GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2007) 12, 311-328. doi:10.1111/j.1365-2443.2007.01053.x
© 2007 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Takahashi, K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kobayashi, Y.
Right arrow Articles by Takahashi, K.

The fission yeast DASH complex is essential for satisfying the spindle assembly checkpoint induced by defects in the inner-kinetochore proteins

Yasuyo Kobayashi, Shigeaki Saitoh, Yuki Ogiyama, Saeko Soejima and Kohta Takahashi*

Division of Cell Biology, Institute of Life Science, Kurume University, Fukuoka, 839-0864, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Spindle assembly checkpoint (SAC) is an evolutionarily conserved surveillance system for chromosome missegregation. We isolated fission yeast Hos2, a component of the Dam1/DASH complex, as a multicopy suppressor of temperature-sensitive (ts) growth of nnf1-495 mutant that exhibits the minichromosome instability (mis) phenotype, producing lethal aneuploids without prominent mitotic delay. It remains elusive why SAC is satisfied in mis mutants despite the occurrence of missegregation. We found that Hos2 binds to the inner-kinetochore regions in both prometaphase and metaphase. Hos2 is essential for kinetochore localization of Dis1, a microtubule (MT) associated Dis1/XMAP215/TOG family protein that is required for proper MT dynamics. Cells lacking DASH exhibit cold-sensitive (cs) growth with the defective in sister-chromatid disjoining (dis) phenotype, which is characterized by hyper-condensed sister-chromatid pairs and elongated spindle MTs. Although DASH-deficient cells are viable at high temperatures, DASH-deletion transforms all the inner-kinetochore mis mutants so far tested into a constitutively active state of SAC, leading to the dis phenotype. We also discovered that Hos2 over-expression commonly suppresses growth retardation in a variety of inner-kinetochore mutants. These genetic interactions highlight the DASH-action(s) in satisfying SAC when aneuploids are formed during mitosis in the inner-kinetochore-defective mis mutants.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Kinetochore is a multiprotein complex that assembles on centromeric DNA and mediates the bipolar attachment of chromosomes to microtubules (MTs) (Cleveland et al. 2003). During early mitosis (from prometaphase to metaphase), sister-kinetochores are captured by the MTs emanating from the opposite poles to form bipolar attachments to spindles, then the sister-chromatids disjoin and move towards the poles during anaphase. To achieve a high fidelity of chromosome transmission, all events occurring during mitosis must be spatially regulated according to the progression of the cell cycle.

Spindle assembly checkpoint (SAC) is an evolutionarily conserved molecular device that coordinates the metaphase–anaphase transition with sister-chromatid alignment (Cleveland et al. 2003; Rieder & Maiato 2004). SAC is activated during each mitosis to monitor the attachment of sister-chromatids to the spindle MTs. When bipolarity is achieved for all sister-chromatid pairs, SAC is silenced and anaphase ensues. SAC components such as Mad2 and Bub1 proteins are recruited to kinetochores in prometaphase, where they monitor the attachment of MTs and the sister-kinetochore tension exerted on the chromosomes by spindle forces in mitosis. Misconnections between the kinetochores and spindle MTs are thought to originate occasionally during normal mitosis, but SAC detects these aberrations and transiently prevents the onset of anaphase until the misconnected kinetochores are repaired (Tanaka 2005). Although this correction process is important to ensure integrity of the stable genome, its molecular details remain poorly understood.

The fission yeast Schizosaccharomyces pombe is an ideal model organism to study the complex centromeres, which contain repetitive motifs underlying the pericentric heterochromatin. The S. pombe centromere has two distinct domains: the inner-kinetochore region consisting of chromosome-specific sequences, named imr and cnt, and the outer-heterochromatin region consisting of a repetitive sequence, named otr, which contains common motifs (dg and dh) among different chromosomes (Takahashi et al. 1992). Cnp1, an S. pombe homologue of CENP-A (a centromere-specific histone H3 variant) is localized on the inner-kinetochore region to form a centromere-specific nucleosome and bona fide kinetochore structure (Takahashi et al. 2000), while Swi6, the fission yeast homologue of heterochromatin protein 1 (HP1), is accumulated on the outer-heterochromatin region to form the pericentric heterochromatin (Partridge et al. 2000). Several subcomplexes bound to the inner-kinetochore regions have been identified genetically and biochemically in fission yeast (Hayashi et al. 2004; Liu et al. 2005). So far, at least four subcomplexes (Mis6-, Mis12-, Nuf2- and Mis16-complexes) have been characterized. Mis6- and Mis16-complexes are required for the loading of Cnp1 histone into the centromere nucleosomes (Takahashi et al. 2000; Hayashi et al. 2004). Mis6- and Nuf2-complexes are required for accumulation of Mad2 onto unattached kinetochores (Saitoh et al. 2005).

The budding yeast DASH complex, an essential component of kinetochores (Cheeseman et al. 2001; Jones et al. 2001; Li et al. 2002), has attracted considerable interest recently, because ten protein components form sliding rings encircling the MTs (Miranda et al. 2005; Westermann et al. 2005). Time-lapse fluorescence microscopy revealed that DASH is co-localized with the tips of disassembling MTs in vitro (Westermann et al. 2006). This work suggests that DASH may contribute directly to kinetochore–MT attachment and force production. In contrast, DASH is not essential for cell viability in fission yeast (Liu et al. 2005; Sanchez-Perez et al. 2005). Whether S. pombe DASH directly contributes to MT-driven movement thus remains obscure. Components of DASH except Dad1 appear on kinetochores and spindles only during mitosis and physically associate with the Mis6–Sim4 complex in fission yeast (Liu et al. 2005; Sanchez-Perez et al. 2005).

Fission yeast is particularly suitable for phenotypic analysis of kinetochore-defective mutants, as it has only three chromosomes condensed in mitosis and spindle apparatus formed only during mitosis. Moreover, a number of temperature-sensitive (ts) and cold-sensitive (cs) mitotic mutants have been isolated and characterized. Fission yeast kinetochore-defective mutants can be classified into at least three categories: mis, dis and lagging chromosomes based on their terminal morphological phenotypes. mis (minichromosome instability) mutants were originally identified as ts mutants that display high loss rates of minichromosomes (Takahashi et al. 1994). Among them, mis6-302 and mis12-537 exhibited a characteristic terminal phenotype producing large and small daughter nuclei in mitosis. mis6+ and mis12+ genes were shown to encode constitutive centromere proteins that specifically locate on the inner-kinetochore regions (Saitoh et al. 1997; Goshima et al. 1999). Most of the ts mutants and gene disruptants so far identified as inner-kinetochore-defective mutants have similar phenotypes (Takahashi et al. 2000; Nabetani et al. 2001; Pidoux et al. 2003; Hayashi et al. 2004; Obuse et al. 2004). Thus, the asymmetrical nuclear division (hereafter called the mis phenotype) is likely to represent a phenotype defective in the inner-kinetochore structure. Curiously, in the kinetochore mutants exhibiting the mis phenotype, the mitotic phases seem to proceed normally despite fetal chromosome missegregation, implying that SAC is not functional or is silenced immediately in these mutants (Saitoh et al. 2005). In contrast, dis (defective in sister-chromatid disjoining) mutants have hyper-condensed, unseparated sister-chromatids, indicating that SAC activation is maintained in these mutants (Ohkura et al. 1988; Nabeshima et al. 1998; Decottignies et al. 2001; Ikui et al. 2002). dis1+ encodes the inner-kinetochore binding MT-associated protein, which has significant homology with Dis1/XMAP215/TOG family proteins (Nabeshima et al. 1995; Garcia et al. 2001; Nakaseko et al. 2001). The other kinetochore-defective phenotype production of lagging chromosomesis is often observed in mutants defective in pericentric heterochromatin (Bernard et al. 2001). For instance, cells lacking Swi6 are viable but exhibit frequent lagging chromosomes at low temperatures (Ekwall et al. 1995).

In this paper, we studied the genetic relationships between mis and dis phenotypes in fission yeast. We identified Hos2, a component of the DASH complex, as a multicopy suppressor for a mis mutant. In the absence of DASH, mis mutants exhibit the dis phenotype in a SAC-dependent manner. Intriguingly, we found that Hos2 acts as a common multicopy suppressor for a variety of mis mutants. DASH may play pivotal role(s) in satisfying SAC in mis mutants, for example, through adjusting states of the spindle MT-attachment with inner-kinetochore-defective kinetochores to a tolerant form(s) for SAC, and/or through promoting adaptation pathway for defects in the inner-kinetochore structure.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Isolation of Hos2, a component of the DASH complex, as a multicopy suppressor of an nnf1 kinetochore-defective mutant

In our efforts to identify new components of the fission yeast kinetochore, we isolated ts mutants showing the mis phenotype with large and small daughter nuclei. One newly obtained mutation was revealed as allelic to nnf1+, and was thus designated as nnf1-495. The nnf1+ gene encodes a component of the Mis12-kinetochore subcomplex (Obuse et al. 2004; Liu et al. 2005). The nnf1-495 mutant has decreased viability after unequal chromosome segregation during the M phase at 36 °C (Fig. S1A, B). The mutation site of nnf1-495 was identified at position 77 (from D to N). We screened for multicopy suppressors of the nnf1-495 ts phenotype and identified three suppressors, nnf1+, mis12+ and hos2+ (Fig. S1C). Suppression of nnf1-495 by hos2+ was weaker than that by nnf1+ and mis12+. hos2+ was originally identified as a non-essential gene that is necessary for growth under high osmotic stress (Nakamichi et al. 2000); however, it was recently shown to be identical to the dad2+ gene product, a component of the DASH complex (Liu et al. 2005; Sanchez-Perez et al. 2005).

Localization of Hos2 on kinetochores in prometaphase and metaphase

To determine the possible roles of Hos2 in kinetochore function, we performed a double-labeling experiment in which YFP-tagged Hos2 was visualized in combination with CFP-tagged Mif2 (a constitutive kinetochore marker, the fission yeast homologue of mammalian CENP-C) (Saitoh et al. 2005) in wild-type cells (Fig. 1A). Mif2 signals were observed at kinetochores throughout the cell cycle, while Hos2 signals appeared when the cells entered the M phase. No specific localization of Hos2-YFP was observed during interphase. Hos2-YFP was associated with Mif2-CFP during the early stages of the M phase. In addition to the kinetochore localization, Hos2-YFP signals were observed discontinuously along the spindles. During the late M phase, Hos2-YFP was localized on the spindle pole bodies (SPBs) and the SPB-proximal parts of the spindle MTs. No Hos2 signal was observed on the spindle mid-zone at this stage. These observations are consistent with the DASH localization reported previously (Liu et al. 2005; Sanchez-Perez et al. 2005) and indicate the mitotic roles of Hos2 in kinetochores and spindles. Other components of DASH, Ask1 and Duo1 (Liu et al. 2005; Sanchez-Perez et al. 2005), were also visualized by GFP tagging (SP2433, SP2434), and a similar subcellular distribution was observed (data not shown).


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
Figure 1  Association of Hos2 with kinetochores and spindles at prometaphase and metaphase. (A) Hos2 associates with spindles and is co-localized with a kinetochore marker, Mif2, during the M phase. Wild-type cells (SP2043), in which the endogenous hos2+ and mif2+ genes were tagged with YFP and CFP, respectively, were grown in YES at 26 °C, methanol-fixed and observed using a fluorescence microscope. Representative images of cells at different stages during the cell cycle are presented. Arrowheads indicate Hos2-YFP signals located along the subsets of spindles. Hereafter, Bar indicates 10 µm. (B) Hos2 is localized on both kinetochores and spindle MTs in early M phase. Shown are representative images of prometaphase-arrested cut7-446 (SP2044) and metaphase-arrested cut9-665 (SP2046) mutant cells expressing Hos2-YFP along with Mif2-CFP. Cells were grown in YES at 26 °C and then cultured at 36 °C, a restrictive temperature, for 2 h for cut7-446 and 4 h for cut9-665. To depolymerize the MT structure, the arrested cells were further incubated on ice for 30 min (ice-treated). Arrowheads indicate Hos2 signals that are Mif2-CFP-negative and are supposed to locate at the plus end of spindle MTs in cut7-446 cells. Arrows indicate the positions at which SPBs are supposed to locate in each mutant. Kinetochores are frequently clustered near SPBs with V-shaped spindles in cut7-446 cells and located at the middle of the spindles to form a metaphase plate in cut9-665 cells.

 
Next, we observed Hos2-YFP signals in prometaphase- or metaphase-arrested mutant cells to clarify the stage-specific localization during the M phase (Fig. 1B). cut7-446, a mutation allele in a gene encoding a kinesin required for the formation of bipolar spindles (Hagan & Yanagida 1990), induces cell cycle arrest in the prometaphase in a SAC-dependent manner (Kim et al. 1998). cut9-665, a mutation allele in a gene encoding component of the anaphase-promoting complex/cyclosome (APC/C) (Yamashita et al. 1999), displays metaphase arrest of the cell cycle in response to a lack of APC/C activity (Yamada et al. 1997). Hos2-YFP signals were co-localized or closely associated with Mif2-CFP signals in both mutants at the restrictive temperature. Punctate Hos2 signals were also observed along the spindle MTs. However, some Hos2 signals accumulated on the ends of MTs, which were supposed to be coincident with the plus ends of the spindle MTs in the prometaphase-arrested cut7 cells and with SPBs in the metaphase-arrested cut9 cells (Fig. 1B). The arrested cells were then incubated on ice to release Hos2 from the MTs by depolymerizing them. With this ice treatment, we expected to freeze the metabolic activities of the cells and thereby visualize pre-existing Hos2 signals on the kinetochores by preventing the released Hos2 from relocating on to the kinetochores. In both ice-treated cut7 and cut9 cells, Hos2-YFP signals were observed to be co-localized with Mif2-CFP signals. Thus, it is most likely that Hos2 directly binds to the kinetochores without the assistance of spindle MTs from prometaphase to metaphase. In contrast, the dot-like localization of Hos2 along the spindles during the early M phase is likely to require an intact MT structure. In budding yeast, MTs are required for Ask1 binding to kinetochores, suggesting that DASH is delivered to the kinetochores by spindle MTs (Li et al. 2002). However, in fission yeast, DASH is capable of binding to kinetochores in the absence of MTs or SPBs (Liu et al. 2005). Our current observations support this conclusion, although formally remains a possibility that very short kinetochore MTs survive the cold treatment and are required for DASH association with the kinetochores.

Reduction in stable association of Hos2 with the central core region of the centromere due to lack of Mis6- or Nuf2-subcomplex

We next performed chromatin immunoprecipitation (ChIP) analysis to determine the regions of the centromeric DNA that are actually associated with Hos2 (Fig. 2A). S. pombe centromeres are large and consist of a central core (cnt and imr), surrounded by the pericentric heterochromatin (otr) with repetitive motifs (dg and dh) (Takahashi et al. 1992). In both the prometaphase- and metaphase-arrested cells, Hos2-GFP co-immunoprecipitated with the cnt and imr DNAs on which Cnp1, a centromeric histone H3 variant (Takahashi et al. 2000), locates. The SAC proteins, Mad2 and Bub1, also bind to the central core regions (Toyoda et al. 2002; Vanoosthuyse et al. 2004). The centromeric association of Hos2 was increased in M phase-arrested cells at 36 °C compared with asynchronous cells at 26 °C, which is consistent with the cytological observations in Fig. 1. Hos2-GFP was not associated with the pericentric heterochromatin region on which Swi6 (S. pombe homologue of HP1) is accumulated (Partridge et al. 2000).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
Figure 2  Stable kinetochore association of Hos2 requires Mis6 and Nuf2. (A) Hos2 binds to the central core regions of kinetochores. ChIP assay was performed to determine the Hos2 binding regions during early M phase. Prometaphase-arrested cut7-446 (SP2004) and metaphase-arrested cut9-665 (SP2012) cells expressing Hos2-GFP were prepared by inoculation in YES at 36 °C for 2 h for cut7-446 and 4 h for cut9-665. Asynchronous cells of each mutant were also prepared by inoculation at 26 °C, a permissive temperature. Co-precipitated DNAs with Hos2-GFP using anti-GFP antibodies from cell extracts were quantified by real-time PCR using cnt, imr, dg, dh and act1 (a background control) probes. Error bars indicate standard deviation from three independent PCR amplifications. (B) Stable Hos2 association with kinetochores depends on Mis6 and Nuf2. The kinetochore localization of Hos2-GFP at 36 °C, a restrictive temperature, was examined in synchronized wild-type (SP2350), cnp1-1 (SP1930), mis6-302 (SP2351), mis12-537 (SP2352) and nuf2-1 (SP1934) cells. Ratios of cells in the first and second M phases became maximal at 1 h and 4 h after the shift to 36 °C. Shown are the frequencies of cells exhibiting Hos2-GFP-positive kinetochores in the mitotic cell population (n > 400, see Experimental procedures for details). Error bars indicate standard deviation from four independent experiments. Statistical analysis was performed using the one-sided, paired Student's t-test (*P < 0.01, **P < 0.05).

 
To address the kinetochore components required for Hos2 association with the central core regions, we next determined the localization of Hos2-GFP in four representative kinetochore mutants (Fig. 2B). We used synchronous cell culture with the genetic background of cnp1-1 (Takahashi et al. 2000), mis6-302 (Saitoh et al. 1997), mis12-537 (Goshima et al. 1999) or nuf2-1 (Nabetani et al. 2001), each of which is supposed to cause disruption of a distinct subcomplex that specifically functions in the central core regions (Hayashi et al. 2004; Saitoh et al. 2005). Under the culture conditions used, mitotic phenotypes with marked chromosome missegregation first appeared at 1 h after a shift-up with nuf2-1, and at 4 h with mis6-302, mis12-537 and cnp1-1 (data not shown). The frequencies of cells showing Hos2-GFP-positive kinetochores with nuf2-1, mis6-302 and mis12-537 were reduced to 53%, 47% and 66% of that in wild-type cells at these time points, respectively. In contrast, the frequency of Hos2-positive cells and the intensity of Hos2-GFP signals in cnp1-1 were comparable with those in the wild-type cells. Both Mis6- and Nuf2-subcomplexes may act as acceptors for DASH during the M phase. The Mis12-subcomplex may also be required for the localization to some extent. Kinetochore localization of the other subunit of DASH, Dad1, was recently reported to depend on Mis6 and Mal2, but not on Nuf2, Mis12 or Cnp1 (Liu et al. 2005; Sanchez-Perez et al. 2005). Fission yeast Dad1 is an exceptional constituent that presents on kinetochores across the cell cycle (Liu et al. 2005; Sanchez-Perez et al. 2005), while other subunits including Hos2, Ask1 and Duo1 in DASH appeared in the M phase. Among the different components of the DASH complex, there may be specificities of interaction with the kinetochore subcomplexes.

DASH-deficient cells exhibit SAC-dependent mitotic arrest with unseparated chromosomes at low temperatures

To analyze the null phenotype of Hos2, we created a haploid strain in which the authentic hos2+ gene was replaced with an hygR gene. As previously reported (Nakamichi et al. 2000), {Delta}hos2 cells were viable at 33 °C. However, they lost a linear minichromosome, CN2, 400-fold larger than the wild-type cells at 33 °C in a selective medium (data not shown). Hos2 deletion thus reduces chromosome stability at 33 °C. {Delta}hos2 cells cultured at 33 °C were slightly bent and were apt to be delayed at the M phase (data not shown). Hyper-condensed chromosomes were seen in 8% of {Delta}hos2 cells (Fig. 3B, time = 0, % hyper-condensed chromosome), but were rarely observed in logarithmically growing wild-type cells. The mitotic delay/arrest phenotype of {Delta}hos2 became prominent under lower temperatures (70% of {Delta}hos2 cells showed hyper-condensed chromosomes at 8 h after shift-down to 20 °C) and depletion of Hos2 was revealed to reduce cell viability at 20 °C (Fig. 3A,B).


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
Figure 3  Loss of Hos2 causes SAC-dependent mitotic arrest with unseparated sister-chromatids at 20 °C. (A) cs growth of Hos2-deficient cells. Tenfold serial dilutions of 108 cells of wild-type (SP82), {Delta}hos2 (SP1519), {Delta}mad2 (SP248), {Delta}bub1 (SP1339), {Delta}hos2 {Delta}mad2 (SP2530) and {Delta}hos2 {Delta}bub1 (SP2529) cells were spotted on to a YES plate and incubated at 20 °C for 5 days. nda3-KM311 (SP131) was used as a representative cs mutant. (B) The cells used in (A) were cultured in YES at 33 °C and then shifted to 20 °C. Shown are the cell number increase and cell viability (upper), the frequencies of cells showing the dis and mis phanotypes per late mitotic and septated cells (middle), the frequency of cells exhibiting hyper-condensed chromosomes per total cells (lower) at each point of time. (C) DAPI-stained images of cells from (A) cultured in YES at 33 °C and then at 20 °C for 6 or 12 h. Arrowheads and asterisks indicates cells showing the dis and mis phenotypes, respectively. (D) Cells used in (A) were cultured in YES at 33 °C and 20 °C for 8 h. The cells were then fixed, double labeled by DAPI (green) and FISH with an rDNA probe (chromosome III marker, red). The frequencies of binucleate (black) and scattered hyper-condensed chromosome-containing (blue) cells with a single rDNA signal (hatched; two chromosome III segregated to the same pole) and with separated two rDNA signals (filled; two chromosome III segregated equally to the opposite poles) were scored. Shown are {Delta}hos2 cells exhibiting the dis phenotype at 20 °C with a 3 : 0 (a) and 2 : 1 (b) segregation pattern of hyper-condensed chromosomes, {Delta}hos2 cells at 33 °C (c) and wild-type cells at 20 °C (d) showing symmetrical nuclear division, SAC-deficient {Delta}hos2 cells showing large and small daughter nuclei with two separated rDNA signals (e, g) and an undivided rDNA signal (f, h).

 
The mitotic defects observed in {Delta}hos2 cells were similar to those in dis mutants (Fig. 3B; % dis phenotype, Fig. 3C) (Ohkura et al. 1988). dis mutants were characterized by cs growth with chromosome non-disjunction. To assess the occurrence of sister-chromatid separation in {Delta}hos2 cells, the fluorescence in situ hybridization (FISH) method was applied using rDNA as a chromosome III-specific probe (Fig. 3D). Under the culture conditions employed, 85% of late mitotic and septated {Delta}hos2 cells showed missegregation with only one rDNA–FISH signal per cell at 20 °C, whereas wild-type cells always showed two separate FISH signals. Cells lacking other components of DASH ({Delta}ask1; SP1903 and {Delta}duo1; SP1905) showed a similar phenotype at 20 °C (data not shown). Ask1 and Duo1 signals completely disappeared from the mitotic apparatus in {Delta}hos2 cells (SP2587, SP2588) (data not shown), indicating that loss of Hos2 prevents the formation of a functional DASH complex during mitosis. These observations indicate that DASH-deficient cells exhibit the cs dis phenotype.

Next, we analyzed the possible contributions of SAC pathways to the cs phenotype of {Delta}hos2. To this end, we crossed {Delta}hos2 with {Delta}mad2 or {Delta}bub1 to observe the mitotic phenotypes of SAC-deficient {Delta}hos2 strains. {Delta}hos2 cells in the absence of Mad2 or Bub1, components of sensing pathway(s) for the spindle attachment to kinetochores and for sister-kinetochore tension, respectively, entered the M phase without mitotic arrest at 20 °C (Fig. 3B; % hyper-condensed chromosome), resulting in reduced cell viability at both 33 °C and 20 °C (Fig. 3B; % viability). In SAC-deficient {Delta}hos2 cells, a typical mis phenotype was observed (Fig. 3B; % mis phenotype); sister-chromatid separation took place, but unequal segregation of chromosome III increased (48% in {Delta}mad2 {Delta}hos2, 36% in {Delta}bub1 {Delta}hos2, compared with 0% in {Delta}mad2, 10% in {Delta}bub1 and 0% in wild-type at 20 °C, see Fig. 3D), suggesting that the reduced cell viability of the double deletant is due to increased chromosome missegregation. Thus, Hos2 ensures the genome stability by a mechanism(s) besides the SAC pathway.

Mitotic spindles in DASH-deficient cells continue to be elongated without sister-chromatid separation

The MT structure of {Delta}hos2 was visualized by staining with antibodies against {alpha}-tubulin. {Delta}hos2 cells frequently exhibited hyper-condensed chromosomes, accompanied by spindle MTs of more than 2.5 µm in length at 20 °C (Fig. 4, compare (f)–(j) in {Delta}hos2 with (b,c) in wild-type). This is in contrast to a metaphase-arrested phenotype such as cut9-665, where the spindle MTs maintain a constant length (2–2.5 µm). Astral MTs (Fig. 4, arrows) were rarely observed in mitotic {Delta}hos2 cells at 20 °C (compare (f)–(j) in {Delta}hos2 with (b,c) in wild-type), but were clearly seen in {Delta}hos2 cells at 33 °C (l, m) and in SAC-deficient {Delta}hos2 cells (SP2530, SP2529) at 20 °C (data not shown). Hos2 depletion may cause a prolonged SAC response induced by defects in the mitotic apparatus at 20 °C, leading to irregular elongation of spindles without sister-chromatid separation (Fig. S2). Even after both ends of the spindles had reached the cell ends, the spindles appeared to continue elongating, resulting in the production of abnormally curved MTs (Fig. 4i,j, arrowheads). These phenotypic features of MT structure in {Delta}hos2 are consistent with those reported previously in dis mutants (Ohkura et al. 1988; Nabeshima et al. 1998). The activity of the MT-organizing centre appeared to remain in the SPBs of septated cells in the Hos2-depleted background (Fig. 4k, asterisks).


Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
Figure 4  Spindle morphology in DASH-deficient cells at 20 °C. Anti-{alpha}-tubulin (red), anti-Sad1 antibody (an SPB marker, green) and DAPI (blue) staining were performed in wild-type (SP82) and {Delta}hos2 (SP1519) cells after 8 h at 20 °C in YES medium. Arrows indicate astral MTs. Asterisks indicate SPBs that appear to retain activity for MT organizing centres in septated cells, in which cytoplasmic MTs are yet to be formed. Arrowheads indicate curved spindle MTs.

 
Hos2 is required for the mitotic association of Dis1 with kinetochores

Dis1 is an MT-associated protein that interacts with the inner-kinetochore regions in early mitosis (Nakaseko et al. 2001; Aoki et al. 2006). Dis1 is not essential for cell viability at high temperatures, but Dis1-depletion causes cs growth with the dis phenotype (Nabeshima et al. 1995), suggesting a close relationship between Dis1- and DASH-functions. As an initial attempt to clarify the functional interactions, we observed the subcellular localization of Dis1-GFP in {Delta}hos2 cells and that of Hos2-GFP in {Delta}dis1 cells. We found that Hos2-GFP localizes on the kinetochores and MTs/SPBs in {Delta}dis1 cells at 33 °C. In contrast, Dis1-GFP failed to associate with the mitotic kinetochores in {Delta}hos2 cells at 33 °C (Fig. 5). Dis1-GFP appeared to localize on MTs/SPBs in both interphase and mitosis in Hos2-depleted cells as in wild-type cells. DASH may participate with Dis1 in the mitotic kinetochore functions.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Figure 5  Localization dependency of Dis1 and Hos2 on the kinetochore. The {Delta}dis1 (SP2599) and wild-type (SP1514) cells expressing Hos2-GFP and the {Delta}hos2 (SP2650) and wild-type (SP2607) cells expressing Dis1-GFP were cultured in YES at 33 °C. To depolymerize the MT structure, the cells were further incubated on ice for 30 min (ice-treated). Shown on the left are the spindle index and the frequency (%) of cells wherein the GFP signals locate on the kinetochores/MTs per total cells.

 
Kinetochore-defective mutants fail to exit mitosis in the absence of DASH complex

To clarify the functional relationship between Nnf1 and Hos2, we next observed the mitotic phenotype of the nnf1-495 {Delta}hos2 strain. The restrictive temperature of the double mutant cells was lower than that of the nnf1-495 cells (Table 1). Surprisingly, instead of the mis phenotype observed in the nnf1 single mutant cells, the double mutant exhibited a dis-like phenotype at restrictive temperatures of 36 °C (Fig. 6A and data not shown). Tetrad analysis of {Delta}hos2 with the inner-kinetochore-defective mutants revealed that Hos2 depletion became lethal in combination with nuf2 mutation (nuf2-1, nuf2-2 or nuf2-3; Table 1). Other mutations tested (mis6-302, mis12-537, mis13-1, mis14-270, mis14-634 and mis16-53), which lead to unequal chromosome segregation, showed synthetic growth defects, but were viable at 26 °C in the {Delta}hos2 background. Interestingly, we found that the dis-like phenotype was commonly observed at the restrictive temperatures in all of the double mutants so far tested (Table 1, Fig. 6A). {Delta}dis1 mis12-537 double mutant also showed the dis-like phenotype at 36 °C (Fig. 6A), suggesting that DASH and Dis1 are involved in aneuploid formation in mis mutants.


View this table:
[in this window]
[in a new window]

 
Table 1  Genetic interactions of {Delta}hos2
 

Figure 6
View larger version (41K):
[in this window]
[in a new window]

 
Figure 6  Passage through mitosis in kinetochore-defective mutants requires the DASH complex. (A) dis-like phenotype of kinetochore-deficient mutants in the absence of Hos2. nnf1-495 {Delta}hos2 (SP2584), mis12-537 {Delta}hos2 (SP2559), mis6-302 {Delta}hos2 (SP2580), mis16-53 {Delta}hos2 (SP2581), mis12-537 {Delta}hos2 {Delta}mad2 (SP2553) and mis12-537 {Delta}hos2 {Delta}bub1 (SP2554), mis12-537 {Delta}dis1 (SP2578) cells were cultured in YES at 26 °C and then shifted to 36 °C for 4 h. Representative cell images stained by DAPI are presented. Arrowheads and asterisks indicate cells showing the dis and mis phenotypes, respectively. (B) Wild-type (SP82), {Delta}hos2 (SP1519), mis12-537 (SP8), mis12-537 {Delta}hos2 (SP2559), mis12-537 {Delta}hos2 {Delta}mad2 (SP2553) and mis12-537 {Delta}hos2 {Delta}bub1 (SP2554) cells were cultured in YES at 26 °C and then shifted to 36 °C. Shown are the cell number increase and cell viability (upper), the frequencies of cells showing the dis and mis phanotypes per late mitotic and septated cells (middle), the frequency of cells exhibiting hyper-condensed chromosomes per total cells (lower) at each point of time. (C) Wild-type (SP82), {Delta}hos2 (SP1519), {Delta}mad2 (SP248), {Delta}bub1 (SP1339), mis12-537 (SP8), mis12-537 {Delta}hos2 (SP2559), mis12-537 {Delta}mad2 (SP521), mis12-537 {Delta}bub1 (SP1195), mis12-537 {Delta}hos2 {Delta}mad2 (SP2553) and mis12-537 {Delta}hos2 {Delta}bub1 (SP2554) cells were cultured in YES at 36 °C for 5 h, then fixed and double labeled by DAPI (green) and FISH with an rDNA probe (red). The frequencies of binucleate (black) and scattered hyper-condensed chromosome-containing (blue) cells with a single rDNA signal (hatched) and with separated two rDNA signals (filled) were scored. Shown are {Delta}hos2 mis12-537 cells exhibiting the dis phenotypes at 36 °C with a 3 : 0 (a) and 2 : 1 (b) segregation pattern of hyper-condensed chromosomes, mis12-537 cells (c, d), {Delta}mad2 {Delta}hos2 mis12-537 cells (e, f) and {Delta}bub1 {Delta}hos2 mis12-537 cells (g, h) at 36 °C with large and small daughter nuclei and two separated rDNA signals (c, e, g) or an undivided rDNA signal (d, f, h).

 
Next, we assessed whether the production of the dis-like ts phenotype of inner-kinetochore-deficient {Delta}hos2 cells requires SAC activation as that of the cs phenotype in {Delta}hos2 single mutant cells. To this end, we further investigated the ts phenotype of mis12-537 {Delta}hos2 cells in detail (Fig. 6B). The restrictive temperature and cell viability of the double mutant were reduced when an SAC component, either Mad2 or Bub1 gene, was further deleted. Hyper-condensed chromosomes were not observed and the frequency of unequal chromosome segregation was drastically increased in SAC-deficient mis12-537 {Delta}hos2 cells compared with that in mis12-537 {Delta}hos2 cells (Fig. 6A,B), indicating that the dis-like phenotype in mis12-537 {Delta}hos2 cells is produced in an SAC-dependent fashion. The viability of SAC-deficient mis12-537 {Delta}hos2 cells was reduced compared with that of mis12-537 {Delta}hos2 cells at 26 °C (Fig. 6B; % viability, time 0). A typical mis phenotype was again observed in SAC-deficient mis12-537 {Delta}hos2 cells (Fig. 6A,B; % mis phenotype). FISH analysis using rDNA as a chromosome III-specific probe revealed that activation of SAC actually prevented sister-chromatid separation in mis12-537 {Delta}hos2 cells (Fig. 6C). As observed in {Delta}hos2 cells at 20 °C, elongated mitotic spindles lacking astral MTs were predominantly observed in double mutant cells cultured at 36 °C for 4–6 h (data not shown). A similar phenotype was observed in the mis12-537 {Delta}ask1 (SP2585) and mis12-537 {Delta}duo1 (SP2586) strains (data not shown). These observations indicate that impaired inner-kinetochore structures commonly cause the dis phenotype in DASH-deficient cells through SAC activation at 36 °C.

Growth retardation caused by the inner-kinetochore mutation was partially restored by Hos2 over-expression

All of the inner-kinetochore mutations so far tested commonly produced the dis phenotype in a DASH-deficient background. This unexpected finding prompted us to enquire whether Hos2 may function as a common multicopy suppressor for mis mutations. We examined the ts growth of mis-related mutants carrying pHos2, and found that Hos2 over-expression ameliorated not only the growth of nnf1-495 cells but also that of mis6-302, mis12-537, mis13-1, mis14-634, mis17-362, mis18-262, mis18-818, nuf2-3 and cnp1-1 cells at their semirestrictive temperatures (Fig. 7). This suppression was reproducibly observed in several independent transformants of each mutant. In other inner-kinetochore mutants (mis14-270, mis15-68, mis16-53, nuf2-1 and nuf2-2) as well as wild-type, the colony-forming ability of cells carrying pHos2 was comparable with that of cells carrying a control vector. In summary, inner-kinetochore defects caused severe mitotic arrest in an Hos2-depleted background, and many were restored by overproduction of Hos2.


Figure 7
View larger version (131K):
[in this window]
[in a new window]

 
Figure 7  Over-expression of Hos2 partially suppresses the ts phenotype of kinetochore-deficient mutants. A 10-fold serial dilution of 108 cells of the indicated strains harbouring a multicopy plasmid containing a hos2+ gene (pHos2) or an empty vector was spotted onto EMM2 with phloxine B plates and incubated at the indicated temperatures. The mis-related mutant strains used are as follows: nnf1-495 (SP2561), mis6-302 (SP1469), mis12-537 (SP8), mis13-1 (SP85), mis14-634 (SP6), mis14-270 (SP156), mis15-68 (SP10), mis16-53 (SP11), mis17-362 (SP12), mis18-262 (SP1088), mis18-818 (SP14), nuf2-1 (SP912), nuf2-2 (SP922), nuf2-3 (SP923) and cnp1-1 (SP148). Hos2 over-expression did not affect the cell growth of wild-type (SP143). Asterisks indicate strains partially suppressed by Hos2-over-expression.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
DASH-depleted cells exhibit cold-sensitive growth with the dis phenotype

At low temperatures, dis mutants exhibit mitotic arrest characterized by at least two phenotypic features: first, three hyper-condensed sister-chromatids move to the poles without dissolving the cohesion; and second, prophase-like spindles lacking the astral MT structure continue to elongate. So far, mutations in three genes, dis1+, dis2+ and dis3+, have been reported to show the dis phenotype at their restrictive temperatures, which encode an MT-associated kinetochore protein (Nabeshima et al. 1995; Garcia et al. 2001; Nakaseko et al. 2001; Aoki et al. 2006), a catalytic subunit of major type 1 protein phosphatize (Ohkura et al. 1989) and an essential protein whose budding yeast homologue is a component of the exosome 3'->5' exoribonuclease complex (Kinoshita et al. 1991; Allmang et al. 1999), respectively. Dis1 deletion causes cs growth with the dis phenotype (Nakaseko et al. 1996), while Dis2 and Dis3 deletion did not (Ohkura et al. 1989; Kinoshita et al. 1991). In this paper, we show that the cs phenotype of {Delta}hos2 resembles that of {Delta}dis1 in terms of scattered hyper-condensed chromosomes with elongated or collapsed spindles (Nabeshima et al. 1995). Dis1 belongs to the evolutionarily conserved Dis1/XMAP215/TOG family of MT-associated proteins and has been proposed to act as a linker between the plus end of the mitotic spindle and the kinetochore (Garcia et al. 2001, 2002; Nakaseko et al. 2001; Aoki et al. 2006). It is noteworthy that the mitotic cellular localization of DASH (Liu et al. 2005; Sanchez-Perez et al. 2005) resembles that of Dis1 (Garcia et al. 2001; Nakaseko et al. 2001; Aoki et al. 2006). Here, we showed that Hos2 binds to the inner-kinetochore regions as Dis1 does during mitosis. Furthermore, Hos2-deletion prevented Dis1 from kinetochore- but not MT-association, suggesting that Hos2 is required for proper functions of Dis1 on the mitotic kinetochores. Dis1 is associated with kinetochores in metaphase and relocates to the pole-to-pole MT lattice in anaphase: this subcellular distribution is regulated by Cdc2 phosphorylation of Dis1 (Aoki et al. 2006). DASH may be involved in the kinetochore localization of Dis1 through affecting and/or recognizing Cdc2 phosphorylation of Dis1. {Delta}hos2 (Table 1) and deletants of other DASH components showed synthetic lethality with Dis1-deficient cells (Sanchez-Perez et al. 2005). Neither over-expression of Hos2 in {Delta}dis1 nor that of Dis1 in {Delta}hos2 complements the cs growth of the deletant (data not shown). Thus, DASH and Dis1 may have non-redundant but partially overlapping functions, and may be physically associated with each other on kinetochores during mitosis.

We demonstrated that astral MTs are rarely observed on the mitotic spindles in {Delta}hos2 cells (Fig. 4), but were formed in SAC-deficient {Delta}hos2 cells (data not shown) at 20 °C. Thus, the lack of astral MTs in {Delta}hos2 is not due to the involvement of DASH in forming and/or maintaining this cytoskeletal structure. As in the dis1 mutant previously demonstrated (Nabeshima et al. 1998), it is rather likely that the prophase-like spindles lacking astral MTs lose the ability to maintain a constant length in {Delta}hos2 cells and continue to be elongated. Pioneering live cell analysis using strains carrying GFP-tagged SPBs and centromeric DNA demonstrated that S. pombe has three phases of spindle dynamics: spindle formation (phase 1), constant spindle length (phase 2) and spindle extension (phase 3), and phase 2 is clearly lacking in dis1 mutants at the restrictive temperature of 20 °C (Nabeshima et al. 1998). DASH might cooperate with Dis1 in establishing the normal linkage between kinetochores and SPBs via the kinetochore MTs, which is necessary for maintaining a constant spindle length at phase 2 (Nabeshima et al. 1998).

Relationships between dis and mis phenotypes

Phenotypic analysis of the inner-kinetochore mis mutants such as mis6-302 and mis12-537 using a synchronous culture population revealed that they produce unequal-sized nuclei during mitosis, increasing in frequency after one or two cycles of cell division (Saitoh et al. 1997; Goshima et al. 1999). Cytokinesis occurred normally after unequal nuclear division, leading to aneuploidy. The metaphase–anaphase transition seems to proceed without a significant delay despite the high frequency of missegregation, implying that SAC does not function or is silenced immediately in mis mutants (Saitoh et al. 2005).

In this paper, we demonstrated that DASH-deficient inner-kinetochore mutants exhibit the dis phenotype by activating SAC signaling at the restrictive temperature. Because DASH depletion can maintain an active state of SAC in mis mutants, SAC signaling is likely functional under situations where the inner-kinetochore chromatin is disrupted. A single mis mutation may not be enough to stimulate an SAC pathway, and full SAC activation may require defect(s) on the kinetochores and/or spindles caused by a combination of DASH depletion with the inner-kinetochore mutation. Because Hos2 over-expression suppresses the mis mutants, and deletion of Hos2 enhances the mis defect, a simple interpretation would be that Hos2 and Mis work in a similar, if not identical, pathway to establish bipolar attachment. Full activation of SAC in the mis and hos2 double mutant, but not in either single mutant, can also be explained by their overlapping functions. However, if the frequent dissociation of chromosomes from the spindle MTs primarily caused full SAC activation in Hos2-deficient mis mutants, the additional deletion of an SAC component would result in a production of the lagging/fallen-off chromosomes more frequently than we observed. Thus, we presume that the fission yeast DASH complex may have other roles besides the function in kinetochore–spindle attachment.

The possible role of DASH, which is not mutually exclusive with that in the kinetochore–spindle functions, may be to silence SAC induced by inner-kinetochore mutations. Although, in wild-type cells, MT-depolymerization can induce full SAC activation, we previously reported that mis6-302 single mutation can override SAC-dependent mitotic arrest induced by MT-depolymerization (Saitoh et al. 2005). SAC-response in mis6-302 cells appeared insensitive to MT-depolymerization, but SAC signaling itself is functional in mis6-302 mutant background because additional Hos2-deletion resulted in SAC-dependent mitotic arrest with the dis phenotype (Fig. 6). Thus, at least in mis6-302 mutant cells, it is likely that SAC activation can be initiated, but not maintained properly. Also in other mis mutants, SAC may be silenced or bypassed immediately through the DASH complex, although defect(s) leading to chromosome missegregation remains. When Hos2 is depleted, SAC activation is maintained in mis6-302 and nuf2-1 mutant cells, wherein Hos2 fails to locate on the kinetochores during mitosis (Fig. 2B). Because Hos2 is still able to locate along the spindle MTs in both mutants, SAC-inactivation in the inner-kinetochore mutants, if actively regulated, may be achieved through the DASH complex on the spindle MTs.

SAC inactivation after error correction on spindle–kinetochore interactions

The most surprising discovery in this study is the general suppression activity of Hos2 for mis mutations by its over-expression. This unexpected finding led us to propose that DASH may function in overriding SAC-dependent mitotic arrest through bypassing a functional SAC or through prompting a repair process for the inner-kinetochore abnormalities. To clarify whether the defects activating SAC remain in the mutants, further studies to examine the state will be needed on the spindle–kinetochore interaction, the localization of SAC proteins and the inner-kinetochore chromatin structure in mutants.

It has been previously reported that vertebrate cells can exit mitosis without satisfying SAC (Rieder & Maiato 2004), although whether a similar phenomenon (SAC adaptation) occurs in fission yeast remains to be studied. In human cells, in the absence of MTs, escape from mitosis occurs in the presence of an active SAC and requires cyclin B destruction (Brito & Rieder 2006). In the fission yeast mis mutants, SAC adaptation, if it exists, may occur in the DASH-dependent fashion. Another role of DASH may be involved in the maintenance of sister-kinetochore bi-orientation, a failure of which activates SAC. In budding yeast, Dam1 and Spc34, two components of ScDASH, are phosphorylated by Ipl1 (Aurora B) kinase and such phosphorylation is crucial to ensure bi-orientation (Cheeseman et al. 2002; Shang et al. 2003). The Ipl1-Sli15 (Aurora B-INCENP) kinase complex facilitates chromosome bi-orientation by promoting reorientation of the kinetochore–spindle pole connection in a tension-dependent manner (Tanaka 2005), and ScDASH itself is required to maintain sister-kinetochore bi-orientation after its establishment (Cheeseman et al. 2001; Janke et al. 2002; Li et al. 2002). The fission yeast DASH may participate in promoting an error correction process for misoriented kinetochore–spindle interactions and in stabilizing bi-orientation in mis mutants, and thus satisfy SAC.

Many tumors display chromosomal instability, in which cells gain or lose chromosomes and become aneuploid. Although some tumors are defective for SAC and carry mutations in hBUB1 (Cahill et al. 1998), most tumors have a functional SAC and the molecular basis of their chromosome instability remains unknown. In this paper, we demonstrated that the SAC signaling pathway is functional in fission yeast inner-kinetochore mutants, but is silenced or bypassed immediately in the presence of the DASH complex, thereby allowing chromosome missegregation at a high frequency. Deletion of DASH blocked aneuploidy by activating SAC in the mutants. Because many cancers have defects in chromosome segregation, the functional DASH homologue in mammalian cells, if it exists, may be required for survival of tumor cells and may be an excellent target for chemotherapy. The human spindle and kinetochore complex comprising Ska1 and Ska2 may be a good candidate of the DASH homologue because this complex has been recently reported to play a critical role in stabilization of kinetochore–MT interaction and spindle checkpoint silencing (Hanisch et al. 2006).


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
General techniques

Fission yeast methods and media have been previously described (Moreno et al. 1991). YES was used as rich medium and EMM2 with appropriate supplements as minimal medium. For yeast transformation, immunostaining and DAPI staining methods, see References in Saitoh et al. (1997). FISH staining methods using rDNA as a probe and the minichromosome loss assay are described in Takahashi et al. (1994).

Strains and plasmids

The strains used in this study are listed in Table 2. For tagging of genomic mif2+, hos2+, ask1+ and duo1+ with GFP :: hph, CFPcerulean :: kanR, YFP :: hph, and gene disruptions of hos2+, ask1+ and duo1+ with hph, kanR, a PCR-mediated method was used (Bahler et al. 1998; Krawchuk & Wahls 1999). hph is a hygromycin resistance marker and a plasmid containing hph (pFA6a-hphMX6) was provided by Dr P. Hentges and Dr A. Carr (Hentges et al. 2005). To construct pHos2, a multicopy plasmid carrying the native promoter-driven hos2+ gene, 2.5 kb genomic DNA was amplified by PCR using the primers 5'-AGGGATCCGTATCAATGTAGCGAAATC-3'/5'-CGGGATCCCATTCACGAAGCAACG-3', and cloned into a pSK248 vector after BamHI digestion.


View this table:
[in this window]
[in a new window]

 
Table 2  Strains used in this study
 
Isolation of nnf-495 mutant and its multicopy suppressor genes

We isolated 613 ts mutants in a {Delta}mad2 background by replica plating after nitrosoguanidine mutagenesis. Individual strains were grown at 30 °C and then shifted to 36 °C for 5 h. Cells were stained with DAPI, and observed under a fluorescence microscope. A 209 mutants showed defects in nuclear division, and 31 of these displayed the mis phenotype at 36 °C. The temperature sensitivity of 16 mutants showed a 2 : 2 segregation pattern in a {Delta}mad2 background. The 16 mutations were classified into ten complementary loci, and one of them was revealed to be allelic to nnf1+. To identify the multicopy suppressors of nnf1-495, transformants with S. pombe genomic library were obtained by plating at 36 °C; 37 of the 48 transformants contained the nnf1+ gene itself, whereas the rest of the transformants contained multicopy suppressor genes. Subsequent subcloning analysis indicated that two non-overlapping DNA fragments containing either mis12+ or hos2+ were responsible for the suppression of the nnf1-495.

Cell culture

For the experiments in Fig. 2B, cells were grown in YES at 22 °C and synchronized in S phase by the addition of 12 mM hydroxyurea for 6.5 h to enrich mitotic cells on release into fresh YES at 36 °C, a restrictive temperature for 4 h. To reduce the non-kinetochore signals of Hos2-GFP by depolymerizing MTs, the cells were further incubated on ice for 30 min. The frequency of cells carrying Hos2-GFP signals on kinetochores and/or mitotic spindles before ice treatment (#) was scored. The frequency of cells exhibiting Hos2-GFP-positive kinetochores (##) was also determined after the incubation on ice. The frequency of cells exhibiting Hos2-GFP-positive kinetochores in the mitotic cell population was calculated by dividing the latter (##) by the former (#).

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed using anti-GFP monoclonal antibodies (Roche) and Dynabeads anti-mouse or anti-rabbit IgG (DYNAL) as previously described (Saitoh et al. 1997). The DNA prepared from 1% formaldehyde-fixed chromatin solutions or immunoprecipitated fractions were analyzed by real-time PCR using an ABI 7000 Sequence Detection System and SYBR Green PCR master mix (Applide Biosystems). The PCR primer sequences used are as follows:

cnt, 5'AAAGCAAACAGCAGTAACCTTGTAA3'/5'TGCGTCCTTATATGCGGCTTA3'
imr, 5'CCTTTACTGGAAAATTGTCG3'/5'GCTGAGGCTAAGTATCTGTT3'
dg, 5'CATGGAACTACGTCAGGAGTGG3'/5'TGCCCTGTTCACTTATCTAATTCG3'
dh, 5'TGATAAGAGTAGGTGTAGGAGTAGGACTCA3'/5'ACATGGCTTAGTTTCACACGCT3'
act1, 5'CTTTCTACAACGAGCTTCGTGTTG3'/5'GAGTCATCTTCTCACGGTTGGAT3'.

Microscopes

Anti-{alpha}-tubulin polyclonal antibodies (TAT1, provided by Dr K. Gull) and anti-Sad1 polyclonal antibodies (provided by Dr O. Niwa) were used for staining MTs and SPBs, respectively. DNA was stained by DAPI (4’6-diamidino-2-phenylindole). To observe the cells expressing CFP-, YFP- or GFP-tagged proteins, the cells were fixed by methanol and observed using a fluorescence microscope (IX81, Olympus) equipped with a 100x objective lens (N.A. = 1.35) and a digital CCD camera (RETIGA FAST1394, Roper Scientific Inc.).


    Acknowledgements
 
We thank Drs A. M. Carr, K. Gull, P. Hentges, Y. Hiraoka, J.-P. Javerzat, O. Niwa and M. Yanagida for providing materials used in this study. This work was supported by the Grant-in-Aid for "Time's Arrow and Biosignaling" in Precursory Research for Embryonic Science and Technology from Japan Science and Technology Agency (to K.T.), the Grant-in-Aid for Scientific Research on Priority Areas "Nuclear Dynamics" (to K.T.), "Bio-nanosystems" and "Chromosome Cycle" (to S.S.) from Ministry of Education, Culture, Sports, Science and Technology of Japan and the Grant-in-Aid for Young Scientists (B) (to S.S.) from Japan Society for Promotion of Science.


    Footnotes
 
Communicated by: Fuyuki Ishikawa

* Correspondence: E-mail: takahash{at}lsi.kurume-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Allmang, C., Petfalski, E., Podtelejnikov, A., Mann, M., Tollervey, D. & Mitchell, P. (1999) The yeast exosome and human PM-Scl are related complexes of 3' -> 5' exonucleases. Genes Dev. 13, 2148–2158.[Abstract/Free Full Text]

Aoki, K., Nakaseko, Y., Kinoshita, K., Goshima, G. & Yanagida, M. (2006) CDC2 phosphorylation of the fission yeast dis1 ensures accurate chromosome segregation. Curr. Biol. 16, 1627–1635.[CrossRef][Medline]

Bahler, J., Wu, J.Q., Longtine, M.S., Shah, N.G., McKenzie, A. 3rd, Steever, A.B., Wach, A., Philippsen, P. & Pringle, J.R. (1998) Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–951.[CrossRef][Medline]

Bernard, P., Hardwick, K. & Javerzat, J.P. (1998) Fission yeast bubl is a mitotic centromere protein essential for the spindle checkpoint and the preservation of correct ploidy through mitosis. J. Cell. Biol. 143, 1775–1787.[Abstract/Free Full Text]

Bernard, P., Maure, J.F., Partridge, J.F., Genier, S., Javerzat, J.P. & Allshire, R.C. (2001) Requirement of heterochromatin for cohesion at centromeres. Science 294, 2539–2542.[Abstract/Free Full Text]

Brito, D.A. & Rieder, C.L. (2006) Mitotic checkpoint slippage in humans occurs via cyclin B destruction in the presence of an active checkpoint. Curr. Biol. 16, 1194–1200.[CrossRef][Medline]

Cahill, D.P., Lengauer, C., Yu, J., Riggins, G.J., Willson, J.K., Markowitz, S.D., Kinzler, K.W. & Vogelstein, B. (1998) Mutations of mitotic checkpoint genes in human cancers. Nature 392, 300–303.[CrossRef][Medline]

Cheeseman, I.M., Anderson, S., Jwa, M., Green, E.M., Kang, J., Yates, J.R. 3rd, Chan, C.S., Drubin, D.G. & Barnes, G. (2002) Phospho-regulation of kinetochore-microtubule attachments by the Aurora kinase Ipl1p. Cell 111, 163–172.[CrossRef][Medline]

Cheeseman, I.M., Enquist-Newman, M., Muller-Reichert, T., Drubin, D.G. & Barnes, G. (2001) Mitotic spindle integrity and kinetochore function linked by the Duo1p/Dam1p complex. J. Cell Biol. 152, 197–212.[Abstract/Free Full Text]

Cleveland, D.W., Mao, Y. & Sullivan, K.F. (2003) Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 112, 407–421.[CrossRef][Medline]

Decottignies, A., Zarzov, P. & Nurse, P. (2001) In vivo localisation of fission yeast cyclin-dependent kinase cdc2p and cyclin B cdc13p during mitosis and meiosis. J. Cell Sci. 114, 2627–2640.[Medline]

Ekwall, K., Javerzat, J.P., Lorentz, A., Schmidt, H., Cranston, G. & Allshire, R. (1995) The chromodomain protein Swi6: a key component at fission yeast centromeres. Science 269, 1429–1431.[Abstract/Free Full Text]

Garcia, M.A., Koonrugsa, N. & Toda, T. (2002) Two kinesin-like Kin I family proteins in fission yeast regulate the establishment of metaphase and the onset of anaphase A. Curr. Biol. 12, 610–621.[CrossRef][Medline]

Garcia, M.A., Vardy, L., Koonrugsa, N. & Toda, T. (2001) Fission yeast ch-TOG/XMAP215 homologue Alp14 connects mitotic spindles with the kinetochore and is a component of the Mad2-dependent spindle checkpoint. EMBO J. 20, 3389–3401.[CrossRef][Medline]

Goshima, G., Saitoh, S. & Yanagida, M. (1999) Proper metaphase spindle length is determined by centromere proteins Mis12 and Mis6 required for faithful chromosome segregation. Genes Dev. 13, 1664–1677.[Abstract/Free Full Text]

Hagan, I. & Yanagida, M. (1990) Novel potential mitotic motor protein encoded by the fission yeast cut7+ gene. Nature 347, 563–566.[CrossRef][Medline]

Hanisch, A., Sillje, H.H. & Nigg, E.A. (2006) Timely anaphase onset requires a novel spindle and kinetochore complex comprising Ska1 and Ska2. EMBO J. 25, 5504–5515.[CrossRef][Medline]

Hayashi, T., Fujita, Y., Iwasaki, O., Adachi, Y., Takahashi, K. & Yanagida, M. (2004) Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres. Cell 118, 715–729.[CrossRef][Medline]

Hentges, P., Van Driessche, B., Tafforeau, L., Vandenhaute, J. & Carr, A.M. (2005) Three novel antibiotic marker cassettes for gene disruption and marker switching in Schizosaccharomyces pombe. Yeast 22, 1013–1019.[CrossRef][Medline]

Hiraoka, Y., Toda, T. & Yanagida, M. (1984) The NDA3 gene of fission yeast encodes beta-tubulin: a cold-sensitive nda3 mutation reversibly blocks spindle formation and chromosome movement in mitosis. Cell 39, 349–358.[CrossRef][Medline]

Ikui, A.E., Furuya, K., Yanagida, M. & Matsumoto, T. (2002) Control of localization of a spindle checkpoint protein, Mad2, in fission yeast. J. Cell Sci. 115, 1603–1610.[Abstract/Free Full Text]

Janke, C., Ortiz, J., Tanaka, T.U., Lechner, J. & Schiebel, E. (2002) Four new subunits of the Dam1-Duo1 complex reveal novel functions in sister kinetochore biorientation. EMBO J. 21, 181–193.[CrossRef][Medline]

Jones, M.H., He, X., Giddings, T.H. & Winey, M. (2001) Yeast Dam1p has a role at the kinetochore in assembly of the mitotic spindle. Proc. Natl. Acad. Sci. USA 98, 13675–13680.[Abstract/Free Full Text]

Kim, S.H., Lin, D.P., Matsumoto, S., Kitazono, A. & Matsumoto, T. (1998) Fission yeast Slp1: an effector of the Mad2-dependent spindle checkpoint. Science 279, 1045–1047.[Abstract/Free Full Text]

Kinoshita, N., Goebl, M. & Yanagida, M. (1991) The fission yeast dis3+ gene encodes a 110-kDa essential protein implicated in mitotic control. Mol. Cell. Biol. 11, 5839–5847.[Abstract/Free Full Text]

Krawchuk, M.D. & Wahls, W.P. (1999) High-efficiency gene targeting in Schizosaccharomyces pombe using a modular, PCR-based approach with long tracts of flanking homology. Yeast 15, 1419–1427.[CrossRef][Medline]

Li, Y., Bachant, J., Alcasabas, A.A., Wang, Y., Qin, J. & Elledge, S.J. (2002) The mitotic spindle is required for loading of the DASH complex onto the kinetochore. Genes Dev. 16, 183–197.[Abstract/Free Full Text]

Liu, X., McLeod, I., Anderson, S., Yates, J.R. & He, X. (2005) Molecular analysis of kinetochore architecture in fission yeast. EMBO J. 24, 2919–2930.[CrossRef][Medline]

Miranda, J.J., De Wulf, P., Sorger, P.K. & Harrison, S.C. (2005) The yeast DASH complex forms closed rings on microtubules. Nat. Struct. Mol. Biol. 12, 138–143.[CrossRef][Medline]

Moreno, S., Klar, A. & Nurse, P. (1991) Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795–823.[Medline]

Nabeshima, K., Kurooka, H., Takeuchi, M., Kinoshita, K., Nakaseko, Y. & Yanagida, M. (1995) p93dis1, which is required for sister chromatid separation, is a novel microtubule and spindle pole body-associating protein phosphorylated at the Cdc2 target sites. Genes Dev. 9, 1572–1585.[Abstract/Free Full Text]

Nabeshima, K., Nakagawa, T., Straight, A.F., Murray, A., Chikashige, Y., Yamashita, Y.M., Hiraoka, Y. & Yanagida, M. (1998) Dynamics of centromeres during metaphase–anaphase transition in fission yeast: Dis1 is implicated in force balance in metaphase bipolar spindle. Mol. Biol. Cell 9, 3211–3225.[Abstract/Free Full Text]

Nabetani, A., Koujin, T., Tsutsumi, C., Haraguchi, T. & Hiraoka, Y. (2001) A conserved protein, Nuf2, is implicated in connecting the centromere to the spindle during chromosome segregation: a link between the kinetochore function and the spindle checkpoint. Chromosoma 110, 322–334.[Medline]

Nakamichi, N., Yamamoto, E., Yamada, H., Aiba, H. & Mizuno, T. (2000) Identification and characterization of a novel gene, hos2+, the function of which is necessary for growth under high osmotic stress in fission yeast. Biosci. Biotechnol. Biochem. 64, 2493–2496.[CrossRef][Medline]

Nakaseko, Y., Goshima, G., Morishita, J. & Yanagida, M. (2001) M phase-specific kinetochore proteins in fission yeast: microtubule-associating Dis1 and Mtc1 display rapid separation and segregation during anaphase. Curr. Biol. 11, 537–549.[CrossRef][Medline]

Nakaseko, Y., Nabeshima, K., Kinoshita, K. & Yanagida, M. (1996) Dissection of fission yeast microtubule associating protein p93Dis1: regions implicated in regulated localization and microtubule interaction. Genes Cells 1, 633–644.[Abstract]

Obuse, C., Iwasaki, O., Kiyomitsu, T., Goshima, G., Toyoda, Y. & Yanagida, M. (2004) A conserved Mis12 centromere complex is linked to heterochromatic HP1 and outer kinetochore protein Zwint-1. Nat. Cell Biol. 6, 1135–1141.[CrossRef][Medline]

Ohkura, H., Adachi, Y., Kinoshita, N., Niwa, O., Toda, T. & Yanagida, M. (1988) Cold-sensitive and caffeine-supersensitive mutants of the Schizosaccharomyces pombe dis genes implicated in sister chromatid separation during mitosis. EMBO J. 7, 1465–1473.[Medline]

Ohkura, H., Kinoshita, N., Miyatani, S., Toda, T. & Yanagida, M. (1989) The fission yeast dis2+ gene required for chromosome disjoining encodes one of two putative type 1 protein phosphatases. Cell 57, 997–1007.[CrossRef][Medline]

Partridge, J.F., Borgstrom, B. & Allshire, R.C. (2000) Distinct protein interaction domains and protein spreading in a complex centromere. Genes Dev. 14, 783–791.[Abstract/Free Full Text]

Pidoux, A.L., Richardson, W. & Allshire, R.C. (2003) Sim4: a novel fission yeast kinetochore protein required for centromeric silencing and chromosome segregation. J. Cell Biol. 161, 295–307.[Abstract/Free Full Text]

Rieder, C.L. & Maiato, H. (2004) Stuck in division or passing through: what happens when cells cannot satisfy the spindle assembly checkpoint. Dev. Cell 7, 637–651.[CrossRef][Medline]

Saitoh, S., Ishii, K., Kobayashi, Y. & Takahashi, K. (2005) Spindle checkpoint signaling requires the mis6 kinetochore subcomplex, which interacts with mad2 and mitotic spindles. Mol. Biol. Cell 16, 3666–3677.[Abstract/Free Full Text]

Saitoh, S., Takahashi, K. & Yanagida, M. (1997) Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation. Cell 90, 131–143.[CrossRef][Medline]

Sanchez-Perez, I., Renwick, S.J., Crawley, K., Karig, I., Buck, V., Meadows, J.C., Franco-Sanchez, A., Fleig, U., Toda, T. & Millar, J.B. (2005) The DASH complex and Klp5/Klp6 kinesin coordinate bipolar chromosome attachment in fi