|
|
||||||||
1 Initial Research Project (IRP), Okinawa Institute of Science and Technology Promotion Corporation (OIST), Uruma 904-2234, Okinawa, Japan
2 CREST, Japan Science and Technology Corporation, Graduate School of Biostudies, Kyoto University, Kyoto 606-8501, Japan
3 Kobe Advanced ICT Research Center, National Institute of Information and Communications Technology, Kobe 651-2401, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The principal properties of quiescent mammalian cells are as follows. Cells sense the nutrient signal to start or stop division and cell division cycle kinases (cyclin-dependent protein kinases; CDKs) are properly regulated. Cell shape is largely changed from the cell dividing state and chromosomes are in the pre-replicative state. Protein synthesis is largely shut down to a low maintenance mode and ribosome biogenesis is diminished. Little is known about how these arrested cells, called G0 cells in this report, are maintained. When G0 cells are exposed to growth factors or nutrients, their cell state changes and they enter the cell division cycle (Pardee 1974; Zetterberg & Larsson 1985). The identification of the molecular switch for division and arrest is crucial for understanding the molecular differences between cells in division and arrest.
The fission yeast Schizosaccharomyces pombe is an excellent model organism for studying cell cycle control, chromosome segregation, cytokinesis, cell shape and meiotic sexual reproduction (Egel 2003). The genome has been sequenced and contains ~4900 genes (Wood et al. 2002; http://www.genedb.org/genedb/pombe/index.jsp), thus allowing for the use of post-genomic approaches. A genome-wide transcriptome analysis using cDNA microarrays has been done for the mitotic cell cycle, meiosis and environmental stress (Mata et al. 2002; Chen et al. 2003; Rustici et al. 2004; Xue et al. 2004; Hansen et al. 2005; Peng et al. 2005; Chikashige et al. 2006).
In the synthetic medium Edinburgh minimal medium2 (EMM2), fission yeast cells divide every 3 h in the vegetative cell cycle (Fig. 1A). Cells are rod shaped and have variable lengths (7.515 µm) depending on the cell cycle stage. In the G2 interphase, cells are elongated. If NH4Cl (the nitrogen source) is removed from the medium, the cells rapidly divide (usually twice) and arrest mainly at G1 (cells contain 1C DNA). Although the majority of G0 cells is in the pre-replicative state, the minor post-replicative cells do exist in G0 and their frequencies are varied depending upon the cell cycle timing exposed to nitrogen-starvation (Mochida & Yanagida 2006). If cell populations consist of opposite mating types, the cells exit from the uncommitted G1 and enter meiotic conjugation (Nurse & Bissett 1981). Conjugated zygotes fuse the two nuclei to form a diploid nucleus for meiosis to produce four spores. In contrast, heterothallic haploid cells that have no mating partners are arrested under nitrogen starvation without entry into meiosis (Costello et al. 1986; Su et al. 1996). These cells are small and round (diameter ~5 µm) and never divide. If the nitrogen source is added back to the medium, the cells increase their volume (growth step) and resume vegetative division after 1012 h. Cell viability of these arrested cells (designated G0 hereafter) under nitrogen starvation conditions does not decrease for weeks and even months (Su et al. 1996). This property might be ecologically advantageous for yeast cells to survive in poor nitrogen surroundings. The G0 cells of S. pombe are metabolically active. If chromosome DNA is damaged by irradiation or chemical agents, the repair is fast and efficient like in vegetative cells (Mochida & Yanagida 2006). Turnover of a short-lived protein, Cut8 (Takeda & Yanagida 2005), is very rapid in the G0 phase as in the vegetative cell cycle, assayed in the presence of cycloheximide, a protein synthesis inhibitor (K. Takeda & M. Yanagida, unpublished data). In the present paper, we report the genome-wide analyses of candidate genes implicated in G0 control, and provide evidence that certain genes are required to support G0.
|
| Results |
|---|
|
|
|---|
Cells of the wild-type strain L972 h exponentially grown in EMM2 synthetic medium were transferred to nitrogen-deficient EMM2-N at 26 °C. Cells divided twice and then arrested for 48 h in EMM2-N. The resulting small round cells were designated as being in the G0 state (Fig. 1B, bottom right). The G0 culture was then transferred back to the NH4Cl-replenished medium (EMM2) at 26 °C, and cells that began growing and proliferating were harvested after 1, 2, 3.5, 6 and 9 h (designated R1, R2, R3.5, R6 and R9, respectively, in Fig. 1B). Cell shape and size were changed in these intermediary steps. Exponentially growing rod-shaped vegetative cells (Fig. 1B, top right) were designated VE.
DNA content analysis indicated that ~80% of G0 cells contained pre-replicative 1C DNA (Fig. 1B, bottom left) and that DNA replication was initiated 6 h after nitrogen replenishment (R6). Cell growth (cell size increase) was initiated around 4 h after nitrogen replenishment, 2 h prior to DNA replication (Fig. 1C). Mitosis and the first cell division were observed at 9 and 11 h, respectively (data not shown). The cell volume increase from G0 to mitosis was roughly threefold, calculated by considering each cell as a combination of two hemispheres with an intervening cylinder. The protein content per cell was then measured, using the method of Bradford (Fig. 1D); it began to increase after 23 h, slightly earlier than the timing for the cell size increase. The average protein content per cell increased approximately sixfold from G0 to VE. The G0 cells are thus not only small and round, but also contained much less protein than VE cells. This is consistent with the fact that autophagy is induced during nitrogen starvation (Ohsumi 2001; Nakashima et al. 2006; Kohda et al. 2007), and that the G0 cells contain a lot of vacuoles in the cytoplasm, in which proteins might be digested into small peptides and/or amino acids.
Cell size increase occurs before Rum1 destruction and Cig2 appearance
Rum1 protein, a CDK inhibitor, is abundant in G1 (Moreno & Nurse 1994; Labib & Moreno 1996). Immunoblots of S. pombe extracts showed that Rum1 was plentiful in G0 and decayed in R6 (Fig. 1E). The timing of the Rum1 decay coincided with DNA replication. In contrast, Cig2, the S phase cyclin of S. pombe (Mondesert et al. 1996), was absent in G0 but appeared in R6. The increase in cell size and protein content was thus initiated prior to replication, Rum1 decay, and Cig2 appearance. In other words, the start of cell growth was earlier than that of the cell cycle events involving Rum1 and Cig2.
After 912 h in the nitrogen-replenished EMM2 medium, cells entered mitosis, followed by cell division. This timing was 34 times longer than that of the generation time (3 h) for VE cells. The sixfold increase in the cellular protein content might simply require a longer time for G0 cells to resume the first mitosis. In the cycling VE cells, only a twofold increase is needed (Mitchison 1970). The mitotic size (1415 µm in length) of vegetative cells was identical to that for cells starting from G0, regardless of their initial DNA content. Although ~20% of G0 cells, which contain post-replicative 2C DNA, do not have to perform DNA replication prior to mitosis (Mochida & Yanagida 2006), all of the nitrogen-replenished cells entered mitosis with about the same timing. We presumed that a sufficient cell length was a critical requirement for both G0-started and cycling VE cells to undergo mitosis.
Changes in the cellular RNA composition from G0 to VE
Genome-wide analyses of S. pombe transcripts were performed using RNAs isolated from cells at G0, VE and the intermediary steps. The major ethidium bromide-stained rRNA bands were observed in the total RNAs (Fig. 1E, left panel). Some abundant RNA bands of unknown origin observed in G0 were absent in VE cells (indicated by the arrowheads). The band intensity for the 35S precursor rRNA considerably increased from R3.5 to R6, suggesting the production of rRNA during this time. Poly A RNAs were obtained from the total RNAs using oligo-dT beads (Fig. 1E, right). The relative intensity of certain RNA bands sharply increased from R1 and R2. Labeled cDNAs were prepared (Experimental procedures) and used for the cDNA microarray analyses.
Extensive changes in the transcript levels
To determine changes in the transcript levels, the dual-color method adapted to S. pombe (Chikashige et al. 2006) was used for the cDNA microarray hybridization assay. On the same microarray slide, the G0 levels were taken as the standards for each transcript in comparison with the levels at other time points. The ratios of transcript levels, calculated as the base-2 logarithm, between G0 and each time point were scored for each gene. The scores were normalized using the average of the raw data and deposited in the NCBI GEO (Gene Expression Omnibus) Database (<URL: http://www.ncbi.nlm.nih.gov/geo/> Accession number: GSE3336 [NCBI GEO] ). For ~500 genes (~10% of the total genes), signal intensities were below the detection threshold for either color label, whereas on the remaining ~4500 genes, ratios could be calculated. Their distribution profiles (the x- and y-axis for the normalized ratio and the number of genes, respectively) are shown in Fig. 2A.
|
Uneven chromosomal distributions of the regulated genes
Mapping of the genes along the three chromosomes of S. pombe demonstrated that the genes with transcripts whose levels changed extensively were not evenly arranged, but were frequently enriched at certain chromosomal loci (Fig. 2C). If these 1300 (650 each for increase and decrease) extensively altered genes were evenly arranged, the average number in a window of 20 was ~2.6 (650/5000 x 20). The down- or up-regulated genes were concentrated and produced frequency peaks of over 5.0. The highest down-regulated peaks (green) were over 15 at the left end of chromosome I. There were other down-regulated peaks at the telomeres. Transcripts from the same chromosomal ends are up-regulated upon nitrogen-starvation (Mata et al. 2002). Telomeric and other arm chromatin regions that showed large changes might thus be collectively regulated under different nutrient conditions (Chen et al. 2003; Sinha et al. 2006).
Most abundant transcripts in G0 and R6 are largely replaced
To gain information on the gross changes in transcriptional regulation upon nutritional stimulation, we first focused on transcripts that showed the highest fluorescent signals, which related to the actual transcript levels (van de Peppel et al. 2003; also see Northern blotting data in Fig. 5). The 30 most intense transcripts in G0 and R6 are shown in Fig. 3A and B, respectively. Their intensities were more than 20-fold greater than the average. Seven genes (green) were present in both lists, while the other genes were present in only G0 (blue) or R6 (red), indicating that the majority of the top 30 transcripts (77%: 23/30) was replaced between G0 and R6. The transcripts abundant in R6 are involved in ribosome biogenesis and translational control. The top 30 G0-abundant transcripts included seven genes involved in glycolysis: glyceraldehyde-3-phosphate dehydrogenases (Tdh1, Gpd3), fructose bis-phosphate aldolase (Fba1), pyruvate decarboxylase (SPAC1F8.07c), enolase (Eno101), triosephosphate isomerase (Tpi1) and alcohol dehydrogenase (SPAC9E9.09c). Gpm1 (phosphoglycerate mutase) was abundant in both G0 and R6.
|
|
Of the R6-abundant 30 transcripts, 20 were ribosomal proteins and the others included translational factors, amino acid metabolism and heat shock proteins. Transcripts abundant in R6 were often also abundant in G0. Of the top 100 transcripts in the R6 or VE lists, 99 were also in the top 300 in G0 (data not shown). Thirty transcripts in the top 100 in G0, however, were not in the top 300 in R6, suggesting that a considerable number of abundant transcripts in G0 diminished in R6. The difference between R6 and VE was very small: 94 of the top 100 genes in R6 and VE were the same (data not shown).
Two transition periods exist
A full set of intensity data from G0 to VE was obtained for 3732 transcripts. Among these 3732 transcripts, 979 showed only small alterations and were classified as SA (small alteration). We then attempted to classify the remaining 2753 genes with greater than twofold alterations in the transcript ratios at, at least one time point by clustering them on the basis of similarity using the "k-means" method (CLUSTER 3.0 software; Eisen et al. 1998). The best clustering data were obtained when all the data were divided by k = 8 (Fig. 4). The divided groups were designated DN1, DN2, DN3, DN4, UP1, UP2, UP3 and UP4, and their averaged time course changes are shown in Fig. 4A. The number of genes belonging to these groups is indicated in Fig. 4B. The actual gene names and products are listed in Supplementary Table S1.
|
Microarray data is consistent with Northern hybridization results
To examine whether the microarray data obtained in this study reflected the actual mRNA levels, Northern hybridization was performed for many of the genes. Eleven examples are shown in Fig. 5 (panels AK; see legends for an explanation of these gene transcripts). The hybridization patterns were consistent with the microarray data. In addition, potential transcriptional regulation might exist that could not be detected by microarray. There was an upward shift of the band for the Mcs6/Crk1 transcript, which is required for the activation of Cdc2 (Buck et al. 1995; Saiz & Fisher 2002) (panel J). As the mcs6+/crk1+ gene contained no intron, the band shift should not be due to alternative splicing. Transcriptional initiation or termination in this gene might be different between G0 and VE. Intense multiple bands detected as the transcripts for Cds1/Chk2 (Murakami & Okayama 1995) in G0 were diminished in R1 and the following periods (panel K). The physiological relevance of such a large change in the level of Cds1 transcripts from G0 to VE is unknown. The microarray signals of Cds1 in G0 seemed to be the sum of the full-length and fragmented bands.
Genes related to ribosome biogenesis, transcription and translation are up-regulated
Gene ontology for biological processes, cellular components and molecular functions (S. pombe Gene DB; <URL: http://www.genedb.org/genedb/pombe/index.jsp>) was applied to ~2700 genes with the P-values calculated (Tavazoie et al. 1999; Boyle et al. 2004), and the results are shown for the eight classified groups described above (summarized in Fig. 4B, right, and details described in Supplementary Table S2). The three up-regulated (UP1UP3) gene clusters are related to ribosome biogenesis (Kondoh et al. 2000), protein biosynthesis, and RNA polymerase I, RNA binding, processing, translation factors, tRNA modification and nucleases. The gene products are present in the cytoplasm, nucleolus and nuclear lumen. These transcripts were continuously or transiently up-regulated, but the transcript levels all increased after nitrogen replenishment. The levels of the remaining up-regulated UP4 cluster gene transcripts, which relate to translation, protein transport, chaperones, secretion and glycoprotein metabolism, increased after a delay. The gene products were present in mitochondria and endoplasmic reticulum to Golgi. The UP4 gene products are thus distinct from those of UP1UP3, and might enhance cell mass increase (growth).
Approximately 1000 SA transcripts showed few alterations before and after nitrogen replenishment. These transcripts are implicated in pol II-dependent transcription, RNA splicing, mRNA processing, DNA metabolism and cell cycle control. The gene products were present in chromosomes, chromatins, mitochondrial ribosomes, and so on.
Functionally diverse transcripts are down-regulated
The transcripts whose levels immediately decreased upon nitrogen replenishment were classified as DN1DN3 and might be involved in maintaining the G0 state. The genes belonging to the DN1DN3 clusters, however, were rather diverse. For example, 47 of 127 genes classified in the DN1 cluster that were continuously decreased have not been annotated for biological processes. DN1 also contained transcripts implicated in amine catabolism, oxidoreductase and hydrolase. The products of transiently decreased DN2DN3 cluster genes were abundant in vacuoles, mitochondria and membranes, and are functionally implicated in carbohydrate metabolism, autophagy, carbohydrate transport, reverse transcription, generation of precursor metabolites and energy, ubiquitin-dependent proteolysis, protein modification and mitochondrial ATPase function. The delayed decrease cluster DN4 is implicated in cell communication, signal transduction and responses to nutrient levels, and the gene products are abundant primarily in membranes.
Gene clusters with related functions are often under similar regulations
Members of certain gene clusters had similar response patterns upon nutritional replenishment (Fig. 6; the gene IDs and their product names are shown in Supplementary Table S3). Among the 152 genes implicated in ribosome biogenesis, most were immediately up-regulated with several exceptions. In contrast, the majority of the ~70 mitochondrial ribosome genes showed little change, indicating that they were under different regulatory mechanisms. The profiles of the unique subunits of RNA polymerase I and III were up-regulated, while there were few changes in the profile of the unique subunits of RNA polymerase II. The levels of each of the ~25 transcripts of autophagy (Ohsumi 2001; Nakashima et al. 2006; Kohda et al. 2007) and wtf (the pseudo genes containing a retrotransposon sequence; Wood et al. 2002) were significantly reduced after nitrogen replenishment. There was a sharp transient decline in approximately half of the glycolytic transcripts (DN2), and none of them was continuously up-regulated. Also, the profiles of the gene clusters of the pentose phosphate shunt, TCA cycle, and aerobic respiration had a similar pattern of transient decline. Several hexose transporter genes (Ght3Ght6) had a transient decline (DN2). Certain gene clusters had split responses; amino acid permeases were in UP1, UP2, DN1 and DN4, while transcripts related to the stress responses were grouped into DN1, DN2 and others. Upon nutritional replenishment, there was a sharp decline in some cytoskeletal transcripts. These genes might be involved in the maintenance of the G0 intracellular architecture for cytoskeletal network and trafficking. The profiles of other gene clusters, such as those for the pentose phosphate shunt, ethanol fermentation, ammonium transporter, chromatin silencing, histone deacetylase, histone acetylase and histone lysine methyl transferase, are also shown in Fig. 6.
|
To obtain functional insight into whether the genes belonging to the DN groups might be involved in maintaining the G0 cell state, we initially studied 43 DN group genes (22, 14, 6 and 1 genes for DN1, DN2, DN3 and DN4, respectively) by gene disruption. Also we studied 10 more genes regardless of which whether they belonged to the DN or UP groups. The resulting 53 deletion strains were examined to determine whether they are required to maintain cell viability in the vegetative and/or G0 state. These genes included those for enzymes, putative transcription factors, protein kinase- or phosphatase-related factors, cyclins, G-protein-related factors and chromatin regulators.
The 53 haploid gene disruptants (h, prototroph) produced colonies on complete YE plates at five different temperatures (20, 26, 30, 33 and 36 °C): they mostly developed normal-sized colonies except for two strains that were temperature-sensitive and one strain that produced small colonies with abnormal cell shape at any temperature. The 52 strains except the sick one were examined their viability in G0. Vegetatively growing cells in the liquid cultures were transferred to nitrogen-deficient EMM2-N for 24 h at 26 °C, and the resulting G0 cells were subsequently cultured at 26 and 42 °C in EMM2-N for 3672 h at 26 °C and for 1248 h at 42 °C, and then plated at 26 °C on YE to measure cell viability (%). The wild-type control G0 cells were resistant to incubation at 42 °C (Su et al. 1996). The reason for selecting 42 °C was that the G0 cells at 2036 °C were quite slow to lose viability (e.g., in distilled water the loss of viability required approximately 1 week). Heat stress at 42 °C was effective for accelerating the decrease in viability within 2448 h. Ten of those deletion strains had decreased cell viability in the G0 state faster than wild-type strain (Table 1, Experiment 1). The remaining 42 strains did not exhibit significant abnormalities in either the vegetative or G0 state under the experimental conditions used.
|
The nine genes that were required for maintaining cell viability in G0 consisted of five DN1, three DN3 and one UP3 (cyclin-like SPBC530.13). Three of the nine genes were implicated in transcriptional regulation. Two C2H2 type zinc-finger factors (SPAC1039.05c and SPBC1105.14) seemed to support the G0 state. SPBC530.13 contained a cyclin domain and was implicated in transcription as it was bound to a kinase that appeared to hyperphosphorylate the C-terminal repeat domain (CTD) of the largest subunit of RNA polymerase II (Sterner et al. 1995). Two genes (SPAC823.16c and SPAC589.07c) were similar to each other, and probably implicated in autophagy, in which proteins are degraded in the vacuoles, as they were similar to the budding yeast Svp1/Atg18 (Dove et al. 2004). The two CBS (cystathionine-ß-synthase) domain proteins, SPBC646.13/Sds23/Psp1/Moc1 (Ishii et al. 1996; Jang et al. 1997; Yakura et al. 2006) and a putative subunit of AMP-activated protein kinase (AMPK), SPAC1556.08c (designated Cbs2) were required for maintaining cell viability in G0, probably through their signal transduction functions, but their functional relationship is unknown. SPAC630.05 might be a GTPase-activating protein involved in vacuole transport as it was similar to the budding yeast Gyp7 (Vollmer et al. 1999). SPAC4F10.04 was a putative activator of protein phosphatase, as it was similar to the budding yeast RRD1 (Douville et al. 2006), which might involve in modulation of gene expression in response to rapamycin exposure. These nine gene products shed light on the genetic control of the nitrogen deficiency-induced G0 state in S. pombe, about which little is known.
| Discussion |
|---|
|
|
|---|
One conclusion from this study is that, after nitrogen replenishment to the G0-arrested S. pombe cells, two principal transitions occurred in the transcript levels prior to DNA replication. In the first immediate transition, the levels of ~1000 transcripts (~20% of the S. pombe genome) either increased or decreased more than fourfold. The maximum change was over 30-fold. Considering the fast reduction of many G0 transcripts upon nitrogen replenishment, the RNA degradation system must become highly active to specific sets of mRNAs. Curiously, the levels of such mRNA processing genes do not fluctuate in the course from the G0 to vegetative phase: they might be required for essential "housekeeping" even in G0 so that their regulation can only be observed at the level of post-translational modifications. We presume that the initial extensive transition in the transcript levels might reduce and replace many G0-active transcripts with those required for the exit from G0 or those leading to the initiation of cell growth, whereas the second transition might facilitate extensive growth or cell mass increase. For the first transition, macromolecular synthesis of proteins and RNAs (particularly rRNA) is strongly up-regulated: many of the top 30 transcripts in G0 are replaced by ribosome- and translation-related transcripts. In contrast, many of the transcripts were in the DN1-3 groups, which are abundant in G0 and rapidly decrease their levels upon nitrogen replenishment, are diverse, and unannoted. Particularly DN1 contains many unannoted genes. These functionally unknown genes are of considerable interest and should be the subject of further study.
Functionally authentic proteins encoded by the immediately down-regulated DN1DN3 transcripts are involved in diverse roles including catabolism of carbohydrate and amines, protein destruction by autophagy and proteasomes, and generation of precursor metabolites and ATP energy. We presume that the genes engaged in the functional maintenance of the G0 state are concentrated in DN1, as their transcript levels were low in the vegetative phase, whereas the decrease in levels during DN2 and DN3 were transient. Gene disruption analyses showed that 5 of the 22 DN1 genes examined are required to support the G0 state (see below). For the second extensive transition, the UP4 transcripts whose gene products are prominently located in the mitochondria and endoplasmic reticulum to Golgi might act to increase cell mass by protein transport, secretion and chaperoning, while the decrease of DN4 transcript levels might support alterations of membrane properties for cell communication and signal transduction. Combined with the fact that the DN2 and DN3 transcript levels are reversed after 3.5 h to the G0 levels, the cell state between 1 and 3.5-h after nitrogen replenishment should be distinct from both G0 and VE. The 13.5 h pre-replicative state might be considered as the transition period (TP), and the duration from the replication to post-replication period before the first mitosis as the post-transition period (PTP). The extensive cell mass increase occurs in PTP, while a small, but definitive cell mass increase occurs in TP. DNA replication is not needed for G0 cells that contain 2C DNA to enter the first mitosis (Mochida & Yanagida 2006), so replication is not essential for the progression from TP to PTP.
The changes in the transcript levels upon nitrogen replenishment suggest that transcriptional and post-transcriptional regulations occur upon nitrogen replenishment (Mata et al. 2005). A full set of gene disruptants, which would allow us to search for candidate genes, is not yet available for S. pombe. We performed a pilot study by disrupting 53 potential candidate genes, mainly among the down-regulated DN groups, and characterized phenotypes of those gene disruptants. We identified 9 of 53 gene-disrupted strains that were defective in supporting the G0 state, while they were normal under the vegetative condition. Among the nine genes, five belonged to DN1. Three of the nine genes are implicated in transcriptional control. One (SPAC1039.05c) encodes a similar protein to the Kruppel-like C2H2 type zinc-finger transcription factor. Kruppel transcription factors were initially found as a DNA-binding segmentation factor in Drosophila (Redemann et al. 1988; Licht et al. 1990). Many (~25) Kruppel-like factors (KLF) exist in humans, and their functions range from development and differentiation to tumor suppression (e.g., Carlson et al. 2006). Determining the target genes for SPAC1039.05c (designated Klf1) is essential for understanding its role in G0 control. Another C2H2 zinc-finger factor required for maintenance of the G0 state is Rsv2 (SPBC1105.14), which is similar to the budding yeast Rpn4, which regulates transcription of the proteasome genes (Mannhaupt et al. 1999). The third transcription-related gene (SPBC530.13) actually encodes a cyclin domain protein, and possibly regulates phosphorylation of the C-terminal repeat domain of the largest subunit of RNA polymerase II (Sterner et al. 1995). Two autophagy genes are implicated in G0 control. These results suggested that protein degradation by autophagy as well as by proteasomes, and protein phosphorylation dependent on a cyclin domain protein are needed for proper G0 control.
Two genes for CBS-domain proteins, sds23+ and cbs2+, were also required for vegetative growth as their deletion strains were temperature-sensitive. Although the deletion mutant of sds23 reported by Ishii et al. (1996) is also cold-sensitive, the newly made deletion mutant in this study only had temperature sensitivity, which might be due to differences in their background genotypes. sds23+ was initially identified as a high copy suppressor of the mutants defective in the APC (anaphase promoting complex)/cyclosome E3 ubiquitin ligase and type 1 protein phosphatase PP1. Cbs2 is the putative
-subunit of AMP-activated protein kinase that has diverse roles in various tissues and is required for sensing the intracellular energy state and acts as the upstream factor of the TSC (tuberous sclerosis), Rheb (Ras homology enriched in brain), and TOR (target of rapamycin) signal transduction pathways (e.g., Xue & Kahn 2006; Motoshima et al. 2006). Sds23 might be the most critical G0 control element, because the viability of Sds23-deletion mutant G0 cells is very rapidly lost at both 26 and 42 °C. The physiological relationship between Cbs2 and Sds23, however, remains to be determined.
In this study, our underlying question was whether S. pombe G0 arrested cells are similar to mammalian G0 cells. Our results support the view that many of the mammalian properties (Iyer et al. 1999; Yamamoto et al. 2006) are found in fission yeast G0 cells; nutrient signal sensing to start division, proper regulation of CDK, change in cell shape, regulation of DNA replication, massive scale limitation in ribosome biogenesis and protein synthesis. For further study, the use of fungi might be advantageous to identify the genes and their functions that are essential for the maintenance of, exit from, and entry into the G0 arrested state through the use of genetic, molecular and post-genomic methods. This report presents an initial, promising result regarding the use of a genetic approach.
| Experimental procedures |
|---|
|
|
|---|
The S. pombe heterothallic haploid 972 h wild-type cell strain (Gutz et al. 1974) was used. Nitrogen-starved G0 cells were prepared by the procedures previously described (Su et al. 1996). Briefly, cells exponentially grown in EMM2 (Mitchison 1970) to a density of 2 x 106 cells/mL at 26 °C were harvested by vacuum filtration using a nitrocellulose membrane (0.45 µm pore size), washed in EMM2-N (EMM2 lacking nitrogen sources) once on the membrane, and then re-suspended in EMM2-N at a concentration of 2 x 107 cells/mL. Because two rounds of cell division rapidly occurred, the resulting concentration reached ~8 x 107 cells/mL. The culture was maintained for 48 h in EMM2-N and used as the source of G0 cells. The nitrogen source was replenished by adding four volumes of fresh EMM2 medium. Cells were harvested at 0, 1, 2, 3.5 and 6 h. To measure the DNA content of the cells, flow cytometry was performed according to Su et al. (1996) using FACSCalibur (Becton Dickinson, San Jose, CA).
Calculation of cell volume
In the growing state as well as in G0, S. pombe cells appear as two hemispheres connected by a cylinder. Cell volume (V) was calculated by the following formula, using the length of the long axis (L) and the length of the short axis (the diameter, D); V =
D2(LD/3)/4. Using phase contrast microscopic photographs with a 100x lens, we measured the long axis (L) and the short axis (D) of ~100 cells in the G0 and vegetative states, and calculated cell volume.
Measurement of protein amount in cells
G0 cells prepared by 24-h nitrogen starvation (1 x 107 cells/mL) were released by adding one volume of EMM2 medium containing 2 times concentration of NH4Cl. The protein extraction procedures were as described in Nagao et al. (2004). Protein concentration in the extract was measured on the method of Bradford, using the Bio-Rad Protein Assay kit (Bio-Rad, Hercules, CA).
Immunoblotting
Total protein extracts were prepared using the trichloroacetic acid precipitation method (Nagao et al. 2004). The same amounts of protein were loaded into each lane. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed using 10% polyacrylamide gels and samples were blotted on to the nitrocellulose membranes. Anti-Rum1 (a gift from S. Moreno), Anti-Cig2 (a gift from H. Yamano), and anti-
-tubulin (a gift from K. Gull) were used as the primary antibodies. Horseradish peroxidase-conjugated secondary antibodies and an ECL chemiluminescence system (Amersham, Piscataway, NJ) were used to amplify signal expression. An LAS3000 (Fuji, Tokyo, Japan) was used for signal detection.
cDNA microarray hybridization
Microarrays were prepared according to the previously published procedures (Chikashige et al. 2006). Three hundred base pair cDNA fragments of the sense strand of all the S. pombe genes were dotted on to coated glass slides with a covalent bond at the 5' ends. The target mRNAs isolated from the G0 cells were labeled by reverse transcription using Cy3 fluorescent dye-conjugated nucleotides. Target mRNAs from cells at other time points (R1, R2, R3.5 and R6) and dividing cells (VE) were labeled with Cy5 dye. The concentrations of the labeled targets were normalized by total fluorescence intensities. Cy5-labeled target DNAs from each time point were individually mixed with Cy3-labeled G0 target, and hybridized to the cDNA microarray. The intensity scores from each gene were calculated as the ratios to the G0 scores. The ratios were normalized by the average of the total scores at each time point, which were expressed in a base-2 logarithmic scale. Thus, the intensity ratio scores do not indicate the absolute quantities of the transcripts, but rather correspond to the relative amount of the transcripts in the cells. The threshold value of the raw intensity scores was set on the average plus twice the standard deviation of the signals from negative control spots. Approximately 90% of the genes had valid scores at each time point.
GEO database accession number
The GEO database accession number is GSE3336 [NCBI GEO] .
Clustering of the genes by expression profiles and evaluation of the enrichment of the clusters within functional terms
CLUSTER 3.0 software (de Hoon et al. 2004) was used for performing the cluster analysis of the genes according to the expression profiles. The "k-means" clustering method using "Euclidean distance" was applied. For each cluster, we calculated P-values for observing the gene frequencies in terms of Gene Ontology, using GO::TERMFINDER software (Boyle et al. 2004). Gene Ontology data in the August 23, 2006, version of GeneDB database <URL: http://www.genedb.org/genedb/pombe> was used for this analysis.
Northern hybridization
Total RNA was isolated according to the acid phenol method described in <http://www.sanger.ac.uk/PostGenomics/S_pombe/>. Poly A RNA was isolated from the total RNA using the µMACS magnetic column system (Miltenyi Biotec, Gladbach, Germany). Poly A RNA from 40 µg of total RNA was loaded into each lane. A 1.2% agarose gel containing 0.6 M formaldehyde in MOPS buffer was used for the electrophoresis. For probes, PCR fragments of target genes were amplified from the S. pombe genomic DNA, and cloned into pGEM-T plasmid vectors. A second PCR was performed with digoxigenin-conjugated nucleotide (Roche, Basel, Switzerland) using those plasmids as templates. Signals were detected by AP-conjugated anti-digoxigenin antibodies and ECL system (Amersham) using the LAS3000 image analyzer (Fuji). Nucleotide sequences of the PCR primers used were as follows:
isp5; TGCAATTGGTACTGGTGTGT, GCTGAAGCCAGTATCCAAGT,
gst2; GCATGCTGGAGGACCCAATC, CTTGACAGCAGGTCGTGCAA,
cdc48; TGTCGTCCAATACCATGGAG, TCTCAATGCCGGATCGATAG,
gpd1; CTCCGTCGAGATCAAGGATG, GAAGATGGAGGAGTGGTTGT,
cig2; AATGCTGATGAGAAGGATAC, GAGCTTTCAACTAACTTTGG,
atb2; AAAATAGTGATGGCGGGTTT, GCACGCTTGCTATACATGAG,
SPBC359.03c; GAACCTGAGCATAAAGGGTT, AGGCAGCTAGATATCCTTGA,
mis3; AAGAATCAAGCTTCGCTACT, GATTTTCGCAGGTTTACGAC,
ura3; TCATTGGAAGCTTTTGAGTG, GCGAAGAGTATTTAATGCGA,
cut15; AAGCGTCGTAATCTGGTTGA, GTATCACCGACGGTTTCTGG,
crk1; GTGGGCCAGTTCAAAGATGG, TCAAGGGCTTGTTGAGCAGT,
cds1; GTGCACAATGGGTTTTGGAG, GGAGTACGATGTTCGTGTGT.
Gene disruption and cell viability assay in G0 state
Gene disruption was performed by replacing the target open reading frames with a Kan-MX6 marker gene cassette (Bähler et al. 1998), using the diploid host strain (the genotype: h+/h ade6-M210/ade6-M216 leu132/leu132). YE +G418 (geneticin) agar plate media was used for screening of the marker gene integration. Replacement of the target open reading frames was verified by PCR. After tetrad dissection, the haploid gene disruptants were backcrossed with a prototroph wild-type strain L972. The prototroph h- gene disruptants were isolated for the following viability assay. Wild-type and the gene-disrupted strains were first grown in complete medium (EMM2) at 26 °C, and then transferred to nitrogen-deficient EMM2-N medium at 26 °C. Twenty-four hours later, the resulting G0 cultures were split and transferred to 26 and 42 °C, or 26 and 33 °C, in EMM2-N, and portions of the cultures were taken and plated on complete YE medium at 26 °C. Cell viability was calculated as the percentage of the number of formed colonies against the number of plated cells (~300).
| Acknowledgements |
|---|
| Footnotes |
|---|
aPresent address: School of Food Science, Dongju College, Busan 604715, Korea.
| References |
|---|
|
|
|---|
Boyle, E., Weng, S., Gollub, J., Jin, H., Botstein, D., Cherry, J.M. & Sherlock, G. (2004) GO::TERMFINDERopen source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes. Bioinfomatics 20, 37103715.[CrossRef]
Buck, V., Russell, P. & Millar, J.B. (1995) Identification of a cdk-activating kinase in fission yeast. EMBO J. 14, 61736183.[Medline]
Carlson, C.M., Endrizzi, B.T., Wu, J., Ding, X., Weinreich, M.A., Walsh, E.R., Wani, M.A., Lingrel, J.B., Hogquist, K.A. & Jameson, S.C. (2006) Kruppel-like factor 2 regulates thymocyte and T-cell migration. Nature 442, 299302.[CrossRef][Medline]
Chen, D., Toone, W.M., Mata, J., Lyne, R., Burns, G., Kivinen, K., Brazma, A., Jones, N. & Bähler, J. (2003) Global transcriptional responses of fission yeast to environmental stress. Mol. Biol. Cell 14, 214229.
Chikashige, Y., Tsutsumi, C., Yamane, M., Okamasa, K., Haraguchi, T. & Hiraoka, Y. (2006) Meiotic proteins bqt1 and bqt2 tether telomeres to form the bouquet arrangement of chromosomes. Cell 125, 5969.[CrossRef][Medline]
Costello, G., Rodgers, L. & Beach, D. (1986) Fission yeast enters the stationary phase G0 state from either mitotic G1 or G2. Curr. Genet. 11, 119125.[CrossRef]
Douville, J., David, J., Lemieux, K.M., Gaudreau, L. & Ramotar, D. (2006) The Saccharomyces cerevisiae phosphatase activator RRD1 is required to modulate gene expression in response to rapamycin exposure. Genetics 172, 13691372.
Dove, S.K., Piper, R.C., McEwen, R.K., Yu, J.W., King, M.C., Hughes, D.C., Thuring, J., Holmes, A.B., Cooke, F.T., Michell, R.H., Parker, P.J. & Lemmon, M.A. (2004) Svp1p defines a family of phosphatidylinositol 3,5-bisphosphate effectors. EMBO J. 23, 19221933.[CrossRef][Medline]
Egel, E. (ed.) (2003) The Molecular Biology of Schizosaccharomyces pombe. Berlin: Springer-Verlag.
Eisen, M.B., Spellman, P.T., Brown, P.O. & Botstein, D. (1998) Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95, 1486314868.
Gutz, H., Heslot, H., Leupold, U. & Lopreno, N. (1974) Schizosaccharomyces pombe. In: Handbook of Genetics 1 (ed. R.C. King), pp. 395446. New York: Plenum Press.
Hansen, K.R., Burns, G., Mata, J., Volpe, T.A., Martienssen, R.A.B., Bähler, J. & Thon, G. (2005) Global effects on gene expression in fission yeast by silencing and RNA interference machineries. Mol. Cell. Biol. 25, 590601.
de Hoon, M.J., Imoto, S., Nolan, J. & Miyano, S. (2004) Open source clustering software. Bioinformatics 20, 14531454.
Ishii, K., Kumada, K., Toda, T. & Yanagida, M. (1996) Requirement for PP1 phosphatase and 20S cyclosome/APC for the onset of anaphase is lessened by the dosage increase of a novel gene sds23+. EMBO J. 15, 66296640.[Medline]
Iyer, V.R., Eisen, M.B., Ross, D.T., Schuler, G., Moore, T., Lee, J.C.F., Trent, J.M., Staudt, L.M., Hudson, J. Jr, Boguski, M.S., Lashkari, D., Shalon, D., Botstein, D. & Brown, P.O. (1999) The transcriptional program in the response of human fibroblasts to serum. Science 283, 8387.
Jang, Y.J., Won, M., Chung, K.S., Kim, D.U. & Hoe, K.L. (1997) A novel protein, Psp1, essential for cell cycle progression of Schizosaccharomyces pombe is phosphorylated by Cdc2-Cdc13 upon entry into G0-like stationary phase of cell growth. J. Biol. Chem. 272, 1999320002.
Kohda, T.A., Tanaka, K., Konomi, M., Sato, M., Osumi, M. & Yamamoto, M. (2007) Fission yeast autophagy induced by nitrogen starvation generates a nitrogen source that drives adaptation processes. Genes Cells 12, 155170.
Kondoh, H., Yuasa, T. & Yanagida, M. (2000) Mis3 with a conserved RNA binding motif is essential for ribosome biogenesis and implicated in the start of cell growth and S phase checkpoint. Genes Cells 5, 525541.[Abstract]
Labib, K. & Moreno, S. (1996) rum1: a CDK inhibitor regulating G1 progression in fission yeast. Trends Cell Biol. 6, 6266.[CrossRef][Medline]
Licht, J.D., Grossel, M.J., Figge, J. & Hansen, U.M. (1990) Drosophila Kruppel protein is a transcriptional repressor. Nature 346, 7679.[CrossRef][Medline]
Mannhaupt, G., Schnall, R., Karpov, V., Vetter, I. & Feldmann, H. (1999) Rpn4p acts as a transcription factor by binding to PACE, a nonamer box found upstream of 26S proteasomal and other genes in yeast. FEBS Lett. 450, 2734.[CrossRef][Medline]
Mata, J., Lyne, R., Burns, G. & Bähler, J. (2002) The transcriptional program of meiosis and sporulation in fission yeast. Nat. Genet. 32, 143147.[CrossRef][Medline]
Mata, J., Marguerat, S. & Bähler, J. (2005) Post-transcriptional control of gene expression: a genome-wide perspective. Trends Biochem. Sci. 30, 506514.[CrossRef][Medline]
Mitchison, J.M. (1970) Physiological and cytological methods for Schizosaccharomyces pombe. Methods Cell Physiol. 4, 131165.[CrossRef]
Mochida, S. & Yanagida, M. (2006) Distinct modes of DNA damage response in S. pombe G0 and vegetative cells. Genes Cells 11, 1327.
Mondesert, O., McGowan, C.H. & Russell, P. (1996) Cig2 a B-type cyclin promotes the onset of S in Schizosaccharomyces pombe. Mol. Cell. Biol. 16, 15271533.
Moreno, S. & Nurse, P. (1994) Regulation of progression through the G1 phase of the cell cycle by the rum1+ gene. Nature 367, 236242.[CrossRef][Medline]
Motoshima, H., Goldstein, B.J., Igata, M. & Araki, E. (2006) AMPK and cell proliferationAMPK as a therapeutic target for atherosclerosis and cancer. J. Physiol. 574, 6371.
Murakami, H. & Okayama, H. (1995) A kinase from fission yeast responsible for blocking mitosis in S-phase. Nature 374, 817819.[CrossRef][Medline]
Nagao, K., Adachi, Y. & Yanagida, M. (2004) Separase-mediated cleavage of cohesin at interphase is required for DNA repair. Nature 430, 10441048.[CrossRef][Medline]
Nakashima, A., Hasegawa, T., Mori, S., Ueno, M., Tanaka, S., Ushimaru, T., Sato, S. & Uritani, M. (2006) A starvation-specific serine protease gene, isp6+, is involved in both autophagy and sexual development in Schizosaccharomyces pombe. Curr. Genet. 49, 403413.[CrossRef][Medline]
Nurse, P. & Bissett, Y. (1981) Cell cycle gene required in G1 for commitment to cell division and in G2 for control of mitosis in fission yeast. Nature 292, 558560.[CrossRef][Medline]
Ohsumi, Y. (2001) Molecular dissection of autophagy: two ubiquitin-like systems. Nat. Rev. Mol. Cell Biol. 2, 211216.[CrossRef][Medline]
Pardee, A.B. (1974) A restriction point for control of normal animal cell proliferation. Proc. Natl. Acad. Sci. USA 71, 12861290.
Peng, X., Karuturi, R.K., Miller, L.D., Lin, K., Jia, Y., Kondu, P., Wang, L., Wong, L., Liu, E.T., Balasubramanian, M.K. & Liu, J. (2005) Identification of cell cycle-regulated genes in fission yeast. Mol. Biol. Cell 16, 10261042.
van de Peppel, J., Kemmeren, P., van Bakel, H., Radonjic, M., van Leenen, D. & Holstege, F.C. (2003) Monitoring global messenger RNA changes in externally controlled microarray experiments. EMBO Report 4, 387393.[CrossRef][Medline]
Redemann, N., Gaul, U. & Jackle, H. (1988) Disruption of a putative Cyszinc interaction eliminates the biological activity of the Kruppel finger protein. Nature 332, 9092.[CrossRef][Medline]
Rustici, G., Mata, J., Kivinen, K., Lio, P., Penkett, C.J., Burns, G., Hayles, J., Brazma, A., Nurse, P. & Bähler, J. (2004) Periodic gene expression program of the fission yeast cell cycle. Nature Genet. 36, 809817.[CrossRef][Medline]
Saiz, J.E. & Fisher, R.P. (2002) A CDK-activating kinase network is required in cell cycle control and transcription in fission yeast. Curr. Biol. 12, 11001105.[CrossRef][Medline]
Sato, S., Suzuki, H., Widyastuti, U., Hotta, Y. & Tabata, S. (1994) Identification and characterization of genes induced during sexual differentiation in Schizosaccharomyces pombe. Curr. Genet. 26, 3137.[CrossRef][Medline]
Sinha, I., Wiren, M. & Ekwall, K. (2006) Genome-wide patterns of histone modifications in fission yeast. Chromosome Res. 14, 95105.[CrossRef][Medline]
Sterner, D.E., Lee, J.M., Hardin, S.E. & Greenleaf, A.L. (1995) The yeast carboxyl-terminal repeat domain kinase CTDK-I is a divergent cyclin-cyclin-dependent kinase complex. Mol. Cell. Biol. 15, 57165724.
Su, S.S.Y., Tanaka, Y., Samejima, I., Tanaka, K. & Yanagida, M. (1996) A nitrogen starvation-induced dormant G0 state in fission yeast: the establishment from uncommitted G1 and its delay for return to proliferation. J. Cell Sci. 109, 13471357.[Abstract]
Takeda, K. & Yanagida, M. (2005) Regulation of nuclear proteasome by Rhp6/Ubc2 through ubiquitination and destruction of the sensor and anchor Cut8. Cell 122, 393405.[CrossRef][Medline]
Tavazoie, S., Hughes, J.D., Campbell, M.J., Cho, R.J. & Church, G.M. (1999) Systematic determination of genetic network architecture. Nat. Genet. 22, 281285.[CrossRef][Medline]
Vollmer, P., Will, E., Scheglmann, D., Strom, M. & Gallwitz, D. (1999) Primary structure and biochemical characterization of yeast GTPase-activating proteins with substrate preference for the transport GTPase Ypt7p. Eur. J. Biochem. 260, 284290.[Medline]
Wood, V., Gwilliam, R., Rajandream, M.A., et al. (2002) The genome sequence of Schizosaccharomyces pombe. Nature 415, 871880.[CrossRef][Medline]
Xue, Y., Haas, S.A., Brino, L., Gusnanto, A., Reimers, M., Talibi, D., Vingron, M., Ekwall, K. & Wright, A.P. (2004) A DNA microarray for fission yeast: minimal changes in global gene expression after temperature shift. Yeast 21, 2539.[CrossRef][Medline]
Xue, B. & Kahn, B.B. (2006) AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance through effects in the hypothalamus and peripheral tissues. J. Physiol. 574, 7383.
Yakura, M., Ishikura, Y., Adachi, Y. & Kawamukai, M. (2006) Involvement of Moc1 in sexual development and survival of Schizosaccharomyces pombe. Biosci. Biotechnol. Biochem. 70, 17401749.[CrossRef][Medline]
Yamamoto, T., Ebisuya, M., Ashida, F., Okamoto, K., Yonehara, S. & Nishida, E. (2006) Continuous ERK activation downregulates antiproliferative genes throughout G1 phase to allow cell-cycle progression. Curr. Biol. 16, 11711182.[CrossRef][Medline]
Zetterberg, A. & Larsson, O. (1985) Kinetic analysis of regulatory events in G1 leading to proliferation or quiescence of Swiss 3T3 cells. Proc. Natl. Acad. Sci. USA 82, 53655369.
Received: 28 November 2006
Accepted: 19 February 2007
This article has been cited by other articles:
![]() |
Y. Hanyu, K. K. Imai, Y. Kawasaki, T. Nakamura, Y. Nakaseko, K. Nagao, A. Kokubu, M. Ebe, A. Fujisawa, T. Hayashi, et al. Schizosaccharomyces pombe cell division cycle under limited glucose requires Ssp1 kinase, the putative CaMKK, and Sds23, a PP2A-related phosphatase inhibitor Genes Cells, May 1, 2009; 14(5): 539 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sajiki, M. Hatanaka, T. Nakamura, K. Takeda, M. Shimanuki, T. Yoshida, Y. Hanyu, T. Hayashi, Y. Nakaseko, and M. Yanagida Genetic control of cellular quiescence in S. pombe J. Cell Sci., May 1, 2009; 122(9): 1418 - 1429. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hayashi, M. Hatanaka, K. Nagao, Y. Nakaseko, J. Kanoh, A. Kokubu, M. Ebe, and M. Yanagida Rapamycin sensitivity of the Schizosaccharomyces pombe tor2 mutant and organization of two highly phosphorylated TOR complexes by specific and common subunits. Genes Cells, December 1, 2007; 12(12): 1357 - 1370. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |