|
|
||||||||
1 Thyroid Division, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, and 2 Beth Israel Deaconess Medical Center, Boston, MA 02115, USA
3 Department of Cell and Molecular Biology, University of Hawaii at Manoa, Honolulu, HI 96822, USA
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Numerous findings support a role for the iron storage protein, ferritin, as a protectant against ROS-mediated damage. Ferritin functions to store iron not required for immediate metabolic needs. Iron is both required for the activities of a number of cellular enzymes and pathways, and toxic in excess. Free intracellular iron participates in oxygen free radical formation via Fenton chemistry (Linn 1998), catalyzing generation of ROS (Halliwell & Gutteridge 1984; Aust et al. 1985). Balancing the negative and positive effects of iron, in which ferritin plays a key role, is thus essential for cell survival. Ferritin is composed of heavy (H) and light (L) chains. The H subunits are responsible for rapid detoxification of iron, due to ferroxidase activity (Theil 1987; Andrews et al. 1992). The L subunits facilitate iron nucleation, mineralization and long-term iron storage (Rucker et al. 1996; Orino et al. 2001).
Oxidative stress has become an important focus in studies of neurological disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Friedreich Ataxia and amyotropic lateral sclerosis. Increased mitochondrial superoxide dismutase (SOD) activity has been reported in substantia nigra in Parkinson's disease, possibly reflecting compensation for increased superoxide production. Decreases in content of reduced glutathione are an early feature in Parkinson's disease, suggesting the accumulation of compounds inducing oxidative stress (Perry et al. 1982; Perry & Yong 1986). Mutations in frataxin result in cell damaging oxidative stress in Friedreich Ataxia, whereas mutations in the copperzinc SOD are associated with familial amyotropic lateral sclerosis (Rosen et al. 1993).
We studied the changes in mRNA profile in a neuronal cell model under oxidative stress conditions established by administration of homocysteic acid (HCA), a glutathione-depleting drug (Sagara et al. 1998). HCA inhibits the chloride-dependent cystineglutamate transporter, and cystine is considered to be the limiting substrate for glutathione synthesis (Tateishi et al. 1974), thus inhibition of its uptake results in glutathione depletion. Our results show that HCA treatment of HT22 murine hippocampal cells increases the levels of the mRNAs encoding at least three proteins involved in protection from oxidant injury, H and L ferritin and GST. In contrast, the mRNA levels for other antioxidant enzymes, including GPX1 and SOD2, were not altered in HT22 cells in response to HCA treatment.
| Results |
|---|
|
|
|---|
Treatment of HT22 hippocampal cells with HCA was carried out for varying periods of time to assess effects on cell viability. Treatment with 10 mM HCA for 7 h had no significant effect on cell viability measured using in vitro toxicology assay (around 75%80% of the untreated control). Treatment for 18 h resulted in only 10%15% viability. Intermediate time points of 12 or 15 h resulted in viability ranging from 50% to 60%, but an irreversible commitment to cell death was established. (Fig. 1).
|
|
Microarray analysis reveals elevated level of H and L ferritin and glutathione S-transferase (GST) mRNAs
The time range corresponding to strong decrease of GSH level was chosen for microarray studies. The results of microarray analyses are shown in the Table 1. The amount of ferritin H mRNA increased 1.6- to 1.7-fold, ferritin L mRNA levels increased 1.8- to 2-fold, GSTp2 mRNA levels increased twofold, and in response to 12 or 15 h HCA-induced glutathione depletion. The mRNA levels for these proteins were unchanged in cells harvested after 7 h treatment, and were either increased or unchanged at 18 h. In cells surviving 18 h HCA treatment, inducible heat shock protein 70 mRNA levels increased twofold, but there was no effect on this mRNA at earlier times, suggesting that this response may be secondary to other cellular stresses. It is likely that the effects on the ferritin and GST mRNAs at 18 h represent underestimates, even when normalizing for the reduced total RNA recovery due to the low cell viability at this time point, as the levels of most other mRNAs examined were significantly reduced after 18 h treatment. The latter effect likely reflects an overall decrease in transcription accompanying the onset of apoptosis and breakdown of nuclei. In contrast to the effects of ferritin and GST mRNAs, the mRNA levels for two important antioxidant proteins, GPX1 and SOD2, and for the constitutive heat shock protein 70 were unchanged following HCA treatment for 12 or 15 h. Similar patterns were seen with the mRNAs for the SECIS binding protein, SBP2 and ß-actin, which could be considered as a control gene. Finally, the mRNAs encoding a number of genes were decreased by one-third to one-half at 12 or 15 h, including c-myc, leukocyte antigen related protein tyrosine phosphatase, and myosin heavy chain ß-isoform.
|
|
|
| Discussion |
|---|
|
|
|---|
In apparent contrast with studies showing increases in ferritin synthesis in response to oxidative stress are reports that H2O2 activates iron regulatory protein (IRP-1) (Pantopoulos et al. 1997; Mueller et al. 2001), which represses ferritin synthesis at the level of translation. H2O2 activation of IRP may occur through direct disassembly of its 4Fe4S cubane cluster (Rouault & Klausner 1996), or by activation of a signal transduction pathway (Pantopoulos & Hentze 1998). IRPs regulate translation of ferritin via binding of the protein to specific stem-loop structures, the iron-responsive elements, in the 5'-untranslated region of iron-responsive mRNAs (Hentze et al. 1987; Leibold & Munro 1988; Hanson & Leibold 1999; Theil & Eisenstein 2000). Reversible activation of IRPs by iron binding finely tunes iron-responsive mRNA translation to intracellular iron levels (Theil 1990; Kuhn & Hentze 1992; Leibold & Guo 1992; Klausner et al. 1993). Activation of IRPs by H2O2 thus decreases synthesis of both ferritin H and L chains in response to oxidative stress. However, inactivation of IRP by superoxide and H2O2 has also been reported in a cell-free system (Cairo et al. 1996), and in an in vivo model of ischemia/reperfusion, which generally leads to ROS production (Tacchini et al. 1997). Thus, the relationships between oxidative stress and regulation of ferritin synthesis are complex, and remain to be fully elucidated. Nonetheless, the role of ferritin in the cellular response to oxidative stress is of crucial importance for neuronal cells. Studies of the substantia nigra after death from Parkinson's disease have shown changes in total antioxidant status, high levels of total iron, and decreased ferritin buffering, compared to normal brain (Jenner et al. 1992).
GSTs have also been reported to exert a protective function in neuronal cultures, in particular against reactive aldehydes generated by peroxidation of polyunsaturated fatty acids (Xie et al. 1998). GST expression was found to be enhanced in HT22 cells selected for resistance to cell death induced by glutathione-depletion (Sagara et al. 1998). Therefore GSTs, like ferritin, appear to function as critical neuronal defense mechanisms against oxidative stress. Intriguingly, the genes for two major antioxidant defense enzymes, GPX and SOD, were not changed in response to glutathione depletion, suggesting that they do not respond directly to either depletion of this important antioxidant cofactor or to the resultant oxidative stress, at least in this model system. The findings reported herein will provide a foundation for studies of compensatory defense mechanisms in neuronal oxidative stress, and possibly to therapeutic approaches for neurodegenerative diseases.
| Experimental procedures |
|---|
|
|
|---|
The HT22 murine hippocampal cell line was maintained in Dulbecco's MEM +10% fetal bovine serum. HCA was added to the media at a final concentration of 10 mM, and cells maintained for the indicated times, prior to harvesting in phosphate buffered saline and isolation of RNA.
The cell viability was quantified using MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromid) assay (in vitro toxicology assay kit, Sigma, St. Louis, MO) following the instruction of the manufacturer. The statistical analysis of the data was done using standard deviation procedure.
Total intracellular glutathione (GSH) level assay
After 0, 7, 12, 15 and 18 h of incubation either in medium containing 10 mM HCA or in HCA-free medium as control, the cells were washed twice with cold PBS, pelleted by centrifugation and sonicated in cold PBS. The cell lysate was centrifuged again for 10 min at 10 000g, the supernatant was used for the total GSH and GSSG assays using commercial kit from Oxis (Foster City, CA) following the instruction of the manufacturer. The statistical analysis of the data was done using t-test.
Oligonucleotide arrays and gene expression profiling
Original oligonucleotide arrays were used for the gene expression analysis (Morozova et al. in preparation). Briefly, for each gene under study, we designed two or four 60 nt long oligonucleotide probes. The probes (37%60% GC) were positioned as close as possible to the 3' end of the gene, and were tested for absence of secondary structure and cross-hybridization elsewhere in the genome. The probes were spotted on to GeneScreen Plus nylon membrane using a V & P Scientific (San Diego, CA) 1536-pin replicator and immobilized by alkali treatment. Total RNA (2 µg) was labeled via oligoT-directed first strand cDNA synthesis using 400 units MLV reverse transcriptase (Invitrogen, Carlsbad, CA) and
-33P-dCTP (40 µCi). cDNA was purified using QiaQuick PCR columns (Qiagen, Valencia CA), heat denatured and hybridized in triplicate to arrays in MicroHyb buffer (Research Genetics, Huntsville, AL) overnight at 60 °C. Arrays were washed with 2x SSC, 0.5% SDS at 50 °C, followed by 12x SSC, 0.5% SDS at 65 °C. The arrays were exposed to phosphor storage screens and signals were quantified by a PhosphoImager (Molecular Dynamics, Sunnyvale, CA). Signal readings were taken for each spot of the array and background readings were taken at the empty spots distributed throughout the array. The raw data, analyzed by IQMAC program, were further automatically processed using Microsoft Excel and presented as a set of numbers.
For the further analysis of the data we used the special program created for the calculation of microarray results obtained by this throughput technology. The details of the program as a part of this microarray method are presented in the technique paper Morozova et al. (in preparation).
Briefly, the program includes normalization procedure, the procedure of excluding from the analysis the signals lower than average background value plus three standard deviations of background, and the request for showing only the reliable (according to t-test from all experiments) data, where the response reveals the same pattern in two different probes created for the same gene. The remaining readings were averaged among triplicate measurement for each point. The relations of these resulting data for different time points of HCA treatment to the control data (untreated cells) are presented as "fold change in mRNA."
Quantitative RT-PCR analysis of HCA effects on mRNA levels
RNA from untreated HT22 cells or cells treated with HCA for 15 h was obtained using the Trizol method (Invitrogen, Carlsbad, CA). cDNA was generated from 1 g RNA using Superscript II RT (Invitrogen) per the manufacturer's protocol, with both random and oligo-dT primers. PCR was carried out using the following primers:
Fer L-5' TCATCTCTGTGACTTCCTGG, Fer L-3' AGGCCTCTGTACCTTCCAAG, Fer H-5' TCAGTCACTACTGGAACTGC, Fer H-3' GCATGTCAGGCTGCCTTCAT,GST-5' AAGATCAAGGCCTTTCTGTC, GST-3' AAGCCTTTTGAGACCCTGCT, GPX-5' GAATGCCTTGCCAACACCCA, GPX-3' AGCAGTCTGGCAACTCCTAA, SBP2-5' TCTTTCTCTCTGCACTCTGG, SBP2-3' AGGATTTGCTAAGATGAGCC
The PCR was performed on automated thermocycler (Robocycler, Stratogene, La Jolla, CA, USA) for 30 cycles using the following protocol: 5 min at 94 °C, 30 times: 30 s at 93 °C, 60 s at 60 °C, 60 s at 72 °C; 5 min at 72 °C.
Quantification of PCR bands was done using the Alpha-Imager (Alpha Innotech Corporation, San Leonardo, CA). Signal density was integrated within rectangles of identical shape and surface area for each pair of bands and the corresponding background area. Rectangles were positioned to maximize the signal density integral.
| Acknowledgements |
|---|
| Footnotes |
|---|
aPresent address: Department of Biological Sciences, University of Illinois at Chicago, Chicago, IL 60607, USA.
| References |
|---|
|
|
|---|
Applegate, L.A., Scaletta, C., Panizzon, R. & Frenk, E. (1998) Evidence that ferritin is UV inducible in human skin: part of a putative defense mechanism. J. Invest. Dermatol. 111, 159163.[CrossRef][Medline]
Aust., S.D., Morehouse, L.A. & Thomas, C.E. (1985) Role of metals in oxygen radical reactions. J. Free Radic. Biol. Med. 1, 325.[Medline]
Balla, G., Jacob, H.S., Balla, J., Rosenberg, M., Nath, K., Apple, F., Eaton, J.W. & Vercellotti, G.M. (1992) Ferritin: a cytoprotective antioxidant strategem of endothelium. J. Biol. Chem. 267, 1814818153.
Balla, J., Jacob, H.S., Balla, G., Nath, K., Eaton, J.W. & Vercellotti, G.M. (1993) Endothelial-cell heme uptake from heme proteins: induction of sensitization and desensitization to oxidant damage. Proc. Natl. Acad. Sci. USA 90, 92859289.
Cairo, G., Castrusini, E., Minotti, G. & Bernelli-Zazzera, A. (1996) Superoxide and hydrogen peroxide-dependent inhibition of iron regulatory protein activity: a protective stratagem against oxidative injury. FASEB. J. 10, 13261335.[Abstract]
Cairo, G., Tacchini, L., Pogliaghi, G., Anzon, E., Tomasi, A. & Bernelli-Zazzera, A. (1995) Induction of ferritin synthesis by oxidative stress. Transcriptional and post-transcriptional regulation by expansion of the "free" iron pool. J. Biol. Chem. 270, 700703.
Halliwell, B. & Gutteridge, J.M. (1984) Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem. J. 219, 114.[Medline]
Hanson, E.S. & Leibold, E.A. (1999) Regulation of the iron regulatory proteins by reactive nitrogen and oxygen species. Gene Expr. 7, 367376.[Medline]
Hentze, M.W., Caughman, S.W., Rouault, T.A., et al. (1987) Identification of the iron-responsive element for the translational regulation of human ferritin mRNA. Science 238, 15701573.
Jenner, P., Schapira, A.H. & Marsden, C.D. (1992) New insights into the cause of Parkinson's disease. Neurology 42, 22412250.
Klausner, R.D., Rouault, T.A. & Harford, J.B. (1993) Regulating the fate of mRNA: the control of cellular iron metabolism. Cell 72, 1928.[CrossRef][Medline]
Kuhn, L.C. & Hentze, M.W. (1992) Coordination of cellular iron metabolism by post-transcriptional gene regulation. J. Inorg. Biochem. 47, 183195.[CrossRef][Medline]
Leibold, E.A. & Guo, B. (1992) Iron-dependent regulation of ferritin and transferrin receptor expression by the iron-responsive element binding protein. Annu. Rev. Nutr. 12, 345368.[CrossRef][Medline]
Leibold, E.A. & Munro, H.N. (1988) Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5 untranslated region of ferritin heavy- and light-subunit mRNAs. Proc. Natl. Acad. Sci. USA 85, 21712175.
Linn, S. (1998) DNA damage by iron and hydrogen peroxide in vitro and in vivo. Drug Metab. Rev. 30, 313326.[Medline]
Mueller, S., Pantopoulos, K., Hubner, C.A., Stremmel, W. & Hentze, M.W. (2001) IRP1 activation by extracellular oxidative stress in the perfused rat liver. J. Biol. Chem. 276, 2319223196.
Nath, K.A., Balla, G., Vercellotti, G.M., Balla, J., Jacob, H.S., Levitt, M.D. & Rosenberg, M.E. (1992) Induction of heme oxygenase is a rapid, protective response in rhabdomyolysis in the rat. J. Clin. Invest. 90, 267270.[Medline]
Orino, K., Lehman, L., Tsuji, Y., Ayaki, H., Torti, S.V. & Torti, F.M. (2001) Ferritin and the response to oxidative stress. Biochem. J. 357, 241247.[CrossRef][Medline]
Pantopoulos, K. & Hentze, M.W. (1998) Activation of iron regulatory protein-1 by oxidative stress in vitro. Proc. Natl. Acad. Sci. USA 95, 1055910563.
Pantopoulos, K., Mueller, S., Atzberger, A., Ansorge, W., Stremmel, W. & Hentze, M.W. (1997) Differences in the regulation of iron regulatory protein-1 (IRP-1) by extra- and intracellular oxidative stress. J. Biol. Chem. 272, 98029808.
Perry, T.L., Godin, D.V. & Hansen, S. (1982) Parkinson's disease: a disorder due to nigral glutathione deficiency? Neurosci. Lett. 33, 305310.[CrossRef][Medline]
Perry, T.L. & Yong, V.W. (1986) Idiopathic Parkinson's disease, progressive supranuclear palsy and glutathione metabolism in the substantia nigra of patients. Neurosci. Lett. 67, 269274.[CrossRef][Medline]
Pietsch, E.C., Chan, J.Y., Torti, F.M. & Torti, S.V. (2003) Nrf2 mediates the induction of ferritin H in response to xenobiotics and cancer chemopreventive dithiolethiones. J. Biol. Chem. 278, 23612369.
Rosen, C.F., Poon, R. & Drucker, D.J. (1995) UVB radiation-activated genes induced by transcriptional and posttranscriptional mechanisms in rat keratinocytes. Am. J. Physiol. 268, C846C855.[Medline]
Rosen, D.R., Siddique, T., Patterson, D., et al. (1993) Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 5962.[CrossRef][Medline]
Rouault, T.A. & Klausner, R.D. (1996) Ironsulfur clusters as biosensors of oxidants and iron. Trends Biochem. Sci. 21, 174177.[CrossRef][Medline]
Rucker, P., Torti, F.M. & Torti, S.V. (1996) Role of H and L subunits in mouse ferritin. J. Biol. Chem. 271, 3335233357.
Sagara, Y., Dargusch, R., Chambers, D., Davis, J., Schubert, D. & Maher, P. (1998) Cellular mechanisms of resistance to chronic oxidative stress. Free Radic. Biol. Med. 24, 13751389.[CrossRef][Medline]
Tacchini, L., Recalcati, S., Bernelli-Zazzera, A. & Cairo, G. (1997) Induction of ferritin synthesis in ischemic-reperfused rat liver: analysis of the molecular mechanisms. Gastroenterology 113, 946953.[CrossRef][Medline]
Tateishi, N., Higashi, T., Shinya, S., Naruse, A. & Sakamoto, Y. (1974) Studies on the regulation of glutathione level in rat liver. J. Biochem. (Tokyo) 75, 93103.
Theil, E.C. (1987) Ferritin: structure, gene regulation, and cellular function in animals, plants, and microorganisms. Annu. Rev. Biochem. 56, 289315.[CrossRef][Medline]
Theil, E.C. (1990) Regulation of ferritin and transferrin receptor mRNAs. J. Biol. Chem. 265, 47714774.
Theil, E.C. & Eisenstein, R.S. (2000) Combinatorial mRNA regulation: iron regulatory proteins and iso-iron-responsive elements (Iso-IREs). J. Biol. Chem. 275, 4065940662.
Vile, G.F., Basu-Modak, S., Waltner, C. & Tyrrell, R.M. (1994) Heme oxygenase 1 mediates an adaptive response to oxidative stress in human skin fibroblasts. Proc. Natl. Acad. Sci. USA 91, 26072610.
Vile, G.F. & Tyrrell, R.M. (1993) Oxidative stress resulting from ultraviolet A irradiation of human skin fibroblasts leads to a heme oxygenase-dependent increase in ferritin. J. Biol. Chem. 268, 1467814681.
Xie, C., Lovell, M.A. & Markesbery, W.R. (1998) Glutathione transferase protects neuronal cultures against four hydroxynonenal toxicity. Free Radic. Biol. Med. 25, 979988.[CrossRef][Medline]
Received: 4 October 2006
Accepted: 29 January 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |