GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2007) 12, 919-928. doi:10.1111/j.1365-2443.2007.01100.x
© 2007 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kani, S.
Right arrow Articles by Minami, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kani, S.
Right arrow Articles by Minami, Y.

Chk2 kinase is required for methylglyoxal-induced G2/M cell-cycle checkpoint arrest: implication of cell-cycle checkpoint regulation in diabetic oxidative stress signaling

Shuichi Kani1, Emiko Nakayama1, Akinori Yoda1, Nobuyuki Onishi1, Nagako Sougawa1, Yuki Hazaka1, Tsuyoshi Umeda2, Kohsuke Takeda2, Hidenori Ichijo2, Yasuhiro Hamada3 and Yasuhiro Minami1,*

1 Department of Physiology and Cell Biology, Faculty of Medical Sciences, Graduate School of Medicine, Kobe University, 7-5-1, Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan
2 Laboratory of Cell Signaling, Graduate School of Pharmaceutical Sciences, The University of Tokyo, CREST, Japan Science and Technology Corporation and Strategic Approach to Drug Discovery and Development in Pharmaceutical Sciences, Center of Excellence (COE) Program, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
3 Division of Diabetes, Digestive and Kidney Diseases, Department of Clinical Molecular Medicine, Graduate School of Medicine, Kobe University, 7-5-1, Kusunoki-cho, Chuo-ku, Kobe 650-0017, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Methylglyoxal (MG) is a reactive endogenous metabolite that is produced from the process of degradation of triose-phosphates. Under hyperglycemic conditions the rate of MG formation increases as a result of elevated concentrations of precursors. It has been established that MG elicits oxidative stress signaling, leading to the activation of MAP kinases, p38 MAPK and JNK, yet it remains largely unknown about a role of cell-cycle checkpoint regulation in MG-induced signaling. Here, we show that checkpoint kinases, Chk1 and Chk2, as well as their upstream ATM kinase are phosphorylated and activated following MG treatment of cultured cells. This MG-induced activation of Chk1 and Chk2 were inhibited by either aminoguanidine (AG), an inhibitor of production of advanced glycation end products (AGEs) or N-acetyl-L-cysteine (NAC), an anti-oxidant in dose dependent manners, indicating that oxidative stress via AGEs is involved critically in the activation of Chk1 and Chk2 by MG. Furthermore, it was found that cell-cycle synchronized cells exhibited G2/M checkpoint arrest following MG treatment, and that siRNA-mediated knock-down of Chk2, but not Chk1, results in a failure of MG-induced G2/M arrest. Thus, the results indicate a critical role for Chk2 in MG-induced G2/M cell-cycle checkpoint arrest.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Methylglyoxal (MG) is a highly reactive {alpha}-oxoaldehyde formed from triose phosphate intermediates during glycolysis, dihydroxyacetone phosphate and glyceraldehyde 3-phosphate (Phillips & Thornalley 1993; Richard 1993; Thornalley 1996). Increases in MG concentration in tissues and body fluids have been implicated in the development of diabetic complications (Mclellan et al. 1994). MG is one of the potent precursors of advanced glycation end products (AGEs). It has been reported that AGEs may result in the cross-linking of structural and basement membranes, thereby modifying crucial cellular structures that affect cellular functions. AGEs themselves can generate reactive oxygen species. The interaction of AGEs with the cell surface receptor RAGE (receptor for AGE) elicits oxidative stress signaling via activation of NADPH oxidase and mitochondrial pathways (Ramasamy et al. 2005). In addition, MG glycates DNA and RNA, in particular guanyl residues (Thornalley 2003; Frischmann et al. 2005). Modification of DNA by MG in cultured cells may induce single-strand DNA breaks, DNA-protein cross-linking and cell toxicity.

MG produced under hyperglycemic conditions has been indicated to be a potent inducer of apoptosis (Kang et al. 1996; Du et al. 2000; Milanesa et al. 2000). c-Jun N-terminal kinase (JNK) and p38 MAPK are representative members of MAPK-family, and are involved in the regulation of survival and apoptosis of cells (Kyriakis & Avruch 2001; Dent et al. 2003; Takeda et al. 2003). In fact, it is well established that MG activates JNK and/or p38 MAPK in various types of cultured cells, leading to cell cycle arrest and apoptosis (Du et al. 2000; Akhand et al. 2001; Liu et al. 2003; Fukunaga et al. 2004, 2005). For example, MG has been shown to induce apoptosis of rat mesangial cells and Schwann cells via activation of p38 MAPK (Liu et al. 2003; Fukunaga et al. 2004, 2005). It has also been reported that stimulation of human endothelial cells and Jurkat cells, a human T cell lymphoma line, with MG results in apoptosis of these cells through activation of JNK and/or p38 MAPK (Du et al. 2000; Akhand et al. 2001). Furthermore, it has been shown that treatment of cells with inhibitors for JNK or p38 MAPK suppress MG-induced apoptosis (Liu et al. 2003; Fukunaga et al. 2004, 2005). It has been considered that apoptosis signal-regulated kinase 1 (ASK1), a member of the MAPKKK-family, may be an upstream protein kinase at least for JNK in Jurkat cells following MG stimulation (Du et al. 2001).

It has been well appreciated that genotoxic stresses activate cell-cycle checkpoint machinery to maintain genomic integrity (Motoyama & Naka 2004; Eyfjord & Bodvarsdottir 2005; Ishikawa et al. 2006). Upon DNA damage, ataxia-telangiectasia-mutated (ATM) and/or ATM and Rad3-related (ATR) kinases are activated rapidly, and these kinases then phosphorylate and activate checkpoint kinases, Chk1 and Chk2, thereby amplifying the DNA damage signal to execute cell-cycle checkpoint regulation (Bartek & Lukas 2003; Ahn et al. 2004; Chen & Sanchez 2004; McGowan & Russell 2004; Traven & Heierhorst 2005). It has been reported that oxidative stresses also activate ATR and/or ATM kinases, and their downstream checkpoint kinases to activate cell-cycle checkpoint machinery (Barzilai & Yamamoto 2004; Helt et al. 2005). Although MG has been shown to induce cell-cycle arrest of several cultured cells (e.g. human leukemia HL60 cells and prostatic PC-3 cells) at G1 (Kang et al. 1996; Milanesa et al. 2000), it remains largely unknown about the role(s) of cell-cycle checkpoint regulation in MG-induced cell-cycle arrest, followed by apoptosis.

In this study, we examined the acute effect(s) of MG on cultured cells, in particular the role(s) of cell-cycle checkpoint regulation in MG-induced stress signaling. We show that both Chk1 and Chk2, in addition to stress responsive MAP kinases, JNK and p38 MAPK, are activated rapidly and transiently following MG stimulation of HEK293 cells, and that activation of these kinases are inhibited by either aminoguanidine (AG), an inhibitor of production of AGEs, or N-acetyl-L-cysteine (NAC), an anti-oxidant. Furthermore, it was found that MG treatment of HEK293 cells results in G2/M cell-cycle checkpoint arrest, and that Chk2, but not Chk1, is required for this MG-induced G2/M cell-cycle arrest. We will discuss our findings in light of the roles of cell-cycle checkpoint regulation in diabetic complications.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Activation of checkpoint kinases, Chk1 and Chk2, in mesangial cells and HEK293 cells following methylglyoxal (MG) stimulation

It has been reported that MG induces activation of MAP kinases, p38 MAPK and JNK, in various types of cells, including mesangial cells (Du et al. 2000; Akhand et al. 2001; Liu et al. 2003; Fukunaga et al. 2004, 2005). To verify MG-induced activation of these MAP kinases in human mesangial cells and HEK293 cells, we monitored phosphorylation status of p38 MAPK and JNK that are reliable surrogate markers for these kinase activation by using phosphorylation site-specific antibodies (see Experimental procedures) following stimulation with either MG (400 µM) or H2O2 (100 µM) as a positive control. As shown in Fig. 1, like H2O2 stimulation, MG stimulation of mesangial cells or HEK293 cells resulted in drastic increases in phosphorylation of threonine 180 (T180) and tyrosine 182 (Y182) in p38 MAPK, and of threonine 183 (T183) and tyrosine 185 (Y185) in JNK, indicating that MG indeed induces activation of p38 MAPK and JNK.


Figure 1
View larger version (49K):
[in this window]
[in a new window]

 
Figure 1  MG-induced activation of checkpoint kinases in human mesangial cells and HEK293 cells. (A) Mesangial cells were treated with MG (400 µM) or H2O2 (100 µM) for 0.5 h. WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho ATM (S1981), anti-ATM, anti-phospho Chk1 (S317), anti-Chk1, anti-phospho Chk2 (T68), anti-Chk2, anti-phospho p38 MAPK (T180/Y182), anti-p38 MAPK, anti-phospho JNK (T183/Y185) or anti-JNK antibodies, as indicated. (B) HEK293 cells were treated with MG (400 µM) or H2O2 (100 µM) for 0.5 h. WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho ATM (S1981), anti-ATM, anti-phospho Chk1 (S317), anti-Chk1, anti-phospho Chk2 (T68), anti-Chk2, anti-phospho p53 (S15 and S20), anti-p53, anti-phospho p38 MAPK (T180/Y182), anti-p38, anti-phospho JNK (T183/Y185) or anti-JNK antibodies, as indicated.

 
Although it has been shown that MG induces cell-cycle arrest and/or apoptosis of various cultured cells (Kang et al. 1996; Du et al. 2000; Milanesa et al. 2000; Akhand et al. 2001; Liu et al. 2003; Fukunaga et al. 2004, 2005), it remains entirely unknown about the roles of checkpoint kinases, Chk1 and Chk2, in MG-induced cell-cycle arrest. It has been appreciated that upon DNA damage, Chk1 and Chk2 are phosphorylated by ATM and/or ATR kinases at serine 317 (S317) and serine 345 (S345) in Chk1 and at threonine 68 (T68) in Chk2, resulting in activation of Chk1 and Chk2, respectively (Melchionna et al. 2000; Chen & Sanchez 2004). Thus, we next examined whether or not cell-cycle checkpoint kinases, Chk1 and Chk2, are activated in mesangial cells or HEK293 cells in response to MG or H2O2 stimulation by using phosphorylation site-specific anti-Chk1 and -Chk2 antibodies (see Experimental procedures). MG or H2O2 stimulation of mesangial cells or HEK293 cells resulted in phosphorylation of S317 in Chk1 and of T68 in Chk2 (Fig. 1), suggesting that both Chk1 and Chk2 are activated upon MG stimulation. In fact, MG stimulation of HEK293 cells induced reproducible phosphorylation of serine 20 (S20) in p53 (Fig. 1B), a well-established p53 phosphorylation site by activated Chk1 and Chk2 (Bartek & Lukas 2003), although to a lesser extent when compared to that observed by H2O2 stimulation.

We then monitored phosphorylation status of ATM kinase that is one of the crucial upstream activators for Chk1 and Chk2 to verify MG-induced activation of ATM. Consistent with the activation of Chk1 and Chk2 by MG treatment, MG stimulation of mesangial cells or HEK293 cells resulted in a weak, but apparent phosphorylation of serine 1981 (S1981) in ATM (Fig. 1), a reliable biochemical marker for ATM activation (Bakkenist & Kastan 2003; Shreeram et al. 2006), suggesting that ATM is activated by MG treatment. It was also found that MG stimulation of HEK293 cells induced phosphorylation of serine 15 (S15) in p53 (Fig. 1B), a well-established p53 phosphorylation site by activated ATM (Traven & Heierhorst 2005; Fujimoto et al. 2006).

Kinetics of activation of ASK1, an upstream activator for p38 MAPK and JNK, and of Chk1 and Chk2 in HEK293 cells following MG stimulation

We next examined kinetics of activation of p38 MAPK and JNK following stimulation of HEK293 cells with MG (400 µM). As shown in Fig. 2A, phosphorylation of p38 MAPK increased following MG stimulation, reached maximal levels within 5–15 min, and sustained up to 1 h, while phosphorylation of JNK was induced at 15 min after MG stimulation, and decreased rapidly thereafter. Maximal phosphorylation levels of p38 MAPK and JNK following MG stimulation were observed at lower extents when compared to those observed by stimulation with H2O2 (1 mM, for 15 min). Since ASK1 is a common upstream molecule for activation of both MKK3/MKK6-p38 MAPK and MKK4/MKK7-JNK pathways (Ichijo et al. 1997; Tobiume et al. 2002; Takeda et al. 2003), we also examined whether or not ASK1 is activated following MG stimulation. To verify activation of ASK1, we monitored phosphorylation of threonine 838 (T838) of ASK1 (human), that is a reliable biochemical marker for ASK1 activation (Tobiume et al. 2002; Takeda et al. 2003), by using a phosphorylation site-specific antibody. As shown in Fig. 2A, phosphorylation of threonine 838 (T838) in ASK1 was induced by MG stimulation within 5 min, and decreased gradually thereafter. MG-induced activation of ASK1 preceded those of p38 MAPK and JNK, suggesting that ASK1 is an upstream molecule of p38 MAPK and JNK in response to MG stimulation. We then monitored kinetics of MG-induced activation of Chk1 and Chk2. As shown in Fig. 2B, phosphorylation of both Chk1 and Chk2 was induced by MG stimulation with rather slower kinetics, compared to those of ASK1, p38 MAPK and JNK, reached maximal levels at 0.5–1 h, and decreased gradually thereafter. These results indicate that activation of ASK1, p38 MAPK, JNK, and of Chk1, Chk2 are early biochemical events with differential kinetics during MG-induced stress signaling.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Figure 2  Activation of ASK1, JNK, and checkpoint kinases in HEK293 cells following MG stimulation. HEK293 cells were treated with MG (400 µM), and cells were harvested at the indicated time points. (A) WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho ASK1 (T838), anti-ASK1, anti-phospho p38 MAPK (T180/Y182), anti-p38 MAPK, anti-phospho JNK (T183/Y185) or anti-JNK antibodies, as indicated. (B) WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho Chk1 (S317), anti-Chk1, anti-phospho Chk2 (T68) or anti-Chk2 antibodies, as indicated.

 
Inhibition of MG-induced activation of p38 MAPK and JNK, and of Chk1 and Chk2, by NAC and AG

It has been shown that MG-induced intracellular peroxide production can be quenched by the presence of NAC, acting as an anti-oxidant (Che et al. 1997; Sagrista et al. 2002). We thus investigated the effect of NAC on MG-induced activation of p38 MAPK and JNK, and of Chk1 and Chk2. As expected, in the absence of NAC treatment of HEK293 cells with MG (400 µM) or H2O2 (100 µM) induced significant activation of p38 MAPK, JNK, Chk1 and Chk2 as assessed by immunoblot analysis with phosphorylation site-specific antibodies (Fig. 3A). However, MG- and H2O2-induced activation of these protein kinases was inhibited by NAC in dose-dependent manners (Fig. 3A). The results indicate that activation of both p38 MAPK/JNK- and Chk1/Chk2-pathways are mediated by intracellular peroxide production induced by MG stimulation. On the other hand, AG has been shown to act as an efficient scavenger for MG (Che et al. 1997; Thornalley et al. 2000), thereby inhibiting MG-induced production of advanced AGEs and of subsequent intracellular peroxide production. Therefore, we also examined the effect of AG on MG- and H2O2-induced activation of p38 MAPK and JNK, and of Chk1 and Chk2 by using an essentially identical experimental approach described above. As shown in Fig. 3B, activation of these protein kinases induced by MG (400 µM), but not H2O2 (100 µM), was drastically inhibited by AG (200 µM). Collectively, these results indicate that MG-induced activation of p38 MAPK and JNK, and of Chk1 and Chk2, was attributable to production of AGEs by MG, and subsequent intracellular peroxide production, presumably elicited by interaction of AGEs with RAGE (receptor for AGEs) (Ramasamy et al. 2005).


Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
Figure 3  Effect of NAC and AG on MG-induced phosphorylation of Chk1, Chk2, p38 and JNK kinases in HEK293 cells. (A) HEK293 cells were treated with or without MG (400 µM) or H2O2 (100 µM), in the presence or absence of NAC (10 or 20 mM) for 0.5 h. WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho Chk1 (S317), anti-Chk1, anti-phospho Chk2 (T68), anti-Chk2, anti-phospho p38 (T180/Y182), anti-p38, anti-phospho JNK (T183/Y185) or anti-JNK antibodies, as indicated. (B) HEK293 cells were treated with or without MG (400 µM) or H2O2 (100 µM), in the presence or absence of AG (200 µM) for 0.5 h. WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-phospho Chk1 (S317), anti-Chk1, anti-phospho Chk2 (T68), anti-Chk2, anti-phospho p38 (T180/Y182), anti-p38, anti-phospho JNK (T183/Y185) or anti-JNK antibodies, as indicated.

 
8-hydroxy-2'-deoxyguanosine (8-OHdG) production by MG-induced oxidative stress signaling

Chk1 and Chk2 kinases have been shown to be activated in response to DNA damage (Bartek & Lukas 2003; Ahn et al. 2004; Chen & Sanchez 2004; McGowan & Russell 2004). It has also been shown that MG can induce production of intracellular peroxide and glycate guanyl residues in DNA (Che et al. 1997; Thornalley et al. 2000; Sagrista et al. 2002; Thornalley 2003). Thus, it is conceivable that treatment of cultured cells with MG would indeed induce DNA damage. Since oxidative stress-induced DNA damage has been shown to associate with production of 8-OHdG (Floyd 1990; Toyokuni & Sagripanti 1996), we examined whether or not MG can induce production of 8-OHdG in HEK293 cells. To this end, 8-OHdG in DNAs from HEK293 cells treated with MG (800 µM), in the absence or presence of NAC (20 mM), was quantitated by a competitive enzyme-linked immunosorbent assay as described in Experimental procedures. As shown in Fig. 4, treatment of HEK293 cells with MG resulted in significant production of 8-OHdG, and this MG-induced 8-OHdG production was inhibited in the presence of NAC. MG-induced 8-OHdG production was also detected when HEK293 cells were treated with MG (400 µM) (data not shown). The result suggests that MG can induce DNA damage via oxidative stress signaling.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Figure 4  Effect of MG on 8-OHdG production in HEK293 cells in the presence or absence of NAC. HEK293 cells were treated with or without MG (800 µM), in the presence or absence of NAC (20 mM) for indicated periods. Cellular DNAs were extracted and hydrolyzed, and 8-OHdG in DNA was quantitated as described in Experimental procedures. The data are expressed as the mean ± SD [relative to the levels in untreated (control) cells] of three independent experiments.

 
G2/M cell-cycle arrest of HEK293 cells following MG stimulation

MG stimulation has been shown to induce G1 cell-cycle arrest of human leukemia HL60 cells and prostatic PC-3 cells (Kang et al. 1996; Milanesa et al. 2000). Therefore, we examined the effect of MG on cell-cycle progression of HEK293 cells. Since continuously growing cells are not suitable to analyze cell-cycle regulation, we employed nocodazole (NOC)-induced blockade to synchronize HEK293 cells at metaphase as described in Experimental procedures (Zieve et al. 1980). After treatment of HEK293 cells with NOC (70 ng/mL) for 12 h, the cells were synchronized at G2/M phase as assessed by cell-cycle analysis using propidium iodide as described in Experimental procedures [Fig. 5, top panel (left)]. Upon removal of NOC, the cells were released from cell-cycle arrest, re-entered their cell-cycle, and a large fraction of the cells were detected at G1 and S phases at 24 h after removal of NOC [Fig. 5, top panel (right)]. Interestingly, when the cells were treated with MG (800 µM) for 24 h after removal of NOC, most of cells were observed at G2/M phase [Fig. 5, 3rd panel from top (right)]. Furthermore, MG-induced G2/M cell-cycle arrest was almost completely inhibited by the presence of NAC (20 mM) or AG (200 µM) [Fig. 5, bottom panel (right), and see Supplementary Fig. S1]. Treatment of HEK293 cells with MG (400 µM) also resulted in G2/M cell-cycle arrest, yet to a somewhat lower extent compared to that with MG (800 µM) (data not shown). The results indicate that MG can induce G2/M cell-cycle arrest of HEK293 cells via oxidative stress signaling.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Figure 5  Effect of MG on cell-cycle progression of synchronized HEK293 cells in the presence or absence of NAC. HEK293 cells were synchronized at metaphase by treatment with NOC for 12 h as described in Experimental procedures. After washing out NOC, cells were treated with or without MG (800 µM) in the presence or absence of NAC (20 mM) as indicated, then cells were harvested 24 h after MG treatment. Cell-cycle distributions were determined by flow cytometric analysis as described in Experimental procedures.

 
Critical role of Chk2, but not Chk1, in MG-induced G2/M cell-cycle arrest of HEK293 cells

We next examined whether Chk1 and/or Chk2 are required for MG-induced G2/M cell-cycle arrest of HEK293 cells. To this end, we first performed siRNA-mediated knock-down of Chk1 and Chk2 in HEK293 cells. Transfection of HEK293 cells with Chk1 siRNA and Chk2 siRNA (#1 or #2) resulted in significant suppression of Chk1 and Chk2 expression in the cells, respectively (Fig. 6A, and see Supplementary Fig. S2A). After transfection of HEK293 cells with control siRNA, Chk1 siRNA or Chk2 siRNA (#1 or #2), the respective cells were treated with NOC for 12 h to synchronize their cell-cycle at G2/M phase. Most of the cells transfected with control siRNA, Chk1 siRNA or Chk2 siRNA (#1 or #2) were detected at G2/M phase [Fig. 6B (left panels), and see Supplementary Fig. S2B (left panels)]. Upon removal of NOC, the respective cells restarted their cell-cycle progression beyond G2/M phase, yet the cells transfected with Chk1 siRNA displayed somewhat delayed cell-cycle progression compared to the cells transfected with control siRNA or Chk2 siRNA (#1 or #2) [Fig. 6B (middle panels), and see Supplementary Fig. S2B (middle panels)], suggesting that Chk1 is required for proper cell-cycle progression at least beyond G2/M phase. Intriguingly, HEK293 cells transfected with control siRNA or Chk1 siRNA, but not Chk2 siRNA (#1 or #2), exhibited G2/M cell-cycle arrest when the respective cells were treated with MG for 24 h [Fig. 6B (right panels), and see Supplementary Fig. S2B (right panels)]. The results indicate that Chk2, but not Chk1, is required for MG-induced G2/M cell-cycle arrest of HEK293 cells.


Figure 6
View larger version (27K):
[in this window]
[in a new window]

 
Figure 6  Effect of siRNA-mediated knock-down of Chk1 or Chk2 on MG-induced G2/M arrest. (A) HEK293 cells were transfected with control siRNA, Chk1 siRNA or Chk2 siRNA #1. WCLs were subjected to SDS-PAGE, transferred onto a PVDF membrane, and then immunoblotted with anti-Chk1, anti-Chk2 or anti-ß-actin antibodies, as indicated. (B) HEK293 cells were transfected with control siRNA, Chk1 siRNA or Chk2 siRNA #1. After 48 h of transfection, the respective cells were arrested at G2/M phase by treatment with NOC for 12 h, and then synchronously release into the cell-cycle by washing out NOC as described in Experimental procedures. Cells were then treated with MG (400 µM), and harvested 24 h after MG treatment. Cell-cycle distributions were determined by a flow cytometric analysis as described in Experimental procedures.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
It has been well established that the reactive glycolysis-derived dicarbonyl metabolite MG can induce stress signaling by activating ASK1-JNK/p38 MAPK pathway in cultured cells (Du et al. 2000, 2001; Akhand et al. 2001; Liu et al. 2003; Fukunaga et al. 2004, 2005). In the present study, we show for the first time that MG also elicits cell-cycle checkpoint signaling by activating ATM-Chk1/Chk2 pathway. ATM, Chk1 and Chk2 kinases are activated following stimulation of mesangial cells and HEK293 cells with MG (Fig. 1). MG-induced activation of Chk1 and Chk2 occurred transiently, and were also observed in a human T cell lymphoma line, Jurkat cells (Fig. 2B, and see Supplementary Fig. S3). Based on our findings that MG-induced activation of Chk1 and Chk2 was inhibited by an anti-oxidant N-acetyl-L-cysteine (NAC) and an inhibitor of advanced glycation end products (AGEs) production aminoguanidine (AG) (Fig. 3), and that MG induced production of 8-OHdG (Fig. 4), it can be assumed that MG induces production of AGEs, and of subsequent intracellular peroxide via AGEs–RAGE interaction, and that its resultant intracellular peroxide elicits DNA damage-induced cell-cycle checkpoint signaling by activating ATM, Chk1 and Chk2. We further show that MG induces G2/M cell-cycle checkpoint arrest of HEK293 cells (Fig. 5), and that Chk2, but not Chk1, is required for this cell-cycle checkpoint arrest (Fig. 6, and see Supplementary Fig. S2).

Taken together with previous reports, our present findings indicate that both ASK1-JNK/p38 MAPK and ATM-Chk1/Chk2 pathways are involved in MG-induced cell-cycle arrest and/or apoptosis of cultured cells. Interestingly, it should be noted that these two pathways share common or related effector molecules, that is, p53 and Cdc25 proteins, to induce cell-cycle arrest and/or apoptosis (Wahl & Carr 2001; Donzelli & Draetta 2003; Bode & Dong 2004). In response to various stresses, p53 is phosphorylated on S20 and T81 by JNK, on S15, S33, S46 and S392 by p38 MAPK, on S15 by ATM, and on S20 by Chk1 and Chk2 (Wahl & Carr 2001; Bode & Dong 2004). On the other hand, following extrinsic stress stimulation, Chk1/Chk2 and p38 MAPK phosphorylate Cdc25A/Cdc25C and Cdc25B, respectively, to inhibit the function of these Cdc25 proteins, resulting in the cell-cycle arrest (Donzelli & Draetta 2003). Thus, it can be assumed that ASK1-JNK/p38 MAPK and ATM-Chk1/Chk2 may phosphorylate p53 and Cdc25 proteins coordinately to regulate cell-cycle arrest and/or apoptosis.

It has been reported that MG induces G1 cell-cycle arrest of human leukemia HL60 cells and prostatic PC-3 cells (Kang et al. 1996; Milanesa et al. 2000). In this study we utilized NOC-induced blockade to examine the effect of MG on cell-cycle regulation of HEK293 cells, since we failed to detect apparent growth arrest of continuously growing HEK293 cells at a particular cell-cycle point following MG stimulation (data not shown). It was found that MG induces G2/M cell-cycle arrest of synchronized HEK293 cells (Fig. 5). The result suggests that the effect of MG on cell-cycle regulation may be different, depending on cell-types or cellular contexts. Further study will be required to clarify the molecular basis of cell-type dependent effects of MG on cell-cycle regulation.

We further show by using siRNA-mediated gene knock-down that Chk1, but not Chk2, is required for proper cell-cycle progression of synchronized HEK293 cells after NOC-induced cell-cycle blockade, and that Chk2, but not Chk1, is required for MG-induced G2/M cell-cycle checkpoint arrest of HEK293 cells (Fig. 6, and see Supplementary Fig. S2). Despite of the functional similarity and redundancy of Chk1 and Chk2 in cell-cycle checkpoint regulation, several differences in their expression profile and functions have been reported (Bartek & Lukas 2003; Ng et al. 2004). Chk2 is a stable protein expressed throughout the cell-cycle and appears to be largely inactive in the absence of DNA damage, while Chk1 is a labile protein expressed mainly in S and G2 phases and has basal activity even in the absence of DNA damage, yet is further activated in response to DNA damage (reviewed in Bartek & Lukas 2003). Furthermore, Chk1, but not Chk2, is essential for mammalian development and viability (Takai et al. 2000, 2002). Interestingly, it has been shown that Chk1, but not Chk2, is involved in G2/M arrest of colon carcinoma cell line HCT-116 (p21–/– and p53–/–), but not HCT-116 (p21+/+ and p53+/+), in response to ionizing radiation or cis-diamine-dichloroplatinum (DDP) treatment (Carrassa et al. 2004), suggesting an importance of cellular contexts (e.g. absence or presence of p21 and p53). Thus, our current findings indicate the differential roles of Chk1 and Chk2 in cell-cycle progression and MG-induced cell-cycle arrest of HEK293 cells, although cellular contexts have also to be considered with a caveat.

Increased formation of MG has been implicated in the development of diabetic complications due to hyperglycemia-related metabolism (Mclellan et al. 1994; Beisswenger et al. 2001). Here we show that acute effects of MG on cultured cells (mesangial cells, HEK293 cells and Jurkat cells) are transient activation of ATM-Chk1/Chk2 and ASK1-JNK/p38 MAPK pathways (Figs 1 and 2, see Supplementary Fig. S3, and data not shown), and that MG induces G2/M cell-cycle arrest of HEK293 cells (Fig. 5). At present it remains unclear how these relatively acute effects of MG observed in vitro are related to the development of diabetic complications due to continuously increased formation of MG under diabetic conditions in vivo. In this study we also found that MG-induced G2/M cell-cycle arrest of HEK293 cells can be abrogated by suppressed expression of Chk2, but not Chk1 (Fig. 6, and see Supplementary Fig. S2), suggesting an important role(s) of Chk2 in cellular response(s) following MG stimulation. It will be of interest to examine whether Chk2-deficient mice are susceptible or resistant to sustained hyperglycemic conditions.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cells, antibodies and chemical reagents

HEK293 cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Nissui) supplemented with 10% (v/v) fetal calf serum (FCS). Normal human mesangial cells were purchased from Cambrex. Human mesangial cells were maintained in MsBM medium (Cambrex) supplemented with 5% (v/v) FCS. Anti-Chk2 antibody was obtained as described previously (Fujimoto et al. 2006). Anti-phospho-Chk2 (Thr68), anti-phospho-ATM (Ser1981), anti-phospho-Chk1 (Ser317), anti-phospho-p53 (Ser15 and Ser20), anti-phospho-p38 MAPK (T180/Y182), anti-p38 MAPK and anti-phospho-JNK (T183/Y185) antibodies were purchased from Cell Signaling. Anti-ATM and anti-Chk1 antibodies were purchased from Upstate and MBL, respectively. Anti-p53 and anti-JNK antibodies were purchased from Santa Cruz. Anti-phospho-ASK1 (T838) and anti-ASK1 antibodies were as described previously (Tobiume et al. 2002). Methylglyoxal (MG) was purchased from Nacalai Tesque. N-acetyl-L-cysteine (NAC), aminoguanidine (AG) and nocodazole (NOC) were from Sigma.

siRNA

The siRNA duplexes were 21 base pairs including a 2-base nucleotide overhang synthesized by RNAI Co., Ltd. The sequence of the Chk1 siRNA and Chk2 siRNA (#1 and #2) oligos were CCAGAUGCUCAGAGAUUCUUC, CGCCGUCCUUUGAAUAACAAU and CUCUUACAUUGCAUACAUACU, respectively. The control siRNA oligo used was GUACCGCACGUCAUUCGUAUC. Cells were transfected with siRNA duplexes using GeneSilencer (Gene Therapy Systems) following the manufacturer's instructions.

Preparation of cell lysates and immunoblot analysis

Cells were solubilized with lysis buffer [50 mM Tris–HCl (pH 7.4), 0.5% (v/v) NP-40, 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 1 mM Na3VO4, 1 mM phenylmethyl sulphonyl fluoride (PMSF), 10 µg/mL leupeptin and 10 µg/mL aprotinin], and cell lysates were prepared by centrifugation at 12 000 g for 15 min at 4 °C. Whole cell lysates (WCLs) were separated by SDS-PAGE (8% or 9% PAG), and transferred onto PVDF membrane filters (Immobilon, Millipore). The membranes were then immunoblotted with the respective antibodies, and bound antibodies were visualized with HRP-conjugated antibodies against mouse or rabbit IgGs (Bio-Rad) using the chemiluminescence reagent (Renaissance, NEN).

Quantitation of cellular 8-OHdG

DNA was isolated by the chaotropic NaI method. HEK293 cells (5 x 106) were suspended in 3.2 mL 50 mM Tris–HCl buffer (pH 8.0), containing 100 mM NaCl, 20 mM EDTA, 1% SDS and 0.25 mg/mL proteinase K. After incubation for 2 h at 50 °C, 4.8 mL 7.6 M NaI was added followed by additional incubation for 10 min at 60 °C. After the addition of 8 mL isopropanol, the content in the tube was mixed well by inversion until a whitish precipitate appeared. The precipitate was collected by centrifugation at 25 000 x g for 10 min and washed with 1 mL of 40% isopropanol (w/v), followed by 1 mL of 70% ethanol (w/v). Extracted DNA (250 µg) was hydrolyzed by treatment with nuclease P1 (6 unit) for 60 min at 37 °C and then with alkaline phosphatase (2 unit) for 1 h at 37 °C. After removal of proteins, the oxidative DNA adduct 8-hydroxy-2'-deoxyguanosine (8-OHdG) in DNA was quantitated by a competitive enzyme-linked immunosorbent assay using Highly Sensitive 8-OHdG Check ELISA (Nikken SEIL Co., Ltd) following the manufacturer's instructions. Spectrophotometric analyses were performed by using Emax (Molecular Devices), and data were analyzed by SOFTMAX PRO (version 4.x, Molecular Devices).

Cell-cycle synchronization and flow cytometric analysis

Cells were transfected with control siRNA, Chk1 siRNA or Chk2 siRNA. NOC-induced blockade was performed at 48 h after transfection by treating transfected cells with 70 ng/mL NOC for 12 h to synchronize cells at metaphase. Subsequently, synchronized cells were released into the cell-cycle by washing out NOC. Cells were then treated with MG (400 or 800 µM), and harvested at 24 h after MG treatment. To analyze DNA contents, cells were fixed with ice-cold 70% (v/v) ethanol, and then resuspended in 0.2% Triton X-100/ PBS containing 20 µg/mL RNase A for 15 min at 37 °C. DNA was stained with propidium iodide (20 µg/mL), and cytometric analysis was performed on a flow cytometer (FACScan, Becton-Dickinson Immunocytometry Systems). Collected data were processed by the CELLQUEST.


    Acknowledgements
 
We thank M. Nishita for critical reading of the manuscript. This work was supported by a Grant-in-Aid for Scientific Research in Priority Areas (YM), a Grant-in-Aid for Young Scientists (B) (AY), a grant from the 21st Century COE Program "Center of excellence for signal transduction disease: diabetes mellitus as model" (SK, EN, NS and YM), from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and by Daiichi Pharmaceutical Co., Ltd. NO is a research fellow of the Japan Society for the Promotion of Sciences.


    Footnotes
 
Communicated by: Kohei Miyazono

* Correspondence: E-mail: minami{at}kobe-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Ahn, J., Urist, M. & Prives, C. (2004) The Chk2 protein kinase. DNA Repair 3, 1039–1047.[CrossRef][Medline]

Akhand, A.A., Hossain, K., Mitsui, H., Kato, M., Miyata, T., Inagi, R., Du, J., Takeda, K., Kawamoto, Y., Suzuki, H., Kurokawa, K. & Nakashima, I. (2001) Glyoxal and methylglyoxal trigger distinct signals for MAP family kinases and caspase activation in human endothelial cells. Free Radic. Biol. Med. 31, 20–30.[CrossRef][Medline]

Bakkenist, C.J. & Kastan, M.B. (2003) DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 421, 499–506.[CrossRef][Medline]

Bartek, J. & Lukas, J. (2003) Chk1 and Chk2 kinases in checkpoint control and cancer. Cancer Cell 3, 421–429.[CrossRef][Medline]

Barzilai, A. & Yamamoto, K. (2004) DNA damage responses to oxidative stress. DNA Repair 3, 1109–1115.[Medline]

Beisswenger, P.J., Howell, S.K., O'Dell, R.M., Wood, M.E. & Szwergold, B.S. (2001) {alpha}-Dicarbonyls increase in the postprandial period and reflect the degree of hyperglycemia. Diabetes Care 24, 726–732.[Abstract/Free Full Text]

Bode, A.M. & Dong, Z. (2004) Post-translational modification of p53 in tumorigenesis. Nat. Rev. Cancer 4, 793–805.[CrossRef][Medline]

Carrassa, L., Broggini, M., Erba, E. & Damia, G (2004) Chk1, but not Chk2, is involved in the cellular response to DNA damaging agents: differential activity in cells expressing or not p53. Cell Cycle 3, 1177–1181.[Medline]

Che, W., Asahi, M., Takahashi, M., Kaneto, H., Okada, A., Higashiyama, S. & Taniguchi, N. (1997) Selective induction of heparin-binding epidermal growth factor-like growth factor by methylglyoxal and 3-deoxyglucosone in rat aortic smooth muscle cells. J. Biol. Chem. 272, 18453–18459.[Abstract/Free Full Text]

Chen, Y. & Sanchez, Y. (2004) Chk1 in the DNA damage response: conserved roles from yeasts to mammals. DNA Repair 3, 1025–1032.[CrossRef][Medline]

Dent, P., Yacoub, A., Fisher, P.B., Hagan, M.P. & Grant, S. (2003) MAPK pathways in radiation responses. Oncogene 22, 5885–5896.[CrossRef][Medline]

Donzelli, M. & Draetta, G.F. (2003) Regulating mammalian checkpoints through Cdc25 inactivation. EMBO Rep. 4, 671–677.[CrossRef][Medline]

Du, J., Suzuki, H., Nagase, F., Akhand, A.A., Ma, X.-Y., Yokoyama, T., Miyata, T. & Nakashima, I. (2001) Superoxide-mediated early oxidation and activation of ASK1 are important for initiating methylglyoxal-induced apoptosis process. Free Radic. Biol. Med. 31, 469–478.[CrossRef][Medline]

Du, J., Suzuki, H., Nagase, F., Akhand, A.A., Yokoyama, T., Miyata, T., Kurokawa, K. & Nakashima, I. (2000) Methylglyoxal induces apoptosis in Jurkat leukemia T cells by activating c-Jun N-terminal kinase. J. Cell. Biochem. 77, 333–344.[CrossRef][Medline]

Eyfjord, J.E. & Bodvarsdottir, S.K. (2005) Genomic instability and cancer: networks involved in response to DNA damage. Mutat. Res. 592, 18–28.[Medline]

Floyd, R.A. (1990) The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis 11, 1447–1450.[Free Full Text]

Frischmann, M., Bidmon, C., Angerer, J. & Pischetsrieder, M. (2005) Identification of DNA adducts of methylglyoxal. Chem. Res. Toxicol. 18, 1586–1592.[CrossRef][Medline]

Fujimoto, H., Onishi, N., Kato, N., Takekawa, M., Xu, X.Z., Kosugi, A., Kondo, T., Oishi, I., Yoda, A., Imamura, M. & Minami, Y. (2006) Regulation of the anti-oncogenic Chk2 kinase by the oncogenic Wip1 phosphatase. Cell Death Differ. 13, 1170–1180.[CrossRef][Medline]

Fukunaga, M., Miyata, S., Higo, S., Hamada, Y., Ueyama, S. & Kasuga, M. (2005) Methylglyoxal induces apoptosis through oxidative stress-mediated activation of p38 mitogen-activated protein kinase in rat Schwann cells. Ann. NY Acad. Sci. 1043, 151–157.[CrossRef][Medline]

Fukunaga, M., Miyata, S., Liu, B.F., Miyazaki, H., Hirota, Y., Higo, S., Hamada, Y., Ueyama, S. & Kasuga, M. (2004) Methylglyoxal induces apoptosis through activation of p38 MAPK in rat Schwann cells. Biochem. Biophys. Res. Commun. 320, 689–695.[CrossRef][Medline]

Helt, C.E., Cliby, W.A., Keng, P.C., Bambara, R.A. & O’Reilly, M.A. (2005) Ataxia telangiectasia mutated (ATM) and ATM and Rad3-related protein exhibit selective target specificities in response to different forms of DNA damage. J. Biol. Chem. 280, 1186–1192.[Abstract/Free Full Text]

Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K. & Gotoh, Y. (1997) Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 275, 90–94.[Abstract/Free Full Text]

Ishikawa, K., Ishii, H. & Saito, T. (2006) DNA damage-dependent cell cycle checkpoints and genomic stability. DNA Cell Biol. 25, 406–411.[CrossRef][Medline]

Kang, Y., Edwards, L.G. & Thornalley, P.J. (1996) Effect of methylglyoxal on human leukaemia 60 cell growth: modification of DNA, G1 growth arrest and induction of apoptosis. Leukemia Res. 20, 397–405.[CrossRef][Medline]

Kyriakis, J.M. & Avruch, J. (2001) Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 81, 807–869.[Abstract/Free Full Text]

Liu, B.-F., Miyata, S., Hirota, Y., Higo, S., Miyazaki, H., Fukunaga, M., Hamada, Y., Ueyama, S., Muramoto, O., Uriuhara, A. & Kasuga, M. (2003) Methylglyoxal induces apoptosis through activation of p38 mitogen-activated protein kinase in rat mesangial cells. Kidney Int. 63, 947–957.[CrossRef][Medline]

McGowan, C.H. & Russell, P. (2004) The DNA damage response: sensing and signaling. Curr. Opin. Cell Biol. 16, 629–633.[CrossRef][Medline]

Mclellan, A.C., Thornalley, P.J., Benn, J. & Sonksen, P.H. (1994) The glyoxalase system in clinical diabetes mellitus and correlation with diabetic complications. Clin. Sci. 87, 21–29.[Medline]

Melchionna, R., Chen, X.B., Blasina, A. & McGowan, C.H. (2000) Threonine 68 is required for radiation-induced phosphorylation and activation of Cds1. Nat. Cell Biol. 2, 762–765.[CrossRef][Medline]

Milanesa, D.M., Choudhury, M.S., Mallouh, C., Tazaki, H. & Konno, S. (2000) Methylglyoxal-induced apoptosis in human prostate carcinoma: potential modality for prostate cancer treatment. Eur. Urol. 37, 728–734.[CrossRef][Medline]

Motoyama, N. & Naka, K. (2004) DNA damage tumor suppressor genes and genomic instability. Curr. Opin. Genet. Dev. 14, 11–16.[CrossRef][Medline]

Ng, C.P., Lee, H.C., Ho, C.W., Arooz, T., Siu, W.Y., Lau, A. & Poon, R.Y. (2004) Differential mode of regulation of the checkpoint kinases Chk1 and Chk2 by their regulatory domains. J. Biol. Chem. 279, 8809–8819.

Phillips, S.A. & Thornalley, P.J. (1993) The formation of methylglyoxal from triose phosphate. Investigation using a specific assay for methylglyoxal. Eur. J. Biochem. 212, 101–105.[Medline]

Ramasamy, R., Vannucci, S.J., Yan, S.S., Herold, K., Yan, S.F. & Schmidt, A.M. (2005) Advanced glycation end products and RAGE: a common thread in aging, diabetes, neurodegeneration, and inflammation. Glycobiology 15, 16R–28R.[Abstract/Free Full Text]

Richard, J.P. (1993) Mechanism for the formation of methylglyoxal from triosephosphates. Biochem. Soc. Trans. 21, 549–553.[Medline]

Sagrista, M.L., Garcia, A.E., Africa De Madariaga, M. & Mora, M. (2002) Antioxidant and pro-oxidant effect of the thiolic compounds N-acetyl-L-cysteine and glutathione against free radical-induced lipid peroxidation. Free Radic. Res. 36, 329–340.[CrossRef][Medline]

Shreeram, S., Demidov, O.N., Hee, W.K., Yamaguchi, H., Onishi, N., Kek, C., Timofeev, O.N., Dudgeon, C., Fornace, A.J., Anderson, C.W., Minami, Y., Appella, E. & Bulavin, D.V. (2006) Wip1 phosphatase modulates ATM-dependent signaling pathways. Mol. Cell 23, 757–764.[CrossRef][Medline]

Takai, H., Naka, K., Okada, Y., Watanabe, M., Harada, N., Saito, S., Anderson, C.W., Appella, E., Nakanishi, M., Suzuki, H., Nagashima, K., Sawa, H., Ikeda, K. & Motoyama, N. (2002) Chk2-deficient mice exhibit radioresistance and defective p53-mediated transcription. EMBO J. 21, 5195–5205.[CrossRef][Medline]

Takai, H., Tominaga, K., Motoyama, N., Minamishima, Y.A., Nagahama, H., Tsukiyama, T., Ikeda, K., Nakayama, K., Nakanishi, M. & Nakayama, K. (2000) Aberrant cell cycle checkpoint function and early embryonic death in Chk1–/– mice. Genes Dev. 14, 1439–1447.[Abstract/Free Full Text]

Takeda, K., Matsuzawa, A., Nishitoh, H. & Ichijo, H. (2003) Roles of MAPKKK ASK1 in stress-induced cell death. Cell Struct. Funct. 28, 23–29.[CrossRef][Medline]

Thornalley, P.J. (1996) Pharmacology of methylglyoxal: formation, modification of proteins and nucleic acids, and enzymatic detoxification—a role in pathogenesis and anti-proliferative chemotherapy. Gene Pharmacol. 27, 565–573.

Thornalley, P.J. (2003) Protecting the genome: defence against nucleotide glycation and emerging role of glyoxalase I in multidrug resistance in cancer chemotherapy. Biochem. Soc. Trans. 31, 1372–1377.[Medline]

Thornalley, P.J., Yurek-George, A. & Argirov, O.K. (2000) Kinetics and mechanism of the reaction of aminoguanidine with the {alpha}-oxoaldehydes glyoxal, methylglyoxal, and 3-deoxyglucosone under physiological conditions. Biochem. Pharmacol. 60, 55–65.[CrossRef][Medline]

Tobiume, K., Saitoh, M. & Ichijo, H. (2002) Activation of apoptosis signal-regulating kinase 1 by the stress-induced activating phosphorylation of pre-formed oligomer. J. Cell. Physiol. 191, 95–104.[CrossRef][Medline]

Toyokuni, S. & Sagripanti, J.-L. (1996) Association between 8-hydroxy-2'-deoxyguanosine formation and DNA strand breaks mediated by copper and iron. Free Radic. Biol. Med. 20, 859–864.[CrossRef][Medline]

Traven, A. & Heierhorst, J. (2005) SQ/TQ cluster domains: concentrated ATM/ATR kinase phosphorylation site regions in DNA-damage-response proteins. Bioessays 27, 397–407.[CrossRef][Medline]

Wahl, G.M. & Carr, A.M. (2001) The evolution of diverse biological responses to DNA damage: insights from yeast and p53. Nat. Cell Biol. 3, E277–E286.[CrossRef][Medline]

Zieve, G.W., Turnbull, D., Mullins, J.M. & McIntosh, J.R. (1980) Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole: nocodazole accumulated mitotic cells. Exp. Cell Res. 126, 397–405.[CrossRef][Medline]

Received: 14 January 2007
Accepted: 25 April 2007




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Yoda, K. Toyoshima, Y. Watanabe, N. Onishi, Y. Hazaka, Y. Tsukuda, J. Tsukada, T. Kondo, Y. Tanaka, and Y. Minami
Arsenic Trioxide Augments Chk2/p53-mediated Apoptosis by Inhibiting Oncogenic Wip1 Phosphatase
J. Biol. Chem., July 4, 2008; 283(27): 18969 - 18979.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kani, S.
Right arrow Articles by Minami, Y.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Kani, S.
Right arrow Articles by Minami, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS