L1Md-A5 promoter construct. Cells were then challenged with BaP to assess L1Md-A5 promoter inducibility. Likewise, silencing AHR in HeLa cells abrogated BaP-induced L1Md-A5 promoter transactivation, and this response was restored upon re-expression of ectopic AHR (Fig. 7). We conclude that stress-induced L1 activation is context-specific, and dependent upon cellular AHR status.


Figure 6
View larger version (27K):
[in this window]
[in a new window]

  		Figure 6  siRNA targeting AHR reduces endogenous L1 expression in HeLa cells. Endogenous L1 expression in HeLa cells upon challenge with 3 µM BaP following siRNA (50 nM) treatment targeting AHR (a). Receptor down-regulation was confirmed by Western blotting (b). Total RNA was isolated, treated with DNAse, cDNA synthesized and 30 cycles of PCR performed (n = 2). Cyp 1a1, a known AHR-regulated gene, was analyzed as a control for AHR signaling.

 

Figure 7
View larger version (8K):
[in this window]
[in a new window]

  		Figure 7  AHR phenotype affects BaP inducibility of L1Md-A5 in HeLa cells. At 60% confluence, triplicate cultures of 1 x 104 cells/cm2 were treated with siRNA targeting AHR for 24 h. Cells were then transfected with the L1MdA5 luciferase reporter construct and 24 h later challenged with 3 µM BaP or vector (DMSO), lysed and analyzed for luciferase activity. To restore the AHR phenotype, siRNA-treated cells were transfected with 1.0 µg SV40 promoter-driven pSPORT-AHR expression plasmid. Luciferase activity was normalized against Renilla and the relative units plotted (n = 2). Proof of concept experiments showed that neither control siRNA nor mock transfecting cells had any effect on L1 promoter activity.

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
Mammalian cells have evolved sophisticated silencing systems to regulate L1 gene expression that involve: (i) DNA hypermethylation of the L1 promoter to maintain chromatin in a compacted state (Woodcock et al. 1997); (ii) bidirectional processing of small L1 transcripts to siRNAs that suppress L1 (Yang & Kazazian 2006); (iii) transcriptional elongation deficiencies caused by premature polyadenylation sites (Perepelitsa-Belancio & Deininger 2003; Han & Boeke 2004); (iv) truncation of 5'UTR sequences that inhibit reverse transcription during retrotransposition (Myers et al. 2002); and (v) recruitment of repressor proteins that interact with the L1 promoter or internal ribosome entry sites (Li et al. 2006). Therefore, the activation of L1 by environmental stressors may involve interference with one or more of these mechanisms. The positive correlation between AHR and endogenous L1 expression implicates this transcription factor in the regulation of L1 in mammalian cells. This hypothesis is consistent with the finding that modulation of L1 expression can be achieved by challenge with exogenous AHR ligands and that genetic and pharmacological manipulation of AHR functions influences L1 expression.

In our study, BaP was the only stressor that activated L1 in all cell types, whether mesenchymal or epithelial, normal or transformed. Gene regulation by BaP involves recruitment of proteins, such as AHR or Nrf-2, that bind to cis elements within the regulatory region of target genes (Chen & Ramos 2000). AHR functions as a transcriptional regulator of genes involved in bioactivation of BaP to intermediates that cause DNA damage and oxidative stress (Kerzee & Ramos 2000), and bind to redox-regulated elements in BaP target genes (Miller & Ramos 2005). A role for AHR in the regulation of L1 is consistent with the ability of TCDD, a potent activator of AHR, to induce L1 in HeLa cells. However, molecular interactions are complex since TCDD was without effect in mVSMCs mK4 or HMECs, and did not transactivate the mouse promoter. Previously we have shown that the L1Md-A5 promoter is regulated by BaP in a redox-dependent manner (Lu & Ramos 2003). Consistency in L1Md-A5 promoter inducibility under homologous and heterologous conditions suggests that similar cis–trans regulatory interactions participate in the regulation of L1 in different cell types, and that assembly of protein factors in both human and mouse cells shares common elements. Given that TCDD is not directly genotoxic (Cole et al. 2003), and only modestly induces oxidative stress (Zhao et al. 1998), L1 activation may require the activation of AHR under conditions of genomic stress, as would be seen following covalent adduct formation or oxidative DNA damage in cells treated with BaP or UV irradiation. This is consistent with studies showing that L1 expression is linked to genomic instability and modifications of chromatin structure (Gilbert et al. 2004). We have previously reported that TCDD modestly activated the L1 promoter in mVSMC (Lu & Ramos, 2003). The discrepancy between those findings and these data may be accounted for by differences in proliferation status since L1 activation profiles are cell cycle-dependent (D. Montoya-Durango and K. S. Ramos, unpublished data).

An L1 network in mammalian cells was recently resolved using genomics and bioinformatics approaches, with members of the PAS homology domain superfamily of proteins (of which AHR is a member) identified as primary nodes (Ramos et al. 2007). Evidence for an AHR–L1 axis includes the inhibition of BaP inducibility by {alpha}NP, the refractoriness of AHR-null mVSMCs to BaP challenge, the inhibition of both endogenous L1 and L1Md-A5 promoter activity by genetic knockdown of AHR in HeLa cells and the restoration of promoter responsiveness following ectopic re-expression of the receptor. Additional mechanisms are involved in the regulation of L1 since UV irradiation activated L1 in a redox-dependent manner. Induction of endogenous L1 by UV irradiation was only seen in HeLa cells. UV irradiation is associated with DNA single- and double-strand breaks and double helix distortions (Squires et al. 2004). Thus, UV may facilitate L1 propagation, not simply as a general stressor, but by providing pre-nicked sites for reverse transcription and reinsertion (Farkash & Prak 2006). This interpretation is consistent with the dependence of propagation on endonuclease activity at initiation and insertion sites (Feng et al. 1996). L1 regulation by UV was redox dependent since pre-treatment of HeLa cells with the antioxidant NAC abrogated endogenous L1 induction. Farkash et al. (2006) have shown that increases in L1 retrotransposition by {gamma} irradiation cause genomic instability by induction of phosphorylated H2AX foci. Cells respond to DNA damage by triggering DNA repair mechanisms involving recruitment and phosphorylation of H2AX and ATM at lesion sites (Suzuki et al. 2006). These proteins play important roles in DNA damage sensing and repair response (Skalka & Katz 2005). Differences in H2AX foci and sensitivity to irradiation between different cells and species may in fact be accounted for by differences in cellular ATM levels (Kato et al. 2006). ATM has been implicated in L1 retrotransposition and {gamma} irradiation-induced H2AX foci in HeLa cells (Gasior et al. 2006). Additional work is needed to elucidate the role of DNA repair mechanisms in control of L1.

Environmental stressors may also modulate the methylation status of L1 or the methylation marks of accessory DNA-binding proteins involved in the regulation of chromatin structure. Aromatic hydrocarbons and oxidative stress are known to modulate patterns of gene methylation in mammalian cells (Varela-Moreiras et al. 1995; Hu et al. 2003; Purohit et al. 2005; Sadikovic & Rodenhiser 2006). A recent report has shown that induction of CYP1B1 mRNA by TCDD in PC3 prostate cancer cells is accompanied by promoter hypomethylation (Tokizane et al. 2005). As such, stress-induced changes in methylation status may regulate L1 expression, a hypothesis consistent with L1 promoter hypomethylation in several forms of cancer (Bratthauer & Fanning 1992; Dante et al. 1992; Florl et al. 1999; Santourlidis et al. 1999; Lin et al. 2001; Roman-Gomez et al. 2005). Thus, the involvement of AHR in the regulation of L1 may involve dysregulation of genomic DNA or protein methylation status.

The similarities in response between mouse and human cell lines indicate that certain elements of the L1 response are conserved across evolutionary lines. However, by virtue of differences in their genetic and epigenetic programs, the cellular response to stress is regulated in a context-specific manner. In the case of L1, our comparative analyses show that cellular stress regulation of L1 varies depending on the type of stressor, and have identified AHR and oxidative signaling as required elements of the L1 regulatory response. These findings open the door for study of molecular mechanisms that control L1 expression in mammalian cells.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Cell cultures

mVSMCs and mK4 cells were grown in M199, while HeLa cells were grown in DMEM, all supplemented with 10% FBS and 1% penicillin–streptomycin. HMEC cells were grown in DMEM-F12 medium supplemented with growth factors, 10% serum and 1% antibiotics.

Antibodies and chemicals

Anti-AHR and GAPDH antibodies were obtained from BIOMOL Research Laboratories (Plymouth Meeting, PA) and Santa Cruz Biochemicals, respectively. BaP, TCDD, {alpha}-NP and NAC were purchased from Sigma. siRNA targeting the AHR were obtained from Ambion while lipofectamine 2000, Fugene 6, and cDNA synthesis and PCR reagents were purchased from Invitrogen. Penicillin/streptomycin was purchased from GIBCOTM.

Luciferase reporter assays

About 1 x 104 cells/cm2 were seeded on 24-well plates (500 µL each) and transfected with Fugene 6 (Invitrogen) at semi-confluence with the mouse 5'UTR–luciferase reporter construct which has ARE-like sequences. Twenty-four hours post-transfection, cells were challenged with 3 µM BaP, 1 and 10 nM TCDD, and 10 or 20 J/m2 of ultraviolet irradiation. After 24 h, cells were lysed and a luciferase promoter assay performed using the Promega Dual Luciferase Reporter Assay system and read out from a manual luminometer. All treatments were done in triplicate, and luciferase readings were normalized to internal control, Renilla luciferase. Statistical differences were examined by ANOVA using SAS/STAT software.

Semiquantitative and quantitative real time PCR

About 1 x 104 HeLa cells/cm2 were seeded in six-well plates (2 mL total), and 24 h later, cells were challenged with 3 µM BaP, 10 nM TCDD or 10–20 J/m2 of UV. Total RNA was extracted and quantified. About 200–500 ng total RNA was used for cDNA synthesis followed by 30 cycles of PCR for regular PCR experiments. For real time PCR analyses, the double strand DNA binding dye method was used to measure RNA levels. Following reverse transcription, real time amplifications were performed as follows using SYBR Green (BIORAD). For each reaction, 25 µL of 2x SYBR green was mixed with 10 µM final concentration of forward and reverse primers. About 1 µL of cDNA was added and volume brought up to 50 µL with DEPC water. Cycling conditions were as follows: initial denaturation step at 95 °C for 3 min, and 50 cycles at 95 °C for 30 s, 55 °C for 30 s and 72 °C for 45 s. All experiments were completed in triplicate. Statistical analyses were done by ANOVA using SAS/STAT software ({alpha} = 0.05).

Primers for human ß-actin—forward: 5'TTCAT CCCTATTCTTCGCTAC3', reverse: 5'TC CATCAGCATCTATGTGGC3'; human GADD45—forward: 5'CTGGAGAGCAGAAG ACCGAAAGG3', reverse: 5'GGCAGGATCCTTCCATTGA GATGA3'; human CYP1A1—forward: 5'TTCATCCCTATTCGCT AC3', reverse: 5'TCC ATCAGCATCTATGTGGC3'; mouse L1ORF 1—forward: 5'CTGGAGAG CAGAAGACCGAAAGG3', reverse: 5'ACACACCGAAAATCTAGAC3'; mouse GAPDH—forward: 5'CATTTGCAGTGGCAAAGT3', reverse: 5'ATTTCYCGTGGTTVACACCC 3'; mouse GADD45—forward: 5'GAGCGACAACGCGGTTCAGAAGA3', reverse: 5'CTTCACAGTAA CTGGCCACCTCC3'; mouse CYP1A1—forward: 5'TGGTGTCAGTAGCCAATGTC3', reverse: VGCATCCAGGGAAGAGTTAGG; and mouse AHR—forward: 5'TTCTATGCTTCCTCCACTACTATCC3', reverse: 5'GGCTTCGTCC ACTCCTTG3'.

Anti-AHR oligonucleotides

About 1 x 104 cells/cm2 were seeded and 24 h later transfected with siRNA (sequence) using lipofectamine 2000TM (Invitrogen). After 48–72 h, cells were harvested or treated as described and analyzed for RNA or protein by real time PCR or 30 cycles of regular PCR or Western blotting, respectively. Oliogonucleotides to AHR targeted exon 2.

Western blots

Total cell protein was isolated using Mammalian Protein Extraction Reagent (MPERTM) reagent supplemented with 1x protease inhibitor cocktail (PIERCE). Cell lysates were fractionated by 10%–12% SDS-PAGE and transferred to PVDF membranes overnight followed by blocking with 5% non-fat skim milk or BSA. PVDF membranes were probed with antibodies against AHR or GAPDH in 1x Tris-buffered saline overnight in a cold chamber followed by HRP-conjugated secondary antibody at room temperature for 1 h. Blots were developed using West Dura chemiluminescent Western blot detection reagent (PIERCE) and visualized using an X-ray film.


   Acknowledgements
 
This work was supported by NIH grant 5R01 ES004849 to K.S.R. The pSPORT–AHR expression plasmids were kindly provided by Dr Christopher A. Bradfield and AHR–/– cells were kindly provided by Dr Alvaro Puga. We thank Dr Diego Montoya Durango for his editorial review of the manuscript, and Qiang He for his assistance in statistical analyses of luciferase and quantitative real time PCR data.


   Footnotes
 
Communicated by: Masayuki Yamamoto

* Correspondence: E-mail: kenneth.ramos{at}louisville.edu


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Banerjee, G., Gupta, N., Tiwari, J. & Raman, G. (2005) Ultraviolet-induced transformation of keratinocytes: possible involvement of long interspersed element-1 reverse transcriptase. Photodermatol. Photoimmunol. Photomed. 21, 32–39.[CrossRef][Medline]

Bittinger, M.A., Nguyen, L.P. & Bradfield, C.A. (2003) Aspartate aminotransferase generates proagonists of the aryl hydrocarbon receptor. Mol. Pharmacol. 64, 550–556.[Abstract/Free Full Text]

Bratthauer, G.L. & Fanning, T.G. (1992) Active LINE-1 retrotransposons in human testicular cancer. Oncogene 7, 507–510.[Medline]

Brauze, D., Widerak, M., Cwykiel, J., Szyfter, K. & Baer-Dubowska, W. (2006) The effect of aryl hydrocarbon receptor ligands on the expression of AhR, AhRR, ARNT, Hif1{alpha}, CYP1A1 and NQO1 genes in rat liver. Toxicol. Lett. 167, 212–220.[CrossRef][Medline]

Brouha, B., Schustak, J., Badge, R.M., Lutz-Prigge, S., Farley, A.H., Moran, J.V. & Kazazian, H.H. Jr (2003) Hot L1s account for the bulk of retrotransposition in the human population. Proc. Natl. Acad. Sci. USA 100, 5280–5285.[Abstract/Free Full Text]

Casavant, N.C., Hardies, S.C., Funk, F.D., Comer, M.B., Edgell, M.H. & Hutchison, C.A., 3rd (1988) Extensive movement of LINES ONE sequences in ß-globin loci of Mus caroli and Mus domesticus. Mol. Cell. Biol. 8, 4669–4674.[Abstract/Free Full Text]

Chen, Y.H. & Ramos, K.S. (2000) A CCAAT/enhancer-binding protein site within antioxidant/electrophile response element along with CREB-binding protein participate in the negative regulation of rat GST-Ya gene in vascular smooth muscle cells. J. Biochem. 275.

Cole, P., Trichopoulos, D., Pastides, H., Starr, T. & Mandel, J.S. (2003) Dioxin and cancer: a critical review. Regul. Toxicol. Pharmacol. 38, 378–388.[CrossRef][Medline]

Dante, R., Dante-Paire, J., Rigal, D. & Roizes, G. (1992) Methylation patterns of long interspersed repeated DNA and alphoid repetitive DNA from human cell lines and tumors. Anticancer Res. 12, 559–563.[Medline]

Dombroski, B.A., Mathias, S.L., Nanthakumar, E., Scott, A.F. & Kazazian, H.H. Jr (1991) Isolation of an active human transposable element. Science 254, 1805–1808.[Abstract/Free Full Text]

El-Sawy, M., Kale, S.P., Dugan, C., Nguyen, T.Q., Belancio, V., Bruch, H., Roy-Engel, A.M. & Deininger, P.L. (2005) Nickel stimulates L1 retrotransposition by a post-transcriptional mechanism. J. Mol. Biol. 354, 246–257.[CrossRef][Medline]

Farkash, E.A., Kao, G.D., Horman, S.R. & Prak, E.T. (2006) {gamma} radiation increases endonuclease-dependent L1 retrotransposition in a cultured cell assay. Nucleic Acids Res. 34, 1196–1204.[Abstract/Free Full Text]

Farkash, E.A. & Prak, E.T. (2006) DNA damage and l1 retrotransposition. J. Biomed. Biotechnol. 2006, 1–8.

Feng, Q., Moran, J.V., Kazazian, H.H. Jr & Boeke, J.D. (1996) Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition. Cell 87, 905–916.[CrossRef][Medline]

Florl, A.R., Lower, R., Schmitz-Drager, B.J. & Schulz, W.A. (1999) DNA methylation and expression of LINE-1 and HERV-K provirus sequences in urothelial and renal cell carcinomas. Br. J. Cancer 80, 1312–1321.[CrossRef][Medline]

Gasior, S.L., Wakeman, T.P., Xu, B. & Deininger, P.L. (2006) The human LINE-1 retrotransposon creates DNA double-strand breaks. J. Mol. Biol. 357, 1383–1393.[CrossRef][Medline]

Gilbert, N., Doucet, A.J. & Bucheton, A. (2004) Genomic instability associated with human LINE-1 retrotransposition (French). J. Soc. Biol. 198, 419–424.[Medline]

Goodier, J.L., Ostertag, E.M., Du, K. & Kazazian, H.H. Jr (2001) A novel active L1 retrotransposon subfamily in the mouse. Genome Res. 11, 1677–1685.[Abstract/Free Full Text]

Han, J.S. & Boeke, J.D. (2004) A highly active synthetic mammalian retrotransposon. Nature 429, 314–318.[CrossRef][Medline]

Han, J.S. & Boeke, J.D. (2005) LINE-1 retrotransposons: modulators of quantity and quality of mammalian gene expression? Bioessays 27, 775–784.[CrossRef][Medline]

Hu, W., Feng, Z. & Tang, M.S. (2003) Preferential carcinogen-DNA adduct formation at codons 12 and 14 in the human K-ras gene and their possible mechanisms. Biochemistry 42, 10012–10023.[CrossRef][Medline]

Kato, T.A., Nagasawa, H., Weil, M.M., Genik, P.C., Little, J.B. & Bedford, J.S. (2006) {gamma}-H2AX foci after low-dose-rate irradiation reveal atm haploinsufficiency in mice. Radiat. Res. 166, 47–54.[CrossRef][Medline]

Kazazian, H.H. Jr, Wong, C., Youssoufian, H., Scott, A.F., Phillips, D.G. & Antonarakis, S.E. (1988) Haemophilia A resulting from de novo insertion of L1 sequences represents a novel mechanism for mutation in man. Nature 332, 164–166.[CrossRef][Medline]

Kerzee, J.K. & Ramos, K.S. (2000) Activation of c-Ha-ras by benzo(a)pyrene in vascular smooth muscle cells involves redox stress and aryl hydrocarbon receptor. Mol. Pharmacol. 58, 152–158.[Abstract/Free Full Text]

Li, P.W., Li, J., Timmerman, S.L., Krushel, L.A. & Martin, S.L. (2006) The dicistronic RNA from the mouse LINE-1 retrotransposon contains an internal ribosome entry site upstream of each ORF: implications for retrotransposition. Nucleic Acids Res. 34, 853–864.[Abstract/Free Full Text]

Li, T., Spearow, J., Rubin, C.M. & Schmid, C.W. (1999) Physiological stresses increase mouse short interspersed element (SINE) RNA expression in vivo. Gene 239, 367–372.[CrossRef][Medline]

Li, T.H. & Schmid, C.W. (2001) Differential stress induction of individual Alu loci: implications for transcription and retrotransposition. Gene 276, 135–141.[CrossRef][Medline]

Lin, C.H., Hsieh, S.Y., Sheen, I.S., Lee, W.C., Chen, T.C., Shyu, W.C. & Liaw, Y.F. (2001) Genome-wide hypomethylation in hepatocellular carcinogenesis. Cancer Res. 61, 4238–4243.[Abstract/Free Full Text]

Lu, K.P. & Ramos, K.S. (2003) Redox regulation of a novel L1Md-A2 retrotransposon in vascular smooth muscle cells. J. Biol. Chem. 278, 28201–28209.[Abstract/Free Full Text]

Miller, K. & Ramos, K. (2001) Impact of metabolism on the biological effects of benzo(a)pyrene and related hydrocarbons. Drug Metab. Rev. 33, 1–35.[CrossRef][Medline]

Miller, K.P. & Ramos, K.S. (2005) DNA sequence specificity of nuclear protein binding to c-Ha-ras antioxidant/electrophile response element in vascular smooth muscle cells. Cell Stress Chaperones 10, 114–125.

Minakami, R., Kurose, K., Etoh, K., Furuhata, Y., Hattori, M. & Sakaki, Y. (1992) Identification of an internal cis-element essential for the human L1 transcription and a nuclear factor(s) binding to the element. Nucleic Acids Res. 20, 3139–3145.[Abstract/Free Full Text]

Morrish, T.A., Gilbert, N., Myers, J.S., Vincent, B.J., Stamato, T.D., Taccioli, G.E., Batzer, M.A. & Moran, J.V. (2002) DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nat Genet. 31, 159–165.[CrossRef][Medline]

Musova, Z., Hedvicakova, P., Mohrmann, M., Tesarova, M., Krepelova, A., Zeman, J. & Sedlacek, Z. (2006) A novel insertion of a rearranged L1 element in exon 44 of the dystrophin gene: further evidence for possible bias in retroposon integration. Biochem. Biophys. Res. Commun. 347, 145–149.[CrossRef][Medline]

Myers, J.S., Vincent, B.J., Udall, H., Watkins, W.S., Morrish, T.A., Kilroy, G.E., Swergold, G.D., Henke, J., Henke, L., Moran, J.V., Jorde, L.B. & Batzer, M.A. (2002) A comprehensive analysis of recently integrated human Ta L1 elements. Am. J. Hum. Genet. 71, 312–326.[CrossRef][Medline]

Perepelitsa-Belancio, V. & Deininger, P. (2003) RNA truncation by premature polyadenylation attenuates human mobile element activity. Nat. Genet. 35, 363–366.[CrossRef][Medline]

Pollenz, R.S. & Buggy, C. (2006) Ligand-dependent and -independent degradation of the human aryl hydrocarbon receptor (hAHR) in cell culture models. Chem. Biol. Interact. 164, 49–59.[CrossRef][Medline]

Purohit, V., Khalsa, J. & Serrano, J. (2005) Mechanisms of alcohol-associated cancers: introduction and summary of the symposium. Alcohol 35, 155–160.[CrossRef][Medline]

Ramos, K.S., He, Q., Kalbfleisch, T., Stribinskis, V. & Brun, M. (2007) Computational inference of gene regulatory networks of LINE-1 retrotransposon. Genomics 90, 176–185.[CrossRef][Medline]

Roman-Gomez, J., Jimenez-Velasco, A., Agirre, X., Cervantes, F., Sanchez, J., Garate, L., Barrios, M., Castillejo, J.A., Navarro, G., Colomer, D., Prosper, F., Heiniger, A. & Torres, A. (2005) Promoter hypomethylation of the LINE-1 retrotransposable elements activates sense/antisense transcription and marks the progression of chronic myeloid leukemia. Oncogene 24, 7213–7223.[CrossRef][Medline]

Sadikovic, B. & Rodenhiser, D.I. (2006) Benzopyrene exposure disrupts DNA methylation and growth dynamics in breast cancer cells. Toxicol. Appl. Pharmacol. 216, 458–468.[CrossRef][Medline]

Santourlidis, S., Florl, A., Ackermann, R., Wirtz, H.C. & Schulz, W.A. (1999) High frequency of alterations in DNA methylation in adenocarcinoma of the prostate. Prostate 39, 166–174.[CrossRef][Medline]

Skalka, A.M. & Katz, R.A. (2005) Retroviral DNA integration and the DNA damage response. Cell Death Differ. 12 (Suppl. 1), 971–978.[CrossRef][Medline]

Squires, S., Coates, J.A., Goldberg, M., Toji, L.H., Jackson, S.P., Clarke, D.J. & Johnson, R.T. (2004) p53 prevents the accumulation of double-strand DNA breaks at stalled-replication forks induced by UV in human cells. Cell Cycle 3, 1543–1557.[Medline]

Stribinskis, V. & Ramos, K.S. (2006) Activation of human long interspersed nuclear element 1 retrotransposition by benzo(a)pyrene, an ubiquitous environmental carcinogen. Cancer Res. 66, 2616–2620.[Abstract/Free Full Text]

Suzuki, K., Okada, H., Yamauchi, M., Oka, Y., Kodama, S. & Watanabe, M. (2006) Qualitative and quantitative analysis of phosphorylated ATM foci induced by low-dose ionizing radiation. Radiat. Res. 165, 499–504.[CrossRef][Medline]

Takahara, T., Ohsumi, T., Kuromitsu, J., Shibata, K., Sasaki, N., Okazaki, Y., Shibata, H., Sato, S., Yoshiki, A., Kusakabe, M., Muramatsu, M., Ueki, M., Okuda, K. & Hayashizaki, Y. (1996) Dysfunction of the Orleans reeler gene arising from exon skipping due to transposition of a full-length copy of an active L1 sequence into the skipped exon. Hum. Mol. Genet. 5, 989–993.[Abstract/Free Full Text]

Tokizane, T., Shiina, H., Igawa, M., Enokida, H., Urakami, S., Kawakami, T., Ogishima, T., Okino, S.T., Li, L.C., Tanaka, Y., Nonomura, N., Okuyama, A. & Dahiya, R. (2005) Cytochrome P450 1B1 is overexpressed and regulated by hypomethylation in prostate cancer. Clin. Cancer Res. 11, 5793–5801.[Abstract/Free Full Text]

Varela-Moreiras, G., Alonso-Aperte, E., Rubio, M., Gasso, M., Deulofeu, R., Alvarez, L., Caballeria, J., Rodes, J. & Mato, J.M. (1995) Carbon tetrachloride-induced hepatic injury is associated with global DNA hypomethylation and homocysteinemia: effect of S-adenosylmethionine treatment. Hepatology 22, 1310–1315.[CrossRef][Medline]

Vogel, C.F., Sciullo, E. & Matsumura, F. (2004) Activation of inflammatory mediators and potential role of ah-receptor ligands in foam cell formation. Cardiovasc. Toxicol. 4, 363–373.[CrossRef][Medline]

Woodcock, D.M., Lawler, C.B., Linsenmeyer, M.E., Doherty, J.P. & Warren, W.D. (1997) Asymmetric methylation in the hypermethylated CpG promoter region of the human L1 retrotransposon. J. Biol. Chem. 272, 7810–7816.[Abstract/Free Full Text]

Yang, N. & Kazazian, H.H. Jr (2006) L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in human cultured cells. Nat. Struct. Mol. Biol. 13, 763–771.[CrossRef][Medline]

Yang, N., Zhang, L. & Kazazian, H.H. Jr (2005) L1 retrotransposon-mediated stable gene silencing. Nucleic Acids Res. 33, e57.

Zhao, W., Parrish, A.R. & Ramos, K.S. (1998) Constitutive and inducible expression of cytochrome P450IA1 and IB1 in human vascular endothelial and smooth muscle cells. In Vitro Cell. Dev. Biol. 34, 671–673.[CrossRef]

Received: 6 February 2007
Accepted: 13 June 2007





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teneng, I.
Right arrow Articles by Ramos, K. S.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Teneng, I.
Right arrow Articles by Ramos, K. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS