GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2008) 13, 1087-1097. doi:10.1111/j.1365-2443.2008.01230.x
© 2008 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takaku, H.
Right arrow Articles by Nashimoto, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Takaku, H.
Right arrow Articles by Nashimoto, M.

Escherichia coli tRNase Z can shut down growth probably by removing amino acids from aminoacyl-tRNAs

Hiroaki Takaku and Masayuki Nashimoto*

Department of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Niigata 956-8603, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
In most organisms, tRNase Z is considered to be essential for 3' processing of tRNA molecules. The Escherichia coli tRNase Z gene, however, appears to be dispensable under normal growth conditions, and its existence remained an enigma. Here we intensively examined various (pre-)tRNAs for good substrates of E. coli tRNase Z in vitro, and found that the enzyme can remove the 3' terminal CCA residues from mature tRNAs regardless of their nucleotide modifications. Furthermore, we discovered that E. coli tRNase Z, when sufficiently expressed in the cell, can shut down growth probably by removing amino acids from aminoacyl-tRNAs. We confirmed in vitro that E. coli tRNase Z exceptionally possesses the activity that cleaves off the 3' terminal residues charging an amino acid from an aminoacyl-tRNA molecule. The current data suggest that tRNase Z might help modulate a cell growth rate by repressing translation under some stressful conditions.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The 3' terminal CCA sequence of tRNA is essential for the protein synthesis on ribosome (Green & Noller 1997). As almost all eukaryotic tRNA genes do not encode the 74CCA76 sequence, this sequence needs to be added by tRNA nucleotidyltransferase onto the discriminator nucleotide, which is believed to be exposed through removing a 3' trailer of pre-tRNA by tRNase Z (Deutscher 1990; Nashimoto 1997; Takaku et al. 2003; Vogel et al. 2005; Zareen et al. 2005). However, percentages of the CCA-coding tRNA genes in bacteria and archaea vary with species from 0% to 100%, and the mechanism to remove 3' trailers and to generate the CCA termini appears to change accordingly (Minagawa et al. 2004). In Bacillus subtilis, where approximately 73% of the total tRNA genes encode the 74CCA76 sequence, the mature 3' ends of CCA-less pre-tRNAs are generated through 3' trailer removal by tRNase Z and subsequent CCA addition by tRNA nucleotidyltransferase, and those of CCA-containing pre-tRNAs are created through the action of the 3' to 5' exoribonuclease RNase PH (Pellegrini et al. 2003; Wen et al. 2005). With respect to Thermotoga maritima, all pre-tRNAs contain 74CCA76 with only one exception, and the mature CCA 3' termini would be generated by tRNase Z in vivo because T. maritima tRNase Z exceptionally cleaves pre-tRNAs containing the 74CCA76 sequence precisely after the A76 residue in vitro (Minagawa et al. 2004).

The CCA sequences of all Escherichia coli tRNAs are also encoded in its genome but, in contrast to T. maritima, the five exoribonucleases RNase II, polynucleotide phosphorylase, RNase PH, RNase D and RNase T in addition to tRNase Z (or RNase BN) are involved in the removal of 3' trailers to generate the CCA termini (Li & Deutscher 1996). The tRNase Z gene, however, appears to be dispensable under normal growth conditions (Schilling et al. 2004). Although E. coli tRNase Z, which cleaves pre-tRNAs after the discriminator (Minagawa et al. 2004), is essential for 3' maturation of T4 bacteriophage pre-tRNAs that lack the CCA sequence (Seidman et al. 1975; Asha et al. 1983), the idea that tRNase Z is preserved during evolution to prepare for T4 bacteriophage infection would not be easy to accept, and the existence of the tRNase Z gene in the E. coli genome remained an enigma.

tRNase Zs can be categorized into two groups: a short form (tRNase ZS) that consists of 300–400 amino acids and a long form (tRNase ZL) that contains 800–900 amino acids (Takaku et al. 2004). Bacterial and archaeal genomes contain a tRNase ZS gene only, whereas eukaryotic genomes encode either only tRNase ZL or both forms. The C-terminal half region of tRNase ZL has high similarity to the whole region of tRNase ZS, and these regions contain a well-conserved histidine motif, which is essential for the tRNase Z activity (Minagawa et al. 2004, 2006a; Zareen et al. 2005, 2006; Karkashon et al. 2007). The N-terminal half region of tRNase ZL, which is important for the versatility in substrate recognition that is characteristic of tRNase ZL, is dispensable for the activity (Takaku et al. 2003, 2004). Recently, we have shown in vitro that tRNase Z can recognize and cleave even unstructured RNA (Shibata et al. 2006), which implies that this enzyme might work for processing and/or degradation of RNAs other than pre-tRNAs, especially in E. coli cells (Perwez & Kushner 2006).

There exists a significant difference in pre-tRNA preference among prokaryotic tRNase Zs (Minagawa et al. 2006b). For example, T. maritima pre-tRNAArg(74CCA76) is a substrate for Pyrobaculum aerophilum tRNase Z, but E. coli pre-tRNAPhe(74CCA76), P. aerophilum pre-tRNAPhe(74CCA76) and pre-tRNAMet(74CCA76) are not; human pre-tRNAArg(74GUG76) is a substrate for E. coli tRNase Z, but T. maritima pre-tRNAArg(74GUG76) and pre-tRNAArg(74CCA76) are not. This is another enigma, because pre-tRNAs should form the common L-shaped structure and tRNase Zs should form the common structure based on the {alpha}β/β{alpha}-fold (de la Sierra-Gallay et al. 2005; Ishii et al. 2005, 2007; Kostelecky et al. 2006).

We suggest that, by solving this enigma regarding the E. coli enzyme, we could elucidate a role of E. coli tRNase Z and thus solve the first enigma. In this paper, we intensively examined E. coli pre-tRNAs for good substrates of E. coli tRNase Z, and found out that the E. coli enzyme can remove the 3' terminal CCA residues from mature tRNAs. Furthermore, we discovered that E. coli tRNase Z, when expressed in the cell, shuts down growth probably by removing amino acids from aminoacyl-tRNAs, and basically solved the first enigma.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The 3' terminal CCA residues can be removed by Escherichia coli tRNase Z

To investigate which pre-tRNAs from the E. coli genome can be substrates for E. coli tRNase Z, we first tested various E. coli pre-tRNAsPhe and pre-tRNAsArg for in vitro cleavage by the histidine-tagged E. coli tRNase Z (Fig. 1A). The pre-tRNAsPhe (F-L7T13, F-L7T10, F-L7T6 and F-L7T3) containing a 7-nt leader and a 3–13-nt trailer (defined as a 3' sequence after the discriminator nucleotide) and the pre-tRNAsArg (R-L7T14, R-L7T6 and R-L7T3) containing a 7-nt leader and a 3–14-nt trailer were synthesized in vitro with T7 RNA polymerase. Cleavages of F-L7T13 and F-L7T10 were not detected whereas F-L7T6 was cleaved primarily after the discriminator A73 and C77, and F-L7T3 was cleaved primarily after the discriminator (Fig. 1B). R-L7T6 and R-L7T3 were also cleaved primarily after the discriminator G73 and C74, but R-L7T14 was hardly cleaved. Overall, the cleavage was more efficient as the trailer length was shorter.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

 
Figure 1  The 3' terminal CCA residues can be removed by E. coli tRNase Z. (A) Secondary structures of E. coli pre-tRNAPhe and pre-tRNAArg. (B)–(D) In vitro 3' processing assays for pre-tRNAs containing a 5' leader and a 74CCA76 sequence (B), pre-tRNAs containing a 5' leader and a non-74CCA76 sequence (C), and mature tRNAs plus a variant ending with 74GUG76 (D). Each (pre-)tRNA substrate (0.2 pmol) was incubated with His-tagged E. coli tRNase Z (10 pmol) at 50 °C for 10 min. The reaction products were analyzed on a 10% polyacrylamide-8 M urea gel. Bars and arrows denote substrates and primary cleavage products, respectively. Arrows on the sequences indicate primary cleavage sites. A percent cleavage value for the primary product(s) is shown below each gel. ND, not or hardly detected.

 
The cleavages of F-L7T3 and R-L7T3 by E. coli tRNase Z were unexpected, as the removal of the mature 3'-terminal CCA should be wasteful for the cellular metabolism. However, later we knew that similar observations had been reported (Schiffer et al. 2003) and that the A76 removal from mature tRNA by E. coli tRNase Z had been reported (Ezraty et al. 2005). To examine a possibility that the 3'-terminal CCA is required for efficient cleavage by E. coli tRNase Z, we assayed six pre-tRNAsPhe variants: F-L7T3GUG, F-L7T3UCA, F-L7T3CUA, F-L7T3CCG, F-L7T2CC and F-L7T1C, ending with 74GUG76, 74UCA76, 74CUA76, 74CCG76, 74CC75 and C74, respectively, and one pre-tRNAsArg variant, R-L7T3GUG ending with 74GUG76 (Fig. 1C). All of these pre-tRNAs were cleaved well primarily after the discriminator, although the efficiencies differed among the substrates, indicating that the 3'-terminal CCA is not essential for efficient cleavage.

Furthermore, to see if mature tRNAs without leader sequences can be substrates for E. coli tRNase Z, we examined E. coli tRNAPhe, tRNATyr, tRNASer and tRNACys synthesized in vitro with T7 RNA polymerase. Surprisingly, E. coli tRNase Z cleaved all these mature tRNAs and generated the CCA-truncated tRNAs (Fig. 1D). A tRNAPhe variant ending with GUG was also tested and cleaved efficiently after the discriminator, suggesting again that the CCA sequence is not essential.

tRNase Z nibbles off the CCA residues of natural mature tRNAs

As cellular mature tRNAs contain various modified nucleotides, we examined if these natural tRNAs were also substrates of E. coli tRNase Z. We used tRNATyr, tRNALys and tRNAMet extracted from E. coli cells and tRNAPhe extracted from Saccharomyces cerevisiae cells for assays. The assays were carried out with fluorescein-labeled tRNAs (Fig. 2A) or non-labeled tRNAs, which were visualized by ethidium bromide staining (Fig. 2B). Escherichia coli tRNase Z cleaved all these modified tRNAs, and generated primarily the CCA-truncated tRNAs as final cleavage products with respect to tRNATyr and tRNAPhe. In addition to the CCA-truncated tRNA, a shorter product lacking the discriminator was also generated from tRNALys, and the shorter cleavage product was a major final product in tRNAMet. In assays with a low enzyme amount for tRNATyr and tRNALys, tRNA lacking only A76 was also detected, suggesting that at least some percentage of tRNA molecules are transformed to the CCA-truncated tRNA through the intermediate (Fig. S1 in the Supplementary material). The same intermediate was also detected in assays with a low enzyme amount for mature tRNAs without modifications (data not shown). These results, together with the above observation for the unmodified tRNAs, suggest that the nucleotide modifications do not affect the substrate–enzyme interaction.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
Figure 2 tRNase Z nibbles off the CCA residues of natural mature tRNAs. (A) and (B) In vitro 3' processing assays for natural mature tRNAs. Each fluorescein-labeled tRNA substrate (0.2 pmol) (A) or each unlabeled tRNA substrate (40 pmol) (B) was incubated with His-tagged E. coli tRNase Z (10 pmol for the labeled tRNA, and 40 or 120 pmol for the unlabeled tRNA) at 50 °C for 10 min. The reaction products were analyzed on a 10% polyacrylamide-8 M urea gel. L, alkaline ladder. Bars and arrows denote substrates and primary cleavage products, respectively. Arrows on the sequences indicate primary cleavage sites.

 
Disruption of the tRNase Z gene shows no effect on tRNA processing

If tRNase Z works on mature tRNAs in the cells and nibbles off the 3' CCA residues, disruption of the tRNase Z gene would result in the increase in the mature tRNA level that would augment the translation level. As the previous knockdown studies for the E. coli tRNase Z gene was not accompanied with data on the cellular tRNA level, we generated a tRNase Z disruptant from the E. coli strain GI724 to analyze a change of the mature tRNA level.

The disruptant was viable, and exhibited a growth curve similar to that of the wild type when grown at 37 °C in an LB or complete synthetic medium. A microscopic examination of the disruptant cells showed no apparent morphological difference compared with the wild-type cells (data not shown). These results indicate that the tRNase Z gene is not essential for growth under typical laboratory conditions, which is consistent with the previous report (Schilling et al. 2004).

We carried out Northern blotting for the five tRNA species: tRNATyr, tRNASer, tRNAMet, tRNAVal and tRNACys, and found no significant differences in the levels of these mature tRNAs between the wild type and the tRNase Z disruptant, suggesting that tRNase Z plays a limited role, if any, in the tRNA 3' processing under the normal physiological conditions (Fig. 3). In fact, no tRNase Z was detected in a Western blot even for the wild type (Fig. 4B), suggesting that the expression level of the tRNase Z gene is very low, if any. This is the reason why the disruption of the tRNase Z gene showed no effect on tRNA processing. This would also explain why the disruption of the CCA-adding enzyme gene is not lethal (Zhu & Deutscher 1987).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
Figure 3 Disruption of the tRNase Z gene shows no effect on tRNA processing. Northern analyses for E. coli cellular tRNAs in the wild type and the tRNase Z gene disruptant.

 

Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4  Expression of tRNase Z shuts down cell growth. (A) Time course of cell density for the wild type and the transformants with pQE/Ec or pQE/Ec(-tag). An arrow denotes a time point of the IPTG (1 mM) addition. Squares, mock; triangles, with pQE/Ec; circles, with pQE/Ec(-tag). Open, without IPTG; filled, with IPTG. (B) Western analyses for tRNase Z in E. coli cells transformed with pQE/Ec or pQE/Ec(-tag) after IPTG (1 mM) induction.

 
tRNase Z shuts down growth through nibbling off the CCA residues

To investigate what happens if tRNase Z is present in the cells at high concentration and for a long period, we transformed an E. coli strain, GI724, with pQE/Ec that expresses histidine-tagged tRNase Z or pQE/Ec(-tag) that expresses tRNase Z with no tag, and measured growth rates at 37 °C in an LB medium. Although each transformant grew as well as a mock transformant in the absence of isopropyl-β-D-thiogalactopyranoside (IPTG), the growth virtually ceased 2 h after induction (Fig. 4A). A similar observation has been reported (Ezraty et al. 2005). Western analyses for tRNase Z showed that the growth shut-down occurred concomitantly with a boost in the tRNase Z level (Fig. 4B). The leaky expressions of tRNase Z in the absence of the IPTG induction hardly affected the growth rates.

As tRNase Z nibbles off the 3' CCA residues of mature tRNA in vitro, we anticipated that the cessation of cell growth by the tRNase Z expression would be because of a reduction in the level of mature tRNAs. To test this, we carried out a Northern analysis for the five tRNA species: tRNATyr, tRNASer, tRNAMet, tRNAVal and tRNACys using a sequencing gel. In all these tRNA species, their shortened forms presumably lacking 3' residues appeared 2 h after the tRNase Z induction, whereas they were not detected in the mock transformant (Fig. 5).


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
Figure 5  The growth shutdown is through nibbling off the CCA residues. Northern analyses for E. coli cellular tRNAs in the transformants with pQE/Ec or pQE/Ec(-tag) after IPTG (1 mM) induction. Bars and arrows denote mature tRNAs and 3'-shortened products, respectively.

 
The types and amounts of the shortened tRNAs differed depending on the tRNA species. The tRNATyr molecules lacking one and two 3' terminal residues were equally detected, whereas 2- and 3-nt lacking tRNASer molecules showed up unequally. The levels of tRNAMet and tRNAVal molecules lacking their 3'-end CA were relatively low, whereas a large number of CCA-lacking tRNACys appeared. Interestingly, histidine-tagged tRNase Z had a greater effect on nibbling mature tRNAs than tRNase Z with no tag. These results imply that the tRNase Z expression would reduce the levels of the other mature tRNAs in the same fashion, and clearly demonstrate that E. coli tRNase Z can shut down growth through nibbling off the CCA residues.

tRNase Z removes an amino acid from aminoacyl-tRNA

As most of the mature tRNA molecules should be charged with amino acids in rapidly growing cells, we wondered if the shortened tRNAs were generated by cleavage of aminoacyl-tRNAs by tRNase Z. To examine this, we carried out Northern analyses for cellular tRNATyr, tRNASer and tRNAVal using an acidic sequencing gel, on which charged tRNAs can be separated from uncharged tRNAs. In each tRNA blot, only charged tRNA was detected before the tRNase Z induction, whereas the tRNA lacking the 3' terminal residues appeared 2 h after the induction (Fig. 6A). The uncharged mature tRNA was not detected at all before and after the induction. These results are very consistent with the results in the above northern assays (Fig. 5), and suggest that tRNase Z generates the shortened tRNA molecules in vivo by directly cleaving aminoacyl-tRNA molecules not by cleaving uncharged mature tRNA molecules.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

 
Figure 6  tRNase Z removes an amino acid from aminoacyl-tRNA. (A) Northern analyses for E. coli cellular tRNAs in the transformant with pQE/Ec after IPTG induction. The tRNA samples were prepared and separated on a denaturing sequencing gel under acidic conditions to avoid discharging of amino acids. Deacylated tRNA was loaded in each left lane. (B) & (C) In vitro 3' processing assays for Tyr-tRNATyr (B) or tRNASer containing the 3'-(CH2)3SH group (C). The substrate (40 pmol for Tyr-tRNATyr and 0.2 pmol for tRNASer) was incubated with His-tagged E. coli tRNase Z (40 pmol for Tyr-tRNATyr and 10 pmol for tRNASer) at 50 °C for 10 min. The reaction products were analyzed on a 10% polyacrylamide-8 M urea gel under acidic or neutral conditions. Bars and arrows denote substrates and cleavage products, respectively.

 
To confirm that tRNase Z cleaves aminoacyl-tRNA to produce tRNA lacking the 3' residues, we carried out in vitro cleavage assays for Tyr-tRNATyr using histidine-tagged tRNase Z. In the same fashion as in vivo, tRNase Z generated the shortened tRNATyr from Tyr-tRNATyr without forming the uncharged mature tRNA intermediate, indicating that E. coli tRNase Z can indeed cleave aminoacyl-tRNA (Fig. 6B). Furthermore, we tested a 3'-modified tRNASer, which contains a (CH2)3SH group through a phosphate at the 3'-end hydroxyl group, for tRNase Z cleavage. Again, the enzyme produced the 3'-shortened tRNASer (Fig. 6C). Taken together, the present data suggest that tRNase Z, when sufficiently expressed in the cell, shuts down growth by removing amino acids from aminoacyl-tRNAs.

Kasugamycin or chloramphenicol induces tRNase Z gene transcription that results in abortive translation

We tried to find conditions, under which the sufficient expression of the tRNase Z gene occurs, other than the T4 bacteriophage infection. We examined various antibiotics, ampicillin, kasugamycin and chloramphenicol, for induction of its gene expression, and detected its mRNA by Northern blot analysis in two cases. The tRNase Z gene transcription was induced 1 h after the kasugamycin or chloramphenicol addition (Fig. 7). However, tRNase Z was not detected by Western analysis, as expected from the fact that kasugamycin and chloramphenicol inhibit the translational initiation and elongation, respectively (data not shown). A microarray analysis for the kasugamycin effect suggests that the increase in the tRNase Z mRNA level is not a consequence of a general increase in the transcription level (Sabina et al. 2003).


Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
Figure 7  Antibiotics induce tRNase Z gene transcription. Northern analyses for the tRNase Z mRNA in the E. coli cells treated with kasugamycin (750 µg/mL) or chloramphenicol (34 µg/mL). An arrow denotes the mRNA. {Delta}, RNA from the tRNase Z disruptant.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Interaction between Escherichia coli (pre-)tRNA and tRNase Z

Here we solved the enigma of the significant difference in preference for pre-tRNAs among prokaryotic tRNase Zs with respect to the E. coli enzyme, and now we take a unified view of (pre-)tRNA substrates for E. coli tRNase Z. That is, E. coli tRNase Z can cleave any (pre-)tRNA that contains a less than 6-nt 3' trailer after the discriminator regardless of its original species, a trailer sequence, and the presence of a approximately 7-nt 5' leader and nucleotide modifications, although the cleavage efficiency changes to some extent with substrates and the cleavage site fluctuates slightly.

The current data shed light on the issue of how E. coli tRNase Z interacts with (pre-)tRNA. In contrast to T. maritima and B. subtilis tRNase Zs, both of which can cleave pre-tRNA containing a long 3' trailer of 13 nt, the E. coli enzyme hardly cleaves pre-tRNA with a 3' trailer of greater than 6 nt, although there is an exceptional case (Perwez & Kushner 2006). The long trailer might disturb the proper pre-tRNA–tRNase Z interaction may be because of less positive charges on the E. coli enzyme surface (de la Sierra-Gallay et al. 2005; Ishii et al. 2005, 2007; Kostelecky et al. 2006).

In most of the uncharged (pre-)tRNAs tested for in vitro cleavage by E. coli tRNase Z, a predominant final product was a (pre-)tRNA ending with the discriminator, and the major final product of tRNAMet was exceptionally tRNA lacking the discriminator also. This exceptional cleavage would be because of the lack of a base-pairing between C1 and A72. In the most assays, longer cleavage products ending with the 74th or 75th nucleotide were also detected. These results suggest that E. coli tRNase Z might also function on certain substrates in an exoribonuclease-like fashion processive or nonprocessive (Ezraty et al. 2005), although this enzyme has been shown to be able to cleave RNAs endoribonucleolytically (Shibata et al. 2006). Alternatively, the E. coli enzyme might cleave trailers of (pre-)tRNAs randomly in the endoribonucleolytic fashion to generate final cleavage products ending with the discriminator. Both fashions would not be mutually exclusive, and their dominancy would change depending on (pre-)tRNA species.

In contrast to the in vitro results for the uncharged tRNAs, the types and amounts of the in vivo shortened tRNAs differed greatly depending on the aminoacyl-tRNA species (Figs 1, 2, 5 and 6B). Although the pattern of tRNASer cleavage in vivo was the same as that in vitro, the cleavage patterns for tRNATyr, tRNAMet and tRNACys were different between in vivo and in vitro. The cleavage pattern for Tyr-tRNATyr in vitro was the same as that for uncharged tRNATyr in vitro, but was different from that in vivo. These differences may be because an amino acid attached to tRNA affects cleavage site selection by E. coli tRNase Z and/or because the cellular conditions differentially affect the cleavage site selection. The effect of an amino acid on the interaction between aminoacyl-tRNA and tRNase Z would likely differ depending on properties of amino acid species such as charge, size and polarity, and this would cause the difference in the types and amounts of the in vivo shortened tRNAs.

Unusual tRNA cleaving property of E. coli tRNase Z

We discovered that E. coli tRNase Z can nibble off the CCA residues from aminoacylated tRNAs as well as deacylated tRNAs. This property of tRNase Z is unprecedented. To address an issue whether tRNase Zs from other species can also remove an amino acid from aminoacyl-tRNA, we examined tRNase Zs from B. subtilis, T. maritima, Synechocystis sp., and human for the activity to nibble off the CCA residues from mature tRNA, but we could not detect this activity under the standard assay conditions with an exception of human tRNase ZL but not tRNase ZS (data not shown). This suggests that it is unlikely that these tRNase Zs except for human tRNase ZL have the ability to remove amino acids from aminoacyl-tRNAs. We observed that human tRNase ZL can also cleave the tRNASer 3'-modified with the (CH2)3SH group (data not shown), although we do not know a physiological role of this activity at this point.

Another type of enzyme that can remove an amino acid from aminoacyl-tRNA is known and designated as aminoacyl-tRNA deacylase. This enzyme can be categorized into two groups: one that hydrolyzes D-aminoacyl-tRNA (Soutourina et al. 1999), and the other that hydrolyzes misacylated tRNA (Ruan & Söll 2005). The former (e.g., E. coli D-Tyr-tRNATyr deacylase) appears to be used to exclude D-amino acids from proteins and to be essential for cell viability in the presence of D-amino acids. And the latter (e.g. E. coli Cys-tRNAPro deacylase) may be involved in the editing of aminoacyl-tRNAs.

Despite the similar reaction, aminoacyl-tRNA deacylase is quite different from tRNase Z not only in a sequence and a structure but also in a cleavage mechanism. Escherichia coli tRNase Z shows no significant similarity with E. coli D-Tyr-tRNATyr deacylase or Cys-tRNAPro deacylase. Escherichia coli tRNase Z removes an amino acid by cleaving one of the phosphodiester bonds in 73NCCA76, whereas aminoacyl-tRNA deacylase appears to remove an amino acid by cleaving the ester bond between the amino acid and tRNA.

Under what natural conditions is tRNase Z expressed in Escherichia coli cells?

In this study, we showed that although the E. coli tRNase Z gene can be transcribed in the presence of kasugamycin or chloramphenicol, its protein product is not generated as a result of translational inhibition by the antibiotics’ actions. Currently, the T4 bacteriophage infection appears to be the only known trigger to the tRNase Z expression (Seidman et al. 1975; Asha et al. 1983). Although Western analyses or other equivalent approaches to detect the protein itself were not carried out, from the fact that the tRNase Z mutant cannot support the T4 phage infection, it is likely that tRNase Z is sufficiently expressed in the wild-type cells and used to process the T4 phage-coded CCA-less pre-tRNAs. From the present observation, we speculate that, in the course of the T4 infection, tRNase Z might start removing amino acids from aminoacyl-tRNAs and slow down translation to inhibit T4 phages from further infection.

Some kind of a nutrient deficiency and/or some of the physical stresses such as change in temperature, pH, or osmotic pressure, or irradiation (Storz & Hengge-Aronis 2000) might somehow induce the sufficient tRNase Z expression to help modulate a growth rate by removing amino acids from aminoacyl-tRNAs. It is also possible that in harmony with the ability of translational repression, tRNase Z might be tuning gene expression through degrading mRNAs (Shibata et al. 2006). In any case, the first enigma was solved by the discovery that this enzyme can shut down cell growth by removing amino acids from aminoacyl-tRNAs, although we need to make further efforts to elucidate under what natural conditions tRNase Z is expressed in order to fully understand its role.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Plasmid construction

The E. coli tRNase Z gene was PCR-amplified from pQE/Ec (Minagawa et al. 2004) using the primer pair 5'-GGAATTCATTAA AGAGGAGAAATTAACTATGGAATTAATTTTTTTAGG-3' and 5'-GCGGATCCTTAAACGTTAAACACGGTGA-3'. The PCR product was inserted into the EcoRI and BamHI sites of pQE-80L (Qiagen) to generate pQE/Ec(-tag) that produces E. coli tRNase Z without the histidine tag.

Expression and purification of Escherichia coli tRNase Z

Histidine-tagged recombinant E. coli tRNase Z was produced from the expression plasmid pQE/Ec in E. coli cells, and purified using nickel–agarose beads as described before (Minagawa et al. 2004).

(Pre-)tRNA synthesis and 5'-labeling with fluorescein

The (pre-)tRNAs were synthesized in vitro with T7 RNA polymerase (Takara Shuzo) from the synthetic (pre-)tDNAs containing its promoter. The transcription reactions were carried out under the conditions recommended by the manufacturer (Takara Shuzo), and the transcribed (pre-)tRNAs were gel-purified. Escherichia coli mature tRNATyr, tRNALys , and tRNAMet , and S. cerevisiae mature tRNAPhe were purchased from Sigma.

A 3'-modified tRNASer, which contains a (CH2)3SH group through a phosphate at the 3'-end hydroxyl group, was generated by joining fluorescein-5'-labeled tRNASer lacking the 69th–76th nucleotides, which was synthesized in vitro with T7 RNA polymerase, and the 69th–76th oligoribonucleotides with the (CH2)3SH group, which was synthesized with a DNA/RNA synthesizer (Nippon Bioservice). The reaction was carried out with T4 RNA ligase (Takara Shuzo).

The (pre-)tRNAs were labeled with fluorescein according to the manufacturer protocol (GE Healthcare). After the removal of the 5'-phosphates of the (pre-)tRNAs with bacterial alkaline phosphatase (Takara Shuzo), they were phosphorylated with ATP{gamma}S using T4 polynucleotide kinase (Takara Shuzo). Then a single fluorescein moiety was appended onto the 5'-phosphorothioate site. The resulting (pre-)tRNAs with fluorescein were gel-purified before assays.

In vitro tRNA 3' processing assay

The 3' processing reactions for fluorescein-labeled (pre-)tRNAs (0.2 pmol) or unlabeled tRNAs (40 pmol) were carried out with His-tagged E. coli tRNase Z (10–120 pmol) in a mixture (6 µL) containing 10 mM Tris–HCl (pH 7.5), 1.5 mM dithiothreitol, 25 mM NaCl and 5 mM MgCl2. The reaction mixture was incubated at 50 °C for 10 min. After resolution of the reaction products on a 10% polyacrylamide-8 M urea gel, the fluorescein-labeled and unlabeled products were visualized with a Typhoon 9210 (GE Healthcare) and by staining with ethidium bromide, respectively. Sizes of 5' cleavage products of 5'-end-labeled (pre-)tRNAs were determined using an RNA alkaline ladder and RNA standards of known sizes (Minagawa et al. 2004; Takaku et al. 2004).

In vitro tRNA 3' processing reactions for Tyr-tRNATyr (40 pmol) were carried out at 50 °C for 10 min with His-tagged E. coli tRNase Z (40 pmol) in a mixture (6 µL) containing 10 mM Tris–HCl (pH 6.8), 1.5 mM dithiothreitol, 25 mM NaCl and 5 mM MgCl2. After resolution of the reaction products on a 10% polyacrylamide-8 M urea sequencing gel, the products were analyzed by Northern blotting as described below.

Generation of the tRNase Z gene disruptant and its culture

The E. coli tRNase Z gene disruptant was generated using a Quick and Easy BAC Modification Kit (Gene Bridges) according to the manufacturer's protocol. A DNA fragment for disruption of the tRNase Z gene was PCR-amplified using a Tn5-neomycin DNA fragment as a template with the primer pair 5'-ATGGAATTAAT TTTTTTAGGTACTTCAGCCGGTGTGCCAACCCGCACG CGTGGACAGCAAGCGAACCGGAATTGC-3' and 5'-TTAA ACGTTAAACACGGTGAAATCATTCGCCAGTTCAGTC GCCGGGAAAATCAGAAGAACTCGTCAAGAAGGCG-3'.

The wild-type and disruptant cells were cultured at 37 °C in the LB medium or the M9 mineral salts medium (Sambrook & Russell 2001).

Cellular RNA preparation

Total RNAs from E. coli cells were prepared with an RNeasy kit (Qiagen). Cellular aminoacyl-tRNAs were prepared as follows. Harvested cells were suspended in a buffer containing 0.3 M sodium acetate (pH 4.5) and 10 mM EDTA, and total RNA was extracted three times with phenol equilibrated with the same buffer. The aminoacyl-tRNAs were precipitated with ethanol and dissolved in a buffer containing 10 mM sodium acetate (pH 4.5) and 1 mM EDTA.

Northern blotting

To analyze uncharged tRNA, low-molecular-weight RNA was resolved on a 15% polyacrylamide/8 M urea gel, and, to analyze both aminoacyl-tRNA and uncharged tRNA, total RNA was separated on an acid urea polyacrylamide gel (Varshney et al. 1991). The uncharged tRNA was prepared by incubating the aminoacyl-tRNA in a buffer (500 mM Tris–HCl (pH 9.0)) at 37 °C for 60 min. Total RNA was also separated by 1% formaldehyde-agarose gel electrophoresis to analyze the tRNase Z mRNA.

The RNA was blotted onto a Hybond N+ membrane (GE Healthcare) and cross-linked to the membrane with a UV transilluminator (UVP). To detect tRNA, the membrane was probed with a fluorescein-isothiocyanate-3'-labeled deoxyoligonucleotide in a QuickHyb buffer (Stratagene) at 45 °C, and analyzed using a CDP-Star detection system (GE Healthcare) with a LAS3000 mini system (Fuji Photo Film). The deoxyoligonucleotide probes for tRNATyr, tRNASer, tRNAMet, tRNAVal and tRNACys were 5'-TCGAAGTCGATGACGGCA-3', 5'-GCAGCTTTTGACCGC-3', 5'-ATCTTCGGGTTATGAGCCC-3', 5'-GGGTGATGAC GGGATC-3' and 5'-TTTGCAATCCGCTAC-3', respectively.

To detect tRNase Z mRNA, the membrane was probed with a digoxigenin (DIG)-labeled antisense RNA to the full-length tRNase Z mRNA in a QuickHyb buffer (Stratagene) at 60 °C, and analyzed using a DIG system (Roche Applied Science) with the LAS3000 mini system.

Western analysis

Whole cell extracts dissolved in a buffer (50 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 100 mM dithiothreitol) were separated by SDS/12% polyacrylamide gel electrophoresis, and transferred to a Hybond ECL membrane (GE Healthcare). The membrane was probed with rabbit polyclonal antibodies raised to recombinant His-tagged E. coli tRNase Z using the ECL Western Blotting Detection System (GE Healthcare), and analyzed with the LAS3000 mini system (Fuji Photo Film).

tRNA aminoacylation

Escherichia coli tRNATyr (500 pmol), which was obtained from Sigma and gel-purified, was aminoacylated with an amino-acid mix (Wako) and tyrosyl-tRNA synthetase (Sigma). The completed reaction mix was acidified with 75 mM sodium acetate (pH 5.2) and deproteinized with phenol–chloroform (pH 5.2). Resulting Tyr-tRNATyr was ethanol-precipitated and redissolved in 5 mM sodium acetate (pH 5.2).


    Acknowledgements
 
We thank M. Aoyama and A. Minagawa for technical assistance and Dr M. Takagi for helpful discussion and encouragement. This work was supported by the Science Research Promotion Fund and the Academic Frontier Research Project Grant from the Promotion and Mutual Aid Corporation for Private Schools of Japan and by Grant-in-Aid for Young Scientists from the Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT).


    Footnotes
 
Communicated by: Yoshikazu Nakamura

* Correspondence: mnashimoto{at}nupals.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Asha, P.K., Blouin, R.T., Zaniewski, R. & Deutscher, M.P. (1983) Ribonuclease BN: Identification and partial characterization of a new tRNA processing enzyme. Proc. Natl. Acad. Sci. USA 80, 3301–3304.[Abstract/Free Full Text]

de la Sierra-Gallay, I.L., Pellegrini, O. & Condon, C. (2005) Structural basis for substrate binding, cleavage and allostery in the tRNA maturase RNase Z. Nature 433, 657–661.[CrossRef][Medline]

Deutscher, M.P. (1990) Ribonucleases, tRNA nucleotidyltransferase, and the 3' processing of tRNA. Prog. Nucleic Acid Res. Mol. Biol. 39, 209–240.[Medline]

Ezraty, B., Dahlgren, B. & Deutscher, M.P. (2005) The RNase Z homologue encoded by Escherichia coli elaC gene is RNase BN. J. Biol. Chem. 280, 16542–16545.[Abstract/Free Full Text]

Green, R. & Noller, H.F. (1997) Ribosomes and translation. Annu. Rev. Biochem. 66, 679–716.[CrossRef][Medline]

Ishii, R., Minagawa, A., Takaku, H., Takagi, M., Nashimoto, M. & Yokoyama, S. (2005) Crystal structure of the tRNA 3' processing endoribonuclease tRNase Z from Thermotoga maritima. J. Biol. Chem. 280, 14138–14144.[Abstract/Free Full Text]

Ishii, R., Minagawa, A., Takaku, H., Takagi, M., Nashimoto, M. & Yokoyama, S. (2007) The structure of the flexible arm of Thermotoga maritima tRNase Z differs from those of homologous enzymes. Acta Cryst. F63, 637–641.[CrossRef][Medline]

Karkashon, S., Hopkinson, A. & Levinger, L. (2007) tRNase Z catalysis and conserved residues on the carboxy side of the His cluster. Biochemistry 46, 9380–9387.[CrossRef][Medline]

Kostelecky, B., Pohl, E., Vogel, A., Schilling, O. & Meyer-Klaucke, W. (2006) The crystal structure of the zinc phosphodiesterase from Escherichia coli provides insight into function and cooperativity of tRNase Z-family proteins. J. Bacteriol. 188, 1607–1614.[Abstract/Free Full Text]

Li, Z. & Deutscher, M.P. (1996) Maturation pathways for E. coli tRNA precursors: a random multienzyme process in vivo. Cell 86, 503–512.[CrossRef][Medline]

Minagawa, A., Takaku, H., Ishii, R., Takagi, M., Yokoyama, S. & Nashimoto, M. (2006a) Identification by Mn2+ rescue of two residues essential for the proton transfer of tRNase Z catalysis. Nucleic Acids Res. 34, 3811–3818.[Abstract/Free Full Text]

Minagawa, A., Takaku, H., Shibata, H.S., Ishii, R., Takagi, M., Yokoyama, S. & Nashimoto, M. (2006b). Substrate recognition ability differs among various prokaryotic tRNase Zs. Biochem. Biophys. Res. Commun. 345, 385–393.[CrossRef][Medline]

Minagawa, A., Takaku, H., Takagi, M. & Nashimoto, M. (2004). A novel endonucleolytic mechanism to generate the CCA 3' termini of tRNA molecules in Thermotoga maritima. J. Biol. Chem. 279, 15688–15697.[Abstract/Free Full Text]

Nashimoto, M. (1997) Distribution of both lengths and 5' terminal nucleotides of mammalian pre-tRNA 3' trailers reflects properties of 3' processing endoribonuclease. Nucleic Acids Res. 25, 1148–1155.[Abstract/Free Full Text]

Pellegrini, O., Nezzar, J., Marchfelder, A., Putzer, H. & Condon, C. (2003) Endonucleolytic processing of CCA-less tRNA precursors by RNase Z in Bacillus subtilis. EMBO J. 22, 4534–4543.[CrossRef][Medline]

Perwez, T. & Kushner, S.R. (2006) RNase Z in Escherichia coli plays a significant role in mRNA decay. Mol. Microbiol. 60, 723–737.[CrossRef][Medline]

Ruan, B. & Söll, D. (2005) The bacterial YbaK protein is a Cys-tRNAPro and Cys-tRNACys deacylase. J. Biol. Chem. 280, 25887–25891.[Abstract/Free Full Text]

Sabina, J., Dover, N., Templeton, L.J., Smulski, D.R., Söll, D. & LaRossa, R.A. (2003) Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12. J. Bacteriol. 185, 6158–6170.[Abstract/Free Full Text]

Sambrook, J. & Russell, D. (2001) Molecular Cloning: A Laboratory Manual (Third Edition). Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.

Schiffer, S., Rösch, S. & Marchfelder, A. (2003) Recombinant RNase Z does not recognize CCA as part of the tRNA and its cleavage efficiency is influenced by acceptor stem length. Biol. Chem. 384, 333–342.[CrossRef][Medline]

Schilling, O., Ruggeberg, S., Vogel, A., Rittner, N., Weichert, S., Schmidt, S. Doig, S., Franz, T., Benes, V., Andrews, S.C., Baum, M. & Meyer-Klaucke, W. (2004) Characterization of an Escherichia coli elaC deletion mutant. Biochem. Biophys. Res. Commun. 320, 1365–1373.[CrossRef][Medline]

Seidman, J.G., Schmidt, F.J., Foss, K. & McClain, W.H. (1975) A mutant of Escherichia coli defective in removing 3' terminal nucleotides from some transfer RNA precursor molecules. Cell 5, 389–400.[CrossRef][Medline]

Shibata, H.S., Minagawa, A., Takaku, H., Takagi, M. & Nashimoto, M. (2006) Unstructured RNA is a substrate for tRNase Z. Biochemistry 45, 5486–5492.[CrossRef][Medline]

Soutourina, J., Plateau, P., Delort, F., Peirotes, A. & Blanquet, S. (1999) Functional characterization of the D-Tyr-tRNATyr deacylase from Escherichia coli. J. Biol. Chem. 274, 19109–19114.[Abstract/Free Full Text]

Storz, G.T. & Hengge-Aronis, R. (2000) Bacterial Stress Responses. Washington, DC: ASM Press.

Takaku, H., Minagawa, A., Masamichi, T. & Nashimoto, M. (2003) A candidate prostate cancer susceptibility gene encodes tRNA 3' processing endoriobonuclease. Nucleic Acids Res. 31, 2272–2278.[Abstract/Free Full Text]

Takaku, H., Minagawa, A., Takagi, M. & Nashimoto, M. (2004) The N-terminal half-domain of the long form of tRNase Z is required for the RNase 65 activity. Nucleic Acids Res. 32, 4429–4438.[Abstract/Free Full Text]

Varshney, U., Lee, C.P. & RajBhandary, U.L. (1991) Direct analysis of aminoacylation levels of tRNAs in vivo. Application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J. Biol. Chem. 266, 24712–24718.[Abstract/Free Full Text]

Vogel, A., Schilling, O., Spath, B. & Marchfelder, A. (2005) The tRNase Z family of proteins: physiological functions, substrate specificity and structural properties. Biol. Chem. 386, 1253–1264.[CrossRef][Medline]

Wen, T., Oussenko, I.A., Pellegrini, O., Bechhofer, D.H. & Condon, C. (2005) Ribonuclease PH plays a major role in the exonucleolytic maturation of CCA-containing tRNA precursors in Bacillus subtilis. Nucleic Acids Res. 33, 3636–3643.[Abstract/Free Full Text]

Zareen, N., Hopkinson, A. & Levinger, L. (2006) Residues in two homology blocks on the amino side of the tRNase Z His domain contribute unexpectedly to pre-tRNA 3' end processing. RNA 12, 1104–1115.[Abstract/Free Full Text]

Zareen, N., Yan, H., Hopkinson, A. & Levinger, L. (2005) Residues in the conserved His domain of fruit fly tRNase Z that function in catalysis are not involved in substrate recognition or binding. J. Mol. Biol. 350, 189–199.[CrossRef][Medline]

Zhu, L. & Deutscher, M.P. (1987) tRNA nucleotidyltransferase is not essential for Escherichia coli viability. EMBO J. 6, 2473–2477.[Medline]

Accepted: 27 July 2008




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T. Dutta and M. P. Deutscher
Catalytic Properties of RNase BN/RNase Z from Escherichia coli: RNase BN IS BOTH AN EXO- AND ENDORIBONUCLEASE
J. Biol. Chem., June 5, 2009; 284(23): 15425 - 15431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takaku, H.
Right arrow Articles by Nashimoto, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Takaku, H.
Right arrow Articles by Nashimoto, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS