GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2008) 13, 1015-1026. doi:10.1111/j.1365-2443.2008.01223.x
© 2008 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makio, T.
Right arrow Articles by Endo, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Makio, T.
Right arrow Articles by Endo, T.

Identification and characterization of a Jem1p ortholog of Candida albicans: dissection of Jem1p functions in karyogamy and protein quality control in Saccharomyces cerevisiae

Tadashi Makio1,{dagger}, Shuh-ichi Nishikawa1,*, Takeshi Nakayama1, Hiroyuki Nagai1 and Toshiya Endo1,2,3

1 Department of Chemistry, Graduate School of Science, and
2 The Institute for Advanced Research, and
3 The Core Research for Evolutional Science and Technology (CREST), Japan Science Technology Corporation (JST), Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Jem1p of yeast Saccharomyces cerevisiae is a J-domain containing co-chaperone (J protein) in the endoplasmic reticulum (ER) lumen. Jem1p is required for nuclear fusion during mating (karyogamy) and functions together with another J protein, Scj1p, in protein folding and quality control in the ER as a partner for the ER Hsp70 (BiP/Kar2p). Candida albicans has a gene encoding a homolog of S. cerevisiae Jem1p, CaJem1p. CaJem1p localized in the ER when expressed in S. cerevisiae, and expression of CaJem1p from a single-copy plasmid suppressed the temperature sensitive growth and the ER quality control defect of the jem1{Delta}scj1{Delta} mutant, indicating that CaJem1p is functional in S. cerevisiae. However, CaJem1p suppressed the karyogamy defect of the jem1{Delta} mutant only when it was over-expressed from a multicopy plasmid. Domain-swapping experiments showed that this was due to the difference between the N-terminal domains of ScJem1p and CaJem1p. The N-terminal domain of ScJem1p is essential for its function and interacts with Nep98p, a component of the spindle pole body involved in karyogamy. Since the interaction of CaJem1p with Nep98p is weaker than that of ScJem1p, the Nep98p-ScJem1p interaction is likely important for promoting karyogamy in S. cerevisiae.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
J-domain containing co-chaperones (J proteins) are the functional partners of Hsp70 molecular chaperones. J proteins are characterized by their common functional domain, the J domain, that is essential for interactions with Hsp70 (Walsh et al. 2004). Since DnaJ, a bacterial J protein, was identified in Escherichia coli, a growing number of J proteins have been identified in Archea, Eubacteria and eukaryotic organisms on the basis of sequence analyses of the developing genome database. The budding yeast Saccharomyces cerevisiae has 22 possible J proteins (Walsh et al. 2004).

Jem1p of S. cerevisiae (ScJem1p) is a J protein in the ER lumen, which functions as a partner for BiP, an Hsp70 in the ER lumen. ScJem1p is a protein of 645 amino acids long with an N-terminal signal sequence and the J domain, which is essential for functions of ScJem1p, at its C-terminal region (Nishikawa & Endo 1997, 1998; Fig. 1A). The region of about 500 residues (the N-terminal domain) between the signal sequence and the J domain does not show homology to any known proteins or functional domains. Genetic analyses have shown that ScJem1p functions in protein folding and quality control in the ER together with Scj1p, another J protein in the ER lumen (Nishikawa & Endo 1997; Silberstein et al. 1998). Although single disruptions of the JEM1 or SCJ1 genes did not cause any defects in yeast growth, the jem1{Delta}scj1{Delta} double mutant showed a temperature-sensitive growth defect (Nishikawa & Endo 1997) and is defective in protein folding and quality control in the ER, so that misfolded or aberrant proteins form aggregates in the ER lumen at restrictive temperature (Nishikawa et al. 2001).


Figure 1
View larger version (51K):
[in this window]
[in a new window]

 
Figure 1  Jem1p of S. cerevisiae and C. albicans. (A) Schematic representations of Jem1 proteins of S. cerevisiae (ScJem1p) and C. albicans (CaJem1p) and their chimeric proteins ScN-CaC and CaN-ScC. Domain structures are shown. The black boxes and the gray circles show signal sequences and TPR motifs, respectively. Positions of putative N-linked glycosylation sites are shown. J, J domain of ScJem1p (residues 535–610) and CaJem1p (residues 487–560). (B) Total cell extracts (0.5 OD600 cells per lane) from strains expressing either HA-tagged ScJem1p (lanes 2 and 5), HA-tagged CaJem1p (lanes 3 and 6) or vector alone (lanes 1 and 4) from a single-copy (lanes 4, 5 and 6) or a multicopy plasmid (lanes 1, 2 and 3) were analyzed by immunoblotting with the anti-HA monoclonal antibody. (C) Cells expressing ScJem1p (panels d–f), CaJem1p (panels g–i), or the vector alone (panels a–c) from a multicopy plasmid were fixed and subjected to immunofluorescence microscopy with the anti-HA antibody and anti-BiP antibodies. Images were taken for the anti-HA antibody (panels a, d and g), anti-BiP antibodies (panels b, e and h), and DAPI (panels c, f and i) staining. Bar, 5 µm. (D) Glutathione agarose beads were first incubated with GST (lane 1), wild-type (WT) GST-ScJem1p (lane 2), GST-ScJem1p with the H566Q mutation (HQ; lane 3), wild-type (WT) GST-CaJem1p (lane 4), or GST-CaJem1p with the H517Q mutation (HQ; lane 5) and second with purified BiP with 1 mM ATP. Beads were then washed as described in Experimental Procedures, and the final eluate was analyzed by SDS-PAGE and stained with Sypro Orange.

 
ScJem1p also functions in nuclear fusion during mating (karyogamy). In the sexual phase of budding yeast, haploid cells of the opposite mating types mate to produce diploid cells. During mating, haploid cells fuse to produce a zygote, and two haploid nuclei fuse to produce a diploid nucleus (Rose 1996). Nuclear fusion (karyogamy) can be divided into two steps, nuclear congression and nuclear membrane fusion (Kurihara et al. 1994), and BiP functions in the nuclear membrane fusion step in cooperation with the two J proteins, Sec63p and ScJem1p, as partners (Ng & Walter 1996; Nishikawa & Endo 1997). ScJem1p and Sec63p appear to function in different steps in the nuclear membrane fusion because over-expression of the SEC63 or JEM1 gene did not suppress the karyogamy defect of the jem1{Delta} or sec63 mutant, respectively (Brizzio et al. 1999). A yeast two-hybrid screening identified an integral membrane protein of the spindle pole body (SPB), Nep98p/Mps3p, as an ScJem1p-interacting protein (Jaspersen et al. 2002; Nishikawa et al. 2003). A temperature sensitive nep98 mutant showed defects in karyogamy, suggesting its role in karyogamy (Nishikawa et al. 2003).

In the present study, we found a gene (CaJEM1) encoding a homolog of ScJem1p in the genome of Candida albicans. We cloned the CaJEM1 gene and analyzed the function of its gene product, CaJem1p, in S. cerevisiae. Low-level expression of CaJEM1 could suppress the temperature-sensitive growth defect of the jem1{Delta}scj1{Delta} strain and its ER quality control defect. In contrast, CaJEM1 suppressed the karyogamy defect of the jem1{Delta} strain only when it was over-expressed from a multicopy plasmid. This inefficient suppression activity of CaJem1p indicates that CaJem1p cannot interact with proteins including Nep98p/Mps3p, which function in karyogamy of S. cerevisiae very efficiently as ScJem1p does.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The Jem1p homolog of Candida albicans is an ER protein

Recent progress in fungal genome projects has enabled us to perform comparative genome sequence analyses between S. cerevisiae and its neighboring yeast species. We thus found a gene (deposited in the database as ORF19.3592 and ORF19.11074, which are alleles of each other) in the genome of C. albicans that encodes a protein with high similarity to S. cerevisiae Jem1p, and named it CaJEM1 (Candida albicans JEM1). We use the name of ScJEM1 for the S. cerevisiae JEM1 gene in this article to distinguish it from CaJEM1.

CaJem1p comprises of 636 amino acid residues and has an N-terminal signal sequence and the J domain in its C-terminal region (Fig. 1A). Amino acid sequences of CaJem1p and ScJem1p show 17% and 40% identities in the N-terminal domain (residues 22–475 in CaJem1p and residues 24–523 in ScJem1p) and the C-terminal domain containing the J domain (residues 476–636 in CaJem1p and residues 524–645 in ScJem1p), respectively. The N-terminal domain of CaJem1p is predicted to contain four tetratricopeptide repeat (TPR) motifs, which may function in protein–protein interactions while ScJem1p does not contain such a motif. We amplified the DNA segment corresponding to the CaJEM1 gene with 500 bp flanking regions from the C. albicans genome by PCR. Since the CTG codon is translated as Ser, not as Leu, in C. albicans (Santos et al. 1993), we replaced the sole CTG codon (the 431st codon) of CaJEM1 with TCG so that the amino acid sequence of CaJem1p expressed in S. cerevisiae is the same as that expressed in C. albicans. A single-copy plasmid harboring the gene for the C-terminally 3 x HA-tagged version of CaJem1p or ScJem1p was introduced into wild-type S. cerevisiae cells, and expression of CaJem1p or ScJem1p from their own promoters was analyzed by immunoblotting with the anti-HA monoclonal antibody. ScJem1p and CaJem1p were detected as 80 and 71 kDa proteins, respectively (Fig. 1B, lanes 5 and 6), which were not observed for the cells containing a vector alone (Fig. 1B, lane 4). The amount of CaJem1p was somewhat larger than that of ScJem1p, indicating that the CaJEM1 promoter functions efficiently in S. cerevisiae cells. The expression level of the 3 x HA-tagged version of CaJem1p or ScJem1p became significantly higher when we used a multicopy plasmid instead of the single-copy plasmid as an expression vector (Fig. 1B, lanes 2 and 3).

We next analyzed subcellular localization of 3 x HA-tagged CaJem1p by immunofluorescence microscopy. Cells expressing CaJem1p or ScJem1p as a control from a multicopy plasmid were fixed and stained with the anti-HA antibody. We observed perinuclear staining with several extensions in the cytoplasm for CaJem1p (Fig. 1C, panel g), which is typical for staining of yeast ER proteins such as ScJem1p (Fig. 1C, panel d). Nearly identical staining patterns were obtained by staining with anti-BiP antibodies (Fig. 1C, panel h), indicating the ER localization of CaJem1p.

J proteins are characterized by their well-conserved His-Pro-Asp sequence in the J domain, which plays an essential role in the interaction with Hsp70 (Hennessy et al. 2005). We previously showed that the ScJem1p mutant carrying a mutation in this sequence (ScJem1pH566Q) could complement neither the temperature-sensitive growth defect of the jem1{Delta}scj1{Delta} mutant nor the karyogamy defect of the jem1{Delta} mutant (Nishikawa & Endo 1997). In order to analyze the interaction of the J domain of ScJem1p with BiP, we expressed GST-ScJem1p, a fusion protein consisting of the C-terminal 115 amino acid residues of ScJem1p and glutathione S-transferase (GST), in E. coli cells and purified it using an affinity chromatography for the hexahistidine tag, which was introduced at the C-terminus of GST-ScJem1p. Interactions of purified GST-ScJem1p with purified yeast BiP in the presence of ATP was shown by the pull down assay using the glutathione-Sepharose beads (Fig. 1D, lane 2). Purified GST-ScJem1p containing the H566Q mutation of ScJEM1 did not interact with BiP (Fig. 1D, lane 3). Similarly, a fusion protein consisting of GST and the C-terminal 154 amino acid residues of CaJem1p (GST-CaJem1p) interacts with BiP (Fig. 1D, lane 4). Introduction of the same HisÆGln mutation in the conserved His-Pro-Asp sequence into CaJem1p (CaJem1pH517Q) also abrogated the BiP binding activity of GST-CaJem1p (Fig. 1D, lane 5).

Low-level expression of CaJem1p suppresses the temperature-sensitive growth and the ER quality control defect of the jem1{Delta}scj1{Delta} mutant

We previously showed that simultaneous deletion of the ScJEM1 gene and the SCJ1 gene, which encodes another J protein in the ER lumen, causes growth defects at elevated temperature because both proteins function in the same process such as protein folding in the ER lumen (Nishikawa & Endo 1997). We introduced a single-copy plasmid harboring the CaJEM1 gene or the ScJEM1 gene into the double deletion (jem1{Delta}scj1{Delta}) mutant strain, and growth of the transformants at 23 and 37 °C was analyzed. As shown in Fig. 2A, jem1{Delta}scj1{Delta} mutant cells transformed with the CaJEM1 gene grew normally like those transformed with the ScJEM1 gene both at 23 and 37 °C, indicating that the CaJEM1 gene suppressed the temperature-sensitive growth of the jem1{Delta}scj1{Delta} mutant. As a control, cells transformed with the vector alone did not grow at 37 °C. The CaJEM1 gene containing the H517Q mutation failed to suppress the temperature-sensitive growth of the jem1{Delta}scj1{Delta} mutant (data not shown), indicating that the J domain is required for CaJem1p functions.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
Figure 2  Suppression of the temperature-sensitive growth and the ER quality control defect of the jem1{Delta}scj1{Delta} mutant by low-level expression of CaJem1p. (A) SNY1026–7A (jem1{Delta}scj1{Delta}) transformed with a single-copy plasmid harboring ScJEM1, CaJEM1 or the vector alone were grown on SCD (-Ura) plates at 23 °C and 37 °C for 2 days. (B) KYSC4 (prc1–1 jem1{Delta}scj1{Delta}) transformed with a single-copy plasmid harboring ScJEM1 (b), CaJEM1 (c) or the vector alone (a) were grown to the early logarithmic phase at 23 °C and then shifted to 37 °C for 60 min. Cell extracts were prepared and subjected to sucrose density gradient centrifugation as described by Nishikawa et al. (2001). Fractions were collected and proteins were analyzed by immunoblotting using an anti-CPY antiserum. Relative amounts of CPY* were quantified. Numbers indicate fractions (from bottom to top) and P represents the pellet fraction recovered in the bottom of the tube. Vertical arrowheads show the positions of apoferritin (440 kDa), alcohol dehydrogenase (150 kDa), bovine serum albumin (70 kDa) and carbonic anhydrase (30 kDa). (C) KYSC4 (prc1-1 jem1{Delta}scj1{Delta}) transformed with a single-copy plasmid harboring ScJEM1 (closed circles), CaJEM1 (open circles) or the vector alone (closed squares) were pulse labeled with 35S-amino acids and chased for the indicated times at 23 °C. CPY* was recovered from the cell extracts by immunoprecipitation using an anti-CPY antiserum and analyzed by SDS-PAGE. Relative amounts of CPY* were quantified by radio-imaging, and the means of two independent experiments are shown. The amount of CPY* at 0 min chase was set to 100%.

 
The jem1{Delta}scj1{Delta} mutant is defective in protein folding and quality control in the ER. As we reported previously (Nishikawa et al. 2001), a mutant form of vacuolar carboxypeptidase Y, CPY*, which is recognized by the ER quality control system and is removed by the ER associated degradation, forms aggregates when the jem1{Delta}scj1{Delta} mutant is incubated at 37 °C (Fig. 2B, panel a). This CPY* aggregation phenotype was suppressed when CaJem1p as well as ScJem1p was expressed from a single-copy plasmid (Fig. 2B, panels b and c); the amount of CPY* recovered in the soluble fraction (fractions 4–6) increased by expression of ScJem1p or CaJem1p reducing the amount of CPY* recovered in the pellet fraction. The jem1{Delta}scj1{Delta} mutant is also defective in the ERAD of CPY* (Nishikawa et al. 2001), and expression of CaJem1p as well as ScJem1p increased the rate of CPY* degradation at 23 °C, indicating the suppression of the ERAD defect of this mutant (Fig. 2C). Single deletions of the JEM1 or the SCJ1 gene had no effect on the ERAD of CPY*, that is, CPY* was degraded in these single mutants at a rate similar to that for wild-type cells (Nishikawa et al. 2001). These results show that expression of CaJem1p from a single-copy plasmid can suppress the ER quality control defect of the jem1{Delta}scj1{Delta} mutant.

CaJem1p can promote karyogamy of Saccharomyces cerevisiae only at the high-expression level

ScJem1p, but not Scj1p, is involved in karyogamy in S. cerevisiae during mating. We thus asked if expression of CaJem1p could suppress the karyogamy defect of the S. cerevisiae jem1{Delta} mutant. Plasmids containing CaJEM1 or ScJEM1 were introduced into the jem1{Delta} mutant, and the transformants were mated with the jem1{Delta} mutant of the opposite mating type. Mating efficiencies were scored by diploid formation rates, and karyogamy efficiencies were analyzed by staining nuclei in zygotes with DAPI. Expression of ScJem1p from both single-copy and multicopy plasmids restored the mating defect and the karyogamy defect of the jem1{Delta} mutant (Table 1). Expression of CaJem1p from a multicopy plasmid also restored the mating and karyogamy defects of the jem1{Delta} mutant. However, low-level expression of CaJem1p from a single-copy plasmid restored the karyogamy defect only partially and did not restore the mating defect in jem1{Delta} mutant cells (Table 1). These results indicate that CaJem1p requires a high level of its expression to suppress the karyogamy defect of the jem1{Delta} mutant.


View this table:
[in this window]
[in a new window]

 
Table 1  CaJem1p suppresses the karyogamy defect of the jem1{Delta} mutant less efficiently than ScJem1p
 
The N-terminal domains of ScJem1p and CaJem1p are less similar to each other, when compared with their C-terminal J domains. In order to analyze whether the difference in their N-terminal domains resulted in the lower suppression activity of CaJem1p in karyogamy, we constructed plasmids that express two chimeric Jem1 proteins consisting of different combinations of the N-terminal and C-terminal domains of ScJem1p and CaJem1p (Fig. 1A). ScN-CaC consists of the N-terminal domain of ScJem1p and the C-terminal domain of CaJem1p, and CaN-ScC consists of the N-terminal domain of CaJem1p and the C-terminal domain of ScJem1p. Plasmids harboring these chimeric genes were introduced into the jem1{Delta} strain and activities of the chimeric proteins as Jem1p in karyogamy were analyzed by mating assays. When these proteins were expressed from a multicopy plasmid, both the mating and karyogamy defects were fully restored like the case of ScJem1p (Table 1). Expression of ScN-CaC from a single-copy plasmid also restored the defects of the jem1{Delta} mutant both in mating and karyogamy whereas expression of CaN-ScC from a single-copy plasmid did not. These results indicate that the N-terminal domains are responsible for the different abilities of ScJem1p and CaJem1p to promote karyogamy.

The N-terminal domain of ScJem1p is required for its function and interacts with Nep98p/Mps3p

In order to analyze the role of the N-terminal domain of ScJem1p in its functions, we constructed a series of ScJem1p mutants with a 50 amino acid residue deletion in different positions throughout the N-terminal domain (Fig. 3A). Then we tested their abilities to complement the temperature-sensitive growth of the jem1{Delta}scj1{Delta} mutant (reflecting the ER quality control defect) and the mating defect of the jem1{Delta} mutant. These deletion mutants were expressed in yeast cells at a level comparable to that of the full-length ScJem1p (Fig. S1). Although one Jem1p mutant lacking residues 24–73 partially complemented the temperature-sensitive growth phenotype of the jem1{Delta}scj1{Delta} mutant, the other mutants did not complement the growth defect (Fig. 3B). All the deletion mutants did not complement the mating defect of the jem1{Delta} mutant (Fig. 3C). Inactivation of ScJem1p by 50 amino acid residue deletions of any position in the N-terminal domain indicates that the entire N-terminal domain is required for its function and/or its proper folding.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
Figure 3  The N-terminal domain of ScJem1p is essential for its function and interacts with Nep98p. (A) Single-copy plasmids expressing a series of ScJem1p deletion mutants were constructed. The plasmids were introduced into SNA1026-7A (jem1{Delta}scj1{Delta}) and SNY1028 (jem1{Delta}) to analyze functions of the ScJem1p mutants. ts+, ts+/– and ts– indicate complementation, partial complementation and no complementation of the temperature-sensitive growth phenotype of SNY1026-7A by the introduced plasmids, respectively. (B) SNY1026-7A cells containing the genes for the ScJem1p deletion mutants in (A) were grown at 23 °C in SCD (-Ura). One A600 unit of cells were diluted in 10-fold increments, and 4 µL of each dilution (starting without dilution) was spotted onto SCD (-Ura) plates and incubated at indicated temperature for 2 days. (C) SNY1028 cells carrying the plasmids containing the genes for the ScJem1p deletion mutants in (A) were mated with SNY1029 (jem1{Delta}) for 2 days at 23 °C, replica plated onto a SD (-Ura -Ade -Lys) plate and grown at 23 °C for 2 days. Only diploid cells formed by conjugation of SNY1028 containing plasmids and SNY1029 can grow on this plate. (D) PJ69-4A expressing Gal4AD-Nep98p (411–682) and the fusion proteins between Gal4BD and ScJem1p deletion mutants (residues 23–535, 23–364, 23–193, 194–535, and 365–535) were grown on SD (–His) or SD (+His) plates for 4 days at 30 °C.

 
We previously identified Nep98p/Mps3p, a component of the half bridge of the SPB, as an ScJem1p-interacting protein by two-hybrid screening (Nishikawa et al. 2003). Nep98p is a type II integral membrane protein with its C-terminal region facing the ER lumen and is essential for yeast cell growth. Nep98p interacts with ScJem1p with its C-terminal region (residues 430–650 of Nep98p), and a temperature-sensitive nep98 mutant is defective in karyogamy, indicating its role in promoting karyogamy (Nishikawa et al. 2003). Since the two-hybrid tester strain expressing the fusion protein between Gal4AD (the activation domain of Gal4 protein) and residues 411–682 of Nep98p (Nep98p(411–682)) and the one between Gal4BD (the DNA binding domain of Gal4 protein) and residues 23–535 of ScJem1p (ScJem1p(23–535)) grew on a SD(-His) plate, the N-terminal domain of ScJem1p has an ability to interact directly with Nep98p (Fig. 3D). We constructed a series of deletion mutants of the N-terminal domain of ScJem1p fused to Gal4BD. All the deletion constructs were expressed as efficiently as Gal4BD-ScJem1p(23–535) (Fig. S2A). However, deletion of any one-third of the N-terminal domain of ScJem1p impaired interactions with Nep98p (Fig. 3D), so that the entire N-terminal domain of ScJem1p appears to be required for proper interactions with Nep98p.

ScJem1p but not CaJem1p interacts with Nep98p with high affinity in Saccharomyces cerevisiae cells to promote karyogamy

We found that high-level expression of ScJem1pH566Q in wild-type cells exhibited a dominant-negative effect on karyogamy. When wild-type cells of the opposite mating types that express ScJem1pH566Q from a multicopy plasmid were mated with each other, 56% of the zygotes showed karyogamy defects (Table 2). On the other hand, more than 97% of the zygotes over-expressing CaJem1pH517Q in wild-type S. cerevisiae cells are proficient in karyogamy, indicating that CaJem1pH517Q does not exhibit a dominant negative effect on the ScJem1p-mediated karyogamy. ScJem1p likely promotes karyogamy through interactions with its karyogamy-specific partner protein, and overproduction of ScJem1pH566Q inhibited karyogamy probably by titrating out such a partner protein. The difference in the dominant negative effect between ScJem1pH566Q and CaJem1pH517Q is most likely due to the difference in their abilities to interact with putative karyogamy-specific partner(s) in S. cerevisiae cells.


View this table:
[in this window]
[in a new window]

 
Table 2  A ScJem1p mutant with the H566Q mutation in the J domain causes a dominant negative effect on karyogamy
 
One candidate for such a partner is Nep98p, and we thus asked by a two-hybrid assay if CaJem1p can interact with Nep98p. While the two-hybrid tester strain expressing the fusion protein between Gal4AD-Nep98p(411–682) and the one between Gal4BD-ScJem1p(23–645) could grow on a SD(-His) plate, the tester strain expressing Gal4AD-Nep98p(411–682) and Gal4BD-CaJem1p(25–636) did not (Fig. 4A). Gal4BD-CaJem1p(25–636) was expressed in the tester strain at a level similar to that of Gal4BD-ScJem1p(23–645) (Fig. S2B). These results indicate that CaJem1p does not interact with Nep98p with a sufficiently high affinity in S. cerevisiae cells to be detected by the yeast two-hybrid assay.


Figure 4
View larger version (50K):
[in this window]
[in a new window]

 
Figure 4  ScJem1p interacts with Nep98p through its N-terminal domain. (A) PJ69-4A expressing Gal4AD fusions (Gal4AD or Gal4AD-Nep98p (411–682)) and Gal4BD fusions (Gal4BD, Gal4BD-ScJem1p, or Gal4BD-CaJem1p) were grown on SD (–His, + 2 mM 3-amino triazole) or SD (+His) plates for 4 days at 30 °C. (B) Spheroplasts prepared from over-expressing Nep98p (vector), Nep98p and 3xHA-tagged ScJem1p (ScJEM1-HA), or Nep98p and 3xHA-tagged CaJem1p (CaJEM1-HA) were labeled with 35S-amino acids. The spheroplasts were disrupted with 0.1% Triton X-100 and incubated with (+) or without (–) 0.5 mg/mL DSP for 20 min on ice. Proteins were extracted and subjected to immunoprecipitation with anti-Nep98p antibodies. Immunoprecipitates were incubated with 10 mM dithiothreitol and subjected to the second round of immunoprecipitation with anti-Nep98p antibodies (98) or the anti-HA monoclonal antibody (HA). Jem1p-3HA was detected as two bands due to heterogeneity in its N-glycosylation (Nishikawa & Endo, 1997).

 
We next tested whether overproduction of Nep98p would suppress the inhibitory effect of overproduction of ScJem1pH566Q on karyogamy. As shown in Table 3, 11% of the zygotes overproducing Nep98p showed karyogamy defects, indicating that overproduction of Nep98p itself slightly inhibited karyogamy. However, since Nep98p overproduction significantly decreased the percentage of karyogamy-defective zygotes reduced to 35%, the elevated level of Nep98p suppressed the karyogamy defect caused by overproduction of ScJem1pH566Q. These results support functional interactions between ScJem1p and Nep98p in karyogamy.


View this table:
[in this window]
[in a new window]

 
Table 3  Over-expression of Nep98p partially suppresses the dominant negative karyogamy defect caused by over-expression of ScJem1pH566Q
 
As shown above, high-level expression of CaJem1p suppressed the karyogamy defect of the jem1{Delta} mutant (Table 1), suggesting that CaJem1p can interact with Nep98p under this condition. We previously showed physical interactions between ScJem1p and Nep98p by cross-linking with a homobifunctional chemical cross-linker, dithiobis(succiminidyl propionate) (DSP) (Nishikawa et al. 2003). We used this method to analyze interactions between CaJem1p and Nep98p at the high CaJem1p expression level. Cells expressing Nep98p and ScJem1p-3 x HA or CaJem1p-3 x HA from multicopy plasmids were converted to spheroplasts, labeled with 35S-amino acids, lysed with 0.1% Triton X-100, and treated with DSP. The proteins were subsequently extracted and subjected to the first round of immunoprecipitation with the anti-Nep98p antibodies. The immunoprecipitates were treated with dithiothreitol to cleave a disulfide bond of the cross-linker and were subjected to the second round of immunoprecipitation with the anti-Nep98p antibodies or the anti-HA monoclonal antibody. Both ScJem1p-3 x HA and CaJem1p-3 x HA were precipitated with the anti-HA antibody only when cells were treated with DSP (Fig. 4B). These results indicate that CaJem1p as well as ScJem1p interacts with Nep98p under the highly expressed condition.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Jem1p of S. cerevisiae (ScJem1p) is a J protein in the ER lumen, which functions in two different processes, ER quality control and karyogamy, as a partner for BiP (Nishikawa & Endo 1997; Brizzio et al. 1999; Nishikawa et al. 2001). Here we report that C. albicans has an ortholog (CaJem1p) of ScJem1p. CaJem1p is, when expressed from its own promoter in S. cerevisiae cells, correctly localized in the ER like ScJem1p (Fig. 1C). Expression of CaJem1p from a single-copy plasmid complemented the growth defect of the jem1{Delta}scj1{Delta} mutant and also its ER quality control defect (Fig. 2). Since the C. albicans genome contains genes that encode orthologs of BiP and Scj1p (ORF19.2013 and ORF19.9564 for BiP; ORF19.3438 and ORF19.10942 for Scj1p), CaJem1p likely functions with the C. albicans orthologs of Scj1p and BiP in protein folding in the ER of C. albicans.

In contrast, high-level expression of CaJem1p is required to complement the karyogamy defect of the jem1{Delta} strain (Table 1). We used such differential activities of CaJem1p to suppress the karyogamy and the ER quality-control defects observed in the yeast mutants lacking ScJem1p to dissect the ScJem1p function in these processes. Analyses of chimeric proteins with different combinations of the N-terminal and C-terminal domains of ScJem1p and CaJem1p suggest that the N-terminal domain is responsible for the difference in the efficiency of ScJem1p and CaJem1p to promote karyogamy (Table 1). High-level expression of nonfunctional ScJem1pH566Q but not of CaJem1pH517Q in wild-type S. cerevisiae cells caused dominant negative effects on karyogamy, suggesting that ScJem1p, but not CaJem1p, interacts with possible partner protein(s) for promoting karyogamy with high affinity (Table 2).

One of the possible candidates for such partner proteins for ScJem1p is Nep98p/Mps3p. Nep98p resides in the half-bridge structure of the SPB (Jaspersen et al. 2002), from which nuclear membrane fusion could start during karyogamy (Byers & Goetsch 1975), and a temperature-sensitive nep98 mutant is defective in karyogamy (Nishikawa et al. 2003). Over-expression of Nep98p partially suppressed the dominant negative effect of ScJem1pH566Q on karyogamy (Table 3). Using the yeast two-hybrid assay, we showed that ScJem1p interacts with Nep98p through its N-terminal domain (Fig. 3D). Although the interaction between CaJem1p and Nep98p was not observed by this assay, these two proteins were chemically cross-linked when they were over-expressed (Fig. 4B). Probably, the interaction between CaJem1p and Nep98p is weaker than that of ScJem1p and Nep98p, rendering it difficult to be detected by the yeast two-hybrid assay. It is most likely that the efficient interaction of the N-terminal domain of ScJem1p with Nep98p is important for promoting nuclear fusion during mating of S. cerevisiae cells. Due to low similarity between the N-terminal domains of ScJem1p and CaJem1p (Fig. S3), it is difficult to identify the residues involved in ScJem1p-Nep98p interaction at the moment.

Candida albicans is a diploid organism and was known as an ‘asexual’ yeast. However, a mating-type-like (MTL) locus in C. albicans that resembles the mating-type (MAT) locus of S. cerevisiae has been identified (Hull & Johnson 1999). Manipulation of the MTL locus allows one to make the cell function as a or {alpha} strains, and to mate diploid a and {alpha} cells of C. albicans (Hull et al. 2000; Magee & Magee 2000). As observed for S. cerevisiae, the mating process of C. albicans can be dissected into cell fusion and nuclear fusion steps, and the nuclear fusion requires the function of an ortholog of S. cerevisiae KAR3 gene, which is required for the same step in the mating of S. cerevisiae (Meluh & Rose 1990; Bennett et al. 2005). These observations suggest the conservation of the mating system between S. cerevisiae and C. albicans. Nevertheless, it is not clear at the moment whether CaJem1p functions in karyogamy during mating of C. albicans cells. Since C. albicans does not have an obvious homolog of Nep98p (Jaspersen et al. 2006), it is unlikely that CaJem1p promotes nuclear fusion in the same way as ScJem1p does in S. cerevisiae. Besides, C. albicans does not have an obvious homolog of Kar1p, another component of the half bridge (Spang et al. 1995) in S. cerevisiae, either. Therefore, organization of the half-bridge structure of C. albicans SPB may be rather different from that of S. cerevisiae. Further analyses using the C. albicans mating assay will reveal roles of CaJem1p in karyogamy in C. albicans.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Yeast strains and culture conditions

Yeast strains used in this study are SEY6210 (MAT{alpha} ura3 leu2 trp1 his3 lys2 suc2) (Robinson et al. 1988), SNY1026–7A (MAT{alpha} jem1{Delta}::LEU2 scj1{Delta}::TRP1 ura3 leu2 trp1 his3 lys2 suc2), SNY1028 (MAT{alpha} jem1{Delta}::LEU2 ura3 leu2 trp1 his3 lys2 suc2), SNY1029 (MATa jem1{Delta}::LEU2 ura3 leu2 trp1 his3 lys2 suc2) (Nishikawa & Endo 1997), KYSC4 (MAT{alpha} prc1–1 jem1{Delta}::LEU2 scj1{Delta}::TRP1 ura3 leu2 trp1 his3 lys2 suc2) (Nishikawa et al. 2001) and PJ69-4A (MATa ura3 leu2 trp1 his3 gal4 gal80 GAL2-ADE2 LYS2::GAL1-HIS3 met2::GAL7-lacZ) (James et al. 1996). Yeast cells were grown in YPD (1% yeast extract, 2% polypeptone, and 2% glucose) or in SD (0.67% yeast nitrogen base without amino acids and 2% glucose) supplemented appropriately (Rose et al. 1990). SCD medium is SD containing 0.5% casamino acids.

Plasmid constructions

For cloning of the CaJEM1 gene, a DNA segment containing the CaJEM1 ORF with 500 bp upstream and downstream regions was amplified by PCR using CGCGAGCTCAATTGCTGA GAAAATGAA and CGCCTCGAGGTATTCCAGGTGGT GGTA as primers and the genomic DNA of C. albicans strain SC5314 as a template. The amplified 2.9-kbp fragment was digested with XhoI and SacI and inserted into the XhoI and SacI sites of pRS316 to generate pRS316-CaJEM1. Since the CTG codon is translated as Ser in C. albicans instead of Leu in the other species (Santos et al. 1993), the single CTG codon of CaJEM1 at position 1231 from the initial ATG codon was replaced to TCG for Ser using the QuikChange kit (Stratagene) with GACAAG TATTTATCGAAAAAGAAGTAT and ATACTTCTTTTTC GATAAATACTTGTC as primers. The resultant plasmid was named pRS316-CaJEM1LS. To introduce the DNA for the 3 x HA-tag into the CaJEM1 gene, a BglII site was introduced into pRS316-CaJEM1LS using the QuikChange kit with GAAT AGGAGCAGATCTCAGTAGGAAATAAT and ATTATTTC CTACTGAGATCTGCTCCTATTC as primers to give pRS316-CaJEM1LSB. A DNA fragment for the 3 x HA-tag was amplified by PCR using GCGAGATCTTACCCATATGACGTTCCA and GCGAGATCTAGCGTAGTCAGGTACGTCGTAA as primers and pSK-3 x HA (Sato & Wada 1997) as a template, digested with BglII, and introduced into the BglII site of pRS316-CaJEM1LSB to give pRS316-CaJEM1LSHA. To swap the C-terminal domains between ScJem1p and CaJem1p, we first introduced a BglII site into the ScJEM1 and the CaJEM1 genes upstream of the C-terminal domain using QuikChange; for ScJEM1, CAACAACACCAAAGATCTCAAGCACCCCCA and TGG GGGTGCTTGAGATCTTTGGTGTTGTTG were used as primers and pSNJ8 (Nishikawa & Endo 1997) as a template; for CaJEM1, CAACAACAATATAGATCTGCTCCACCACAT and ATGTGGTGGAGCAGATCTATATTGTTGTTG were used as primers and pRS316-CaJEM1LS as a template. The DNA fragments corresponding to the C-terminal domain and 3'-region of both genes were excised out by digestion with BglII and XhoI, and were used to construct chimeric genes. Multicopy plasmids expressing CaJem1p and chimeric proteins between CaJem1p and ScJem1p were constructed by inserting XhoI/SacI fragments of the corresponding single-copy plasmids containing the JEM1 genes into the XhoI and the SacI sites of pYO326 (Qadota et al. 1992). A series of deletion mutants of ScJEM1 were constructed by PCR mutagenesis using pSNJ3 (Nishikawa & Endo 1997) as a template. The mutant gene for ScJEM1H566Q was constructed as described previously (Nishikawa & Endo 1997). The mutant gene for CaJEM1H517Q was constructed by PCR using CAACCAGATAAATATAAAGGTGAT and ATACTTTAATGTTTGTGTTCTATA as primers and pRS316-CaJEM1LS as a template. Both mutant genes were cloned into the XhoI and the SacI sites of pYO326.

For two-hybrid analyses, pNY6 (Nishikawa et al. 2003) was used for expression of Gal4BD-Jem1p(23–645). To construct a plasmid, pNTY3(411–682), which expresses Gal4AD-Nep98p(411–682), a DNA fragment was amplified by PCR using GCGGAAT TCTCGAGCATATTAATGAAAAG and GCGAGATCTTATTG ATCTAGCTCATCTTG as primers and pSNY5 (Nishikawa et al. 2003) as a template, digested with EcoRI and BglII, and inserted into the EcoRI and BglII sites of pGAD-c1 (James et al. 1996). A plasmid expressing Gal4BD-CaJem1p was constructed by inserting a 1.9 kbp BclI/XhoI fragment of the pRS316-CaJEM1LSHA into the BamHI and the XhoI sites of pGBD-c3 (James et al. 1996) to generate pGBD-CaJEM1LSHA. To construct a series of plasmids expressing fusion proteins between Gal4BD and the ScJem1p deletion mutants, DNA fragments containing the corresponding regions of ScJEM1 were amplified by PCR and inserted into the SmaI/BglII sites of pGBD-c1 (James et al. 1996).

The DNA fragment corresponding to the J domain of ScJem1p was amplified by PCR using primers ATGCGGCCGCTCA GTGGTGGTGGTGGTGGTGAAGCCCAAAATTCATTTTA AAGCC and GCGGTCGACAGCGCCTAACTACGACC and pSNJ8 as a template. The DNA fragment corresponding to the J domain of CaJem1p was amplified by PCR using primers CGCGTCGACGCGAAAGAAACCAGCTAATGA and ATGCGGCCGCTCAGTGGTGGTGGTGGTGGTGCTGCT TTCTGCTCCTATTCTTTTT pRS316-CaJEM1LS as a template. The amplified DNA fragment was digested with SalI and NotI and introduced into the SalI and NotI sites of pGEX4T-2 (GE Healthcare) to give pSNJ20 and pGST-CaJ for GST-ScJem1p and GST-CaJem1p expressions, respectively. pSNJ20(HQ) and pGST-CaJ(HQ) were constructed as above except that templates contained ScJEM1H566Q and CaJEM1H517Q mutations, respectively.

Mating assay

A quantitative mating assay was performed essentially as described (Brizzio et al. 1999). About 8 x 106 cells in the log phase from each parental strain were mixed and filtered through a 0.22-µm nitrocellulose filter (Advantec). The filter was placed on an YPD plate buffered at pH 4.5 for 4 h at 23 °C, and then cells were suspended in sterile water and streaked onto SD (-Ade -Lys) and YPD plates. Efficiencies of diploid formation were calculated as ratios between the numbers of colonies appeared on SD (-Ade -Lys) and YPD plates. To analyze the nuclear fusion during mating, cells were fixed in 5 % formaldehyde and 0.1 M potassium phosphate, pH 6.5 at room temperature for 1 h, washed with phosphate-buffered saline and re-suspended in 1 µg/mL 4', 6-diamidino-2-phenylindole (DAPI).

Immunofluorescence microscopy

Immunofluorescence microscopy was performed as described previously (Nishikawa et al. 2003) with the anti-HA monoclonal antibody (Covance) and anti-BiP antibodies (Nakatsukasa et al. 2004). Cells were viewed on an Olympus IX-70 inverted microscope with suitable filter sets. Images were captured by a MicroMax cooled CCD camera (Princeton Research Instruments) and analyzed by IPLab software (Scanalystics).

Purification of GST-Jem1p-His

Bacterial strain TG1 harboring pSNJ20, pSNJ20(HQ), pGST-CaJem or pGST-CaJem(HQ) was grown in 1 L LB medium containing 50 µg/mL ampicillin at 26 °C. Expression of GST-Jem1p-His was induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside. Cells were harvested, washed once with ice-cold 50 mM Hepes-KOH pH7.4, 5 mM β-mercaptoethanol, 200 mM NaCl and 10 mM imidazole (buffer A) and resusupend in 16 mL of buffer A containing 0.1 mg/mL lysozyme. After incubation for 30 min on ice, phenylmethylsulfonyl fluoride was added to the suspension to 1 mM, and cells were disrupted by sonication for 1 min (2 s on, 1 s off pulsed periods, 40% duty cycle, Astorason XL2020 sonicator with a micro tip). Triton X-100 was added to the cell lysate to a final concentration of 0.1%, and the lysate was centrifuged at 12 000 g for 10 min at 4 °C. The supernatant was further centrifuged at 200 000 g for 30 min at 4 °C, and the cleared supernatant was filtrated through a 0.45 µm membrane filter. The filtrate was applied onto a 1 mL of Ni-NTA column (Qiagen) that had been equilibrated with buffer A. The column was washed successively with 6 mL of buffer A, 6 mL of buffer A containing 1% Triton X-100 and 5% glycerol, 6 mL of buffer A containing 1 M NaCl and 5% glycerol, 6 mL of buffer A containing 5 mM MgCl2, 5 mM ATP and 300 mM NaCl, 6 mL of buffer A containing 0.5 M Tris–HCl, pH 7.4 and 300 mM NaCl, 6 mL of buffer A containing 300 mM NaCl, 5% glycerol and 25 mM imidazole, and 6 mL of buffer A containing 300 mM NaCl, 5% glycerol and 50 mM imidazole. Proteins were eluted successively with 6 mL of buffer A containing 300 mM NaCl, 5% glycerol and 100 mM imidazole and 6 mL of buffer A containing 300 mM NaCl, 5% glycerol and 250 mM imidazole. The fractions containing GST-Jem1p-His were desalted with a NAP-10 column (GE Healthcare), which had been equilibrated with 20 mM Hepes-KOH, pH 7.4, 50 mM KCl, 5% glycerol.

Purification of hexahistidine-tagged BiP and the BiP-binding assay

Hexahistidine-tagged BiP was purified essentially as described by McClellan et al. (1998), except that a Mono Q column (1 mL bed volume, GE Healthcare) was used instead of a Q-Sepharose column, and the eluted fractions were desalted with a Sephadex G-25 column (1.5 x 26 cm, Amersham-Pharmacia Biotech) that had been equilibrated with 20 mM Hepes-KOH, pH 7.4, 50 mM KCl, 0.3 mM dithiothreitol and 5% glycerol.

For the BiP binding assay, glutathione-Sepharose 4B beads (GE Healthcare) were equilibrated with binding buffer (20 mM Hepes-KOH, pH 7.4, 100 mM KCl, 5 mM MgCl2, 0.1% Triton X-100, 2% glycerol and 1 mM dithiothreitol). 6.25 x 10–12 moles of GST-Jem1p-His was added to 20 µL of 50% suspension of glutathione-Sepharose beads, the volume was increased to 50 µL, and the tubes were incubated at 4 °C for 30 min. Beads were collected by centrifugation and washed with 500 µL of binding buffer containing 1 mM ATP. Purified BiP (2.5 x 10–11 moles) that had been incubated with 1 mM ATP was added to the beads and the volume was increased to 50 µL with binding buffer containing 1 mM ATP. The reaction mixtures were incubated at 4 °C for 60 min. Beads were collected by centrifugation and washed four times with 500 µL of binding buffer containing 1 mM ATP. Proteins retained on the beads were analyzed by SDS-PAGE and visualized by staining with Sypro Orange (Invitrogen) and a Storm 860 image analyzer (Molecular Dynamics).

Miscellaneous

The procedures were described previously for preparation of yeast total cell extracts (Yaffe & Schatz 1984), sucrose density gradient centrifugation analysis (Nishikawa et al. 2001) and metabolic labeling of yeast cells, cross-linking, and immunoprecipitation (Nishikawa et al. 2003).


    Acknowledgements
 
The authors thank Dr T. Akashi for providing Candida albicans strain SC5314 and for discussion and C. Ohshima for technical assistance. T. Makio was a Research Fellow of the Japan Society for the Promotion of Science. This study was supported in part by grants-in-aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan and grants from the Japan Science and Technology Corporation (to TE) and the Naito foundation (to SN).


    Footnotes
 
Communicated by: Yoshinori Ohsumi

{dagger}Present address: Department of Cell Biology, University of Alberta, Edmonton, Alberta T6G2H7, Canada. Back

* Correspondence: shuh{at}biochem.chem.nagoya-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bennett, R.J., Miller, M.G., Chua, P.R., Maxon, M.E. & Johnson, A.D. (2005) Nuclear fusion occurs during mating in Candida albicans and is dependent on the KAR3 gene. Mol. Microbiol. 55, 1046–1059.[CrossRef][Medline]

Brizzio, V., Khalfan, W., Huddler, D., Beh, C.T., Andersen, S.S., Latterich, M. & Rose, M.D. (1999) Genetic interactions between KAR7/SEC71, KAR8/JEM1, KAR5, and KAR2 during nuclear fusion in Saccharomyces cerevisiae. Mol. Biol. Cell 10, 609–626.[Abstract/Free Full Text]

Byers, B. & Goetsch, L. (1975) Behavior of spindles and spindle plaques in the cell cycle and conjugation of Saccharomyces cerevisiae. J. Bacteriol. 124, 511–523.[Abstract/Free Full Text]

Hennessy, F., Nicoll, W.S., Zimmermann, R., Cheetham, M.E. & Blatch, G.L. (2005) Not all J domains are created equal: Implications for the specificity of Hsp40–Hsp70 interactions. Protein Sci. 14, 1697–1709.[CrossRef][Medline]

Hull, C.M. & Johnson, A.D. (1999) Identification of a mating type-like locus in the asexual pathogenic yeast Candida albicans. Science 285, 1271–1275.[Abstract/Free Full Text]

Hull, C.M., Raisner, R.M. & Johnson, A.D. (2000) Evidence for mating of the "asexual" yeast Candida albicans in a mammalian host. Science 289, 307–310.[Abstract/Free Full Text]

James, P., Halladay, J. & Craig, E.A. (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425–1436.[Abstract]

Jaspersen, S.L., Giddings, T.H., Jr. & Winey, M. (2002) Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J. Cell Biol. 159, 945–956.[Abstract/Free Full Text]

Jaspersen, S.L., Martin, A.E., Glazko, G., Giddings, T.H., Jr., Morgan, G., Mushegian, A. & Winey, M. (2006) The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to connect the spindle pole body with the nuclear envelope. J. Cell Biol. 174, 665–675.[Abstract/Free Full Text]

Kurihara, L.J., Beh, C.T., Latterich, M., Schekman, R. & Rose, M.D. (1994) Nuclear congression and membrane fusion: Two distinct events in the yeast karyogamy pathway. J. Cell Biol. 126, 911–923.[Abstract/Free Full Text]

Magee, B.B. & Magee, P.T. (2000) Induction of mating in Candida albicans by construction of MTLa and MTL{alpha} strains. Science 289, 310–313.[Abstract/Free Full Text]

McClellan, A.J., Endres, J.B., Vogel, J.P., Palazzi, D., Rose, M.D. & Brodsky, J.L. (1998) Specific molecular chaperone interactions and an ATP-dependent conformational change are required during posttranslational protein translocation into the yeast ER. Mol. Biol. Cell 9, 3533–3545.[Abstract/Free Full Text]

Meluh, P.B., & Rose, M.D. (1990) KAR3, a kinesin-related gene required for yeast nuclear fusion. Cell 60: 1029–1041.[CrossRef][Medline]

Nakatsukasa, K., Okada, S., Umebayashi, K., Fukuda, R., Nishikawa, S. & Endo, T. (2004) Roles of O-mannosylation of aberrant proteins in reduction of the load for endoplasmic reticulum chaperones in yeast. J. Biol. Chem. 279, 49762–49772.[Abstract/Free Full Text]

Ng, D.T. & Walter, P. (1996) ER membrane protein complex required for nuclear fusion. J. Cell Biol. 132, 499–509.[Abstract/Free Full Text]

Nishikawa, S. & Endo, T. (1997) The yeast JEM1p is a DnaJ-like protein of the endoplasmic reticulum membrane required for nuclear fusion. J. Biol. Chem. 272, 12889–12892.[Abstract/Free Full Text]

Nishikawa, S. & Endo, T. (1998) Reinvestigation of the functions of the hydrophobic segment of Jem1p, a yeast endoplasmic reticulum membrane protein mediating nuclear fusion. Biochem. Biophys. Res. Commun. 244, 785–789.[CrossRef][Medline]

Nishikawa, S., Fewell, S.W., Kato, Y., Brodsky, J.L. & Endo, T. (2001) Molecular chaperones in the yeast endoplasmic reticulum maintain the solubility of proteins for retrotranslocation and degradation. J. Cell Biol. 153, 1061–1069.[Abstract/Free Full Text]

Nishikawa, S., Terazawa, Y., Nakayama, T., Hirata, A., Makio, T. & Endo, T. (2003) Nep98p is a component of the yeast spindle pole body and essential for nuclear division and fusion. J. Biol. Chem. 278, 9938–9943.[Abstract/Free Full Text]

Qadota, H., Ishii, I., Fujiyama, A., Ohya, Y. & Anraku, Y. (1992) RHO gene products, putative small GTP-binding proteins, are important for activation of the CAL1/CDC43 gene product, a protein geranylgeranyltransferase in Saccharomyces cerevisiae. Yeast 8, 735–741.[CrossRef][Medline]

Robinson, J.S., Klionsky, D.J., Banta, L.M. & Emr, S.D. (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol. Cell. Biol. 8, 4936–4948.[Abstract/Free Full Text]

Rose, M.D. (1996) Nuclear fusion in the yeast Saccharomyces cerevisiae. Annu. Rev. Cell Dev. Biol. 12, 663–695.[CrossRef][Medline]

Rose, M.D., Winston, F.D. & Hieter, P. (1990) Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Santos, M.A., Keith, G. & Tuite, M.F. (1993) Non-standard translational events in Candida albicans mediated by an unusual seryl-tRNA with a 5'-CAG-3' (leucine) anticodon. EMBO J. 12, 607–616.[Medline]

Sato, M.H. & Wada, Y. (1997) Universal template plasmid for introduction of the triple-HA epitope sequence into cloned genes. Biotechniques 23, 254–256.[Medline]

Silberstein, S., Schlenstedt, G., Silver, P.A. & Gilmore, R. (1998) A role for the DnaJ homologue Scj1p in protein folding in the yeast endoplasmic reticulum. J. Cell Biol. 143, 921–933.[Abstract/Free Full Text]

Spang, A., Courtney, I., Grein, K., Matzner, M. & Schiebel, E. (1995) The Cdc31p-binding protein Kar1p is a component of the half bridge of the yeast spindle pole body. J. Cell Biol. 128, 863–77.[Abstract/Free Full Text]

Walsh, P., Bursac, D., Law, Y.C., Cyr, D. & Lithgow, T. (2004) The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep. 5, 567–571.[CrossRef][Medline]

Yaffe, M.P. & Schatz, G. (1984) Two nuclear mutations that block mitochondrial protein import in yeast. Proc. Natl. Acad. Sci. USA 81, 4819–4823.[Abstract/Free Full Text]

Received: 16 September 2006
Accepted: 7 July 2008





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makio, T.
Right arrow Articles by Endo, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Makio, T.
Right arrow Articles by Endo, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS