| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Medical Genome Sciences, Graduate School of Frontier Sciences, University of Tokyo, Building FSB-401, 5-1-5, Kashiwanoha, Kashiwa, Chiba Prefecture 277-8562, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
Mitochondria contain a separate protein-synthesis machinery for the production of polypeptides encoded by mitochondrial DNA (mtDNA) (Spremulli et al. 2004). In mammals, mtDNA encodes 13 proteins that play essential roles in the respiratory chain (Anderson et al. 1981). Mitochondrial (mt) rRNAs and tRNAs are also encoded by mtDNA (Anderson et al. 1981), whereas all proteins involved in mitochondrial translation are encoded by nuclear genes and imported from the cytoplasm. Many nuclear-encoded mammalian mitochondrial translation factors have been cloned and characterized. These include mitochondrial IF-2, IF-3, EF-Tu, EF-Ts, EF-G1, EF-G2, MTF, MetRS, SerRS, PheRS, LysRS, LeuRS, TyrRS, AspRS, GlyRS, RF-1 and RRF (Takeuchi et al. 1998; Zhang & Spremulli 1998; Bullard et al. 1999, 2000; Tolkunova et al. 2000; Yokogawa et al. 2000; Spencer et al. 2004; Spremulli et al. 2004; Bonnefond et al. 2005; Chihara et al. 2007; Scheper et al. 2007a). In addition, proteomic analyses of mitochondrial ribosomes have identified over 50 species of mitochondrial ribosomal proteins and their cognate genes (O’Brien et al. 1999, 2000; Cavdar Koc et al. 2001; Koc et al. 2001; Suzuki et al. 2001a,b; Smits et al. 2007).
Defects in mitochondrial translation system are associated with a subset of human diseases (Jacobs 2003; Jacobs & Turnbull 2005; Scheper et al. 2007b; Shoubridge & Sasarman 2007). Most of the mutations ascribed so far occur in mtDNA, reflecting the relative ease of study of this small genome and the unique characteristics of mitochondrial genetics (see MITOMAP, <http://www.mitomap.org>). During the last few years, an increasing number of mutations have been reported in the nucleus-encoded components of the mitochondrial translation system. These include, EF-Tu, EF-Ts, EF-G1, AspRS, GlyRS, ArgRS, IF3, S6, S16, S22, L37, and so on (Miller et al. 2004; Maraganore et al. 2005; Antonicka et al. 2006; Papapetropoulos et al. 2006; Smeitink et al. 2006; Abahuni et al. 2007; Chihara et al. 2007; Edvardson et al. 2007; Saada et al. 2007; Scheper et al. 2007a; Valente et al. 2007). However, the detailed mechanisms of how the mutations influence translation and how they result in the clinical phenotypes remain to be elucidated. Additionally, it is currently unknown which and how many respiratory chain complexes are affected by these mutations.
During the process of translational termination, several auxiliary factors are required. In bacteria, four factors are involved in the termination step (Craigen et al. 1990; Tate & Brown 1992; Nakamura et al. 1996). Release factor 1 (RF1) and Release factor 2 (RF2) are responsible for the recognition of the stop codons and the hydrolysis of the ester bond between the tRNA and the nascent polypeptide. Release factor 3 (RF3) stimulates the activities of RF1 and RF2. The ribosome recycling factor (RRF) is essential for the release of ribosomes from mRNA at stop codons (Janosi et al. 1994, 1998). In the eukaryotic cell cytoplasm, two RFs are known (eRF1 for codon recognition and eRF3 for the stimulation of this activity) (Stansfield et al. 1995; Frolova et al. 1996; Nakamura et al. 1996). No cytoplasmic equivalent of RRF has been detected. To date, limited information is available about the termination process in mammalian mitochondria. The cDNA sequences for the putative human mitochondrial translation release factor 1 (HMRF1) and ribosome recycling factor have been reported (Zhang & Spremulli 1998). One mitochondrial RF has been partially purified from rat liver mitochondria and has been shown to recognize the stop codon UAA (Lee et al. 1987). A genetic code that is somewhat different from the universal code is used by mammalian mitochondria. For example, human mitochondria use, in addition to UAA, the universal arginine codons AGG and AGA for termination. UGA serves as a codon for tryptophan rather than as a stop codon. It is unclear how stop codon recognition take places in human mitochondria (Barrell et al. 1979).
With the aim of acquiring an understanding of the molecular basis of the mitochondrial translation system, we have been engaged in establishing an in vitro translation system. The initial trials using human mitochondrial crude extracts were not very successful. Apparently, mitochondrial crude extracts contain too many nucleases and proteases, which makes them unsuitable as a source of extracts for in vitro translation. To circumvent this problem, we have been trying to reconstitute the mammalian mitochondrial translation system using purified recombinant translation factors. However, this requires a complete set of essential translation factors that are functional in vitro. While all the essential mammalian mitochondrial translation factors involved in the initiation and elongation processes have been already cloned and well characterized (Spremulli et al. 2004), factors involved in the termination process have resisted biochemical characterization. This prompted us to identify a functional human mitochondrial RF.
In the present work, we first produced and characterized recombinant HMRF1, which was previously denoted as human mitochondrial RF (Zhang & Spremulli 1998). Here we show, however, that HMRF1 is inactive in the in vitro translation system, although it is a mitochondrial protein. Instead, we identified another candidate for human mitochondrial RF, termed HMRF1L, and demonstrate that HMRF1L is a mitochondrial protein that functions as a RF for the decoding of UAA and UAG termination codons in vitro. Moreover, we demonstrate that HMRF1L does not decode UGA, AGA or AGG as termination stop codons in vitro. With the identification of a functional mitochondrial RF, it should now become possible to acquire a detailed understanding of the process of polypeptide chain termination in mammalian mitochondria.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
To detect RF activity, an in vitro translation system was used (Fig. 1). mRNA coding a short polypeptide (MFFLFFLFF) with various termination codons was translated using the reconstituted in vitro translation system (PURE system). Short polypeptide (MFFLFFLFF) synthesis was estimated by measuring the incorporation of [14C] phenylalanine into polypeptides. In this system, RF recognition of the termination codon promotes release of the polypeptide from the ribosome, resulting in multi-round translation of the mRNA. Thus, the yield of synthesized polypeptide reflects the efficiency of codon recognition by the RF and the catalytic activity of the RF. Since mRNA is naturally translated and the RFs are tested with various competitive factors and events, this assay system may show certain merits in analyses for termination codon specificity of RFs compared with the classical assay system where programmed static Escherichia coli ribosome including fMet-tRNA and two separate codons are used.
|
|
|
Search for an alternative candidate for human mitochondrial RF
To obtain a functional mitochondrial RF, we searched for alternative candidates of human mitochondrial RF in the human genome database. Utilizing the BLAST program with the HMRF1 amino acid sequence (tblastn program, nr database, <http://www.ncbi.nlm.nih.gov/BLAST/>), a homologue of HMRF1, as well as many isoforms of HMRF1, were retrieved. The HMRF1 homologue, termed hereafter human mitochondrial RF1-like protein (HMRF1L), carries the signature sequences of class I RFs. These include the highly conserved GxGGQ motif, which facilitates the termination of translation by hydrolyzing the ester bond between the tRNA and the nascent polypeptide (Frolova et al. 1999; Seit-Nebi et al. 2001), and RTYNF sequences (Ito et al. 1996; Nakamura et al. 1996; Ito & Nakamura 1997) (Fig. 3). Additionally, HMRF1L carries a PKT sequence for the PXT tri-peptide motif, which is responsible for codon recognition. The PKT sequence of HMRF1L more closely resembles the PXT tri-peptide sequences of other RF1s than does HMRF1, which has a PEVGLS sequence in this region (Fig. 3). HMRF1L was predicted to be localized to mitochondria according to programs for the prediction of protein localization sites in cells (PSORT II and Target P).
Both HMRF1 and HMRF1L are mitochondrial proteins
Next we examined if endogenous HMRF1L and HMRF1 were actually expressed in mitochondria in vivo. Mitochondrial and cytoplasmic lysates were prepared from HeLa cells and subjected to Western blot analysis with antibodies against recombinant HMRF1L and HMRF1. Correct cell fractionation was confirmed by performing Western blot analysis with anti-bEF-Tumt and β-actin antibodies (Fig. 4A, bEF-Tumt and β-actin), which showed that HMRF1L and HMRF1 were specifically present in the mitochondrial fraction (Fig. 4A, HMRF1L and HMRF1). No cross-reactivity of anti-HMRF1L and anti-HMRF1 antibodies with purified HMRF1 and HMRF1L, respectively, was noted (data not shown).
|
These results confirmed that both HMRF1L and HMRF1 are mitochondrial proteins and not the products of pseudo-genes.
HMRF1L exhibits RF activity for UAA and UAG codons
Next we proceeded to test the RF activity of HMRF1L. As with HMRF1, the RF activity of HMRF1L was assessed in an in vitro translation system. According to the cleavage site of the mitochondrial import signal predicted by PSORT II and Target P, an N-terminal histidine-tagged HMRF1L lacking its N-terminal 25 residues was used in the assay. HMRF1L showed significant RF activity for UAA and UAG codons as did E. coli RF1 (Fig. 5, HMRF1L), and did not show any activity with UGA, AGA or AGG codons.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
At present, a search for human mitochondrial translation RFs that recognize AGA and AGG codons has not yielded any candidates. It is noteworthy that AGA and AGG codons are unassigned in rat and mouse mitochondria (Bibb et al. 1981; Koike et al. 1982; Pepe et al. 1983). Consistently, RF activities for AGA and AGG codons have not been detected in rat mitochondrial extracts (Lee et al. 1987). Additionally, there is no experimental evidence that AGA and AGG codons are used as stop codons in human mitochondria. Although AGA and AGG codons seem to encode stop codons for COI and ND6 genes on mtDNA, the possibility that RNA editing, resulting in, for instance, the creation of UAG codons following U-insertions in front of AGA–AGG codons, cannot be excluded. A more detailed analysis of mRNA sequences in human mitochondria would appear to be necessary.
Functional significance of HMRF1L in vivo
In the present work, we have identified a functional mammalian mitochondrial translation RF, HMRF1L, which should now be added to the growing list of mitochondrial translation factors. We demonstrated that HMRF1L exhibits RF activity in the multi-round translation of short peptides in vitro (Fig. 5). However, the functional significance of RF activity of HMRF1L in mammalian mitochondria is still ambiguous.
The depletion of HMRF1L by siRNA did not exhibit any significant change in mitochondrial translation activity (Soleimanpour-Lichaei et al. 2007). It might be difficult to assess the functional significance of HMRF1L by siRNA. First, the translation efficiency of DHFR (20 kDa) in mitochondrial in vitro translation system does not strictly depend on the HMRF1L activity (Takeuchi et al., unpubl. data). It is explained that the activity of RF is rarely reflected when long peptides are translated in the single-round translation. Thus, it is consistent that the depletion of HMRF1L by siRNA did not affect de novo mitochondrial protein synthesis (Soleimanpour-Lichaei et al. 2007). Second, most subunits of respiratory complexes are very stable. For example, the steady-levels of subunits of respiratory complexes remain constant even after mitochondrial translation is down-regulated for 96 h (Takeuchi & Ueda 2003). Thus, it might be why the steady-levels of subunits of respiratory complexes did not change after siRNA for HMRF1L for 3 days (Soleimanpour-Lichaei et al. 2007).
It is possible that HMRF1L is important beyond its translational activity. Many mitochondrial translation apparatus are associated with the mitochondrial inner membrane (Liu & Spremulli 2000; Takeuchi & Ueda 2003). A change in HMRF1L level associated with the mitochondrial inner membrane would affect the assembly of the respiratory complexes, and production of reactive oxygen species (ROS). This might be because siRNA for HMRF1L caused increased mitochondrial ROS production (Soleimanpour-Lichaei et al. 2007), rather than due to the defect in RF activity of HMRF1L.
It has been indicated that some human diseases are caused by the dys-regulation of the termination of protein synthesis in mitochondria (Temperley et al. 2003; Chrzanowska-Lightowlers et al. 2004; Jesina et al. 2004). Further analyses on the other mitochondrial factors involved in mitochondrial translation termination, such as RRF, would be necessary to understand precisely the translational termination process in mammalian mitochondria, as well as the biological role of HMRF1L. In vitro reconstitution of the termination process in mitochondria utilizing all of the purified factors involved in mitochondrial translation termination is now in progress with the aim of understanding the molecular basis of such diseases.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
DNA templates were prepared as follows. Using plasmid pURE1 (Post Genome Institute Co., Ltd, Tokyo, Japan), DNA fragments were amplified by PCR with the T7 promoter primer 5'-GCGCGTAATACGACTCACTATAG-3' and 3' primer 5'-GATCCCTAGAACAGCTAAAAGAACAGAAAGAACAGG AAGAACATATGATATCTCCTTCTTAAAGTT-3'. The underlined sequence encodes the MFFLFFLFF short polypeptide (see Fig. 1, construction of template DNA). Bold letters denote termination codons, which were varied as indicated.
The system was reconstituted as published previously (Shimizu et al. 2001) with slight modifications. Briefly, RF3 was omitted from the standard system. Only methionyl–tRNA synthetase, phenylalanyl–tRNA synthetase and leucyl–tRNA synthetase were included as aminoacyl–tRNA synthetase sources. Instead of amino acid mixtures, methionine, [14C] phenylalanine, phenylalanine and leucine were used, and [35S] methionine was omitted from the system. Arginyl–tRNA synthetase and arginine were not added to the system in order to prevent arginyl–tRNA suppression of AGA and AGG codons. The other components were the same as described previously. Equal amounts of RF (0.2 µg each, E. coli RF1, HMRF1 or HMRF1L) were used in the assay.
Reactions (20 µL) were started by the addition of 0.27 µg/mL (final concentration) of PCR-amplified DNA template. After incubation at 37 °C for 1 h, the mixture was spotted onto filter paper (Whatman 3 mm), and incubated in 10% TCA for 30 min at 85 °C. Filters were then washed in cold 10% TCA, and incorporation of [14C] phenylalanine into polypeptides was determined using a scintillation counter.
Construction of plasmids
HMRF1/pETDuet-1 was used as an E. coli expression vector for N-terminal histidine-tagged human HMRF1. The EST coding for HMRF1 (accession number BC042196 [GenBank] ) was obtained from Invitrogen, Carlsbad, CA. The coding sequence was amplified by PCR, using primers 5'-AATTGGTCCAGGGATCCTTGCC ATCAAGACACCAAGATGCTCT-3' and 5'-ATAATAATAA GCGGCCGCTTATTTTGCTGATTTAAGGTGTTCA-3', and cloned between the BamH I and Not I sites of pETDuet-.1
HMRF1L/pET15b was used as the E. coli expression vector for N-terminal histidine-tagged human mt RF1L. The EST coding for HMRF1L (accession number BC011873 [GenBank] ) was purchased from Invitrogen. The coding sequence was amplified by PCR, using primers 5'-CCAGCCCGCCGGCATATGAGCTCCGGTA GCCCGCCGCTGGAGG-3' and 5'-AACAAGTCGACTT AAACTTTTTGGGAAATAATTTCT-3', and cloned between the Nde I and Sal I sites of a modified pET15b vector (Novagen, Madison, WI), whose original multi-cloning sites were modified in our laboratory.
HMRF1-3xFLAG/pcDNA3.1 was used as the mammalian expression vector for C-terminal 3XFLAG-tagged HMRF1. The coding sequence was amplified from the cDNA clone described above by PCR, using primers 5'-GCGGATCCGCCACCATG AATCGTCACCTGTGTGTTTGGC-3' and 5'-CCGCTCGA GTCACTTGTCATCGTCATCCTTGTAATCGATGTCATG ATCTTTATAATCACCGTCATGGTCTTTGTAGTCTTTT GCTGATTTAAGGTGTTCATCCAAAAG-3', and cloned between the BamH I and Xho I sites of pcDNA3.1/Zeo(+) (Invitrogen).
HMRF1L-3xFLAG/pcDNA3.1 was used as the mammalian expression vector for C-terminal 3XFLAG-tagged HMRF1L. The coding sequence was amplified from the cDNA clone described above by PCR, using primers 5'-CGCAAGCTT CCGCCACCATGCGGTCCCGGGTTCTGTGGGGCG-3' and 5'-CCGGAATTCTTACTTGTCATCGTCATCCTTGT AATCGATGTCATGATCTTTATAATCACCGTCATGGTC TTTGTAGTCAACTTTTTGGGAAATAATTTCTACTAA-3', and cloned between the Hind III and EcoR I sites of pcDNA3.1/Zeo(+) (Invitrogen).
Over-expression and purification of human mitochondrial proteins
HMRF1/pETDuet-1 or HMRF1L/pET15b was transformed into E. coli Rosetta(DE3)pLysS (Novagen) for the expression of HMRF1 and HMRF1L, respectively. Cultures were induced with 100 µM isopropyl-1-thio-D-galactopyranoside (IPTG) at 18 °C overnight. Proteins were purified to homogeneity by sequential Ni–NTA (Qiagen, Venlo, the Netherlands) and Q-sepharose HP column chromatographies (GE healthcare. Little Chalfont, UK). Proteins were concentrated up to 5 mg/mL, and were divided into aliquots before being fast-frozen and stored at –70 °C.
Confocal fluorescence microscopy
HeLa cells were transfected with either HMRF1-3xFLAG/pcDNA3.1 or HMRF1L-3xFLAG/pcDNA3.1 using lipofectamine (Invitrogen). After transfection (24 h), cells were stained with MitoTracker CMXRos dye (Molecular Probes, Eugene, OR) at a final concentration of 100 nM for 15 min to visualize mitochondria. Subsequently, cells were fixed in PBS containing 4% (v/v) formaldehyde and stained with the following antibodies diluted in PBS containing 0.1% TritonX-100, 3% w/v bovine serum albumin and 0.5% (v/v) whole goat serum (ICN): mouse anti-FLAG M2 (Sigma; 1:2000), and anti-mouse IgG FITC (Sigma, St Louis, MO; 1 : 2000). The red fluorescence of the dye and the green fluorescence of FITC were simultaneously observed by confocal fluorescence microscopy (Leica TCS SP2).
Cellular fractionation and Western blot analysis
Cell fractionation was performed as described (Suzuki et al. 2007). Mitochondrial and cytosolic proteins (20 µg each for HMRF1, HMRF1L and bEF-Tumt, and 2.5 µg for β-actin) were separated on an SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. Subsequently, the proteins were detected by using antibodies against HMRF1 (1 : 1000), HMRF1L (1 : 1000), bEF-Tumt (1 : 1000) and β-actin (Sigma, 1 : 5000). Polyclonal antisera were generated in our laboratory by injecting rabbits with purified recombinant bEF-Tumt, HMRF1 and HMRF1L.
|
Endnote |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
|
Acknowledgements |
|---|
|
Footnotes |
|---|
* Correspondence: Email: nono{at}k.u-tokyo.ac.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresEndnoteReferences |
|---|
Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R. & Young, I.G. (1981) Sequence and organization of the human mitochondrial genome. Nature 290, 457–465.[CrossRef][Medline]
Antonicka, H., Sasarman, F., Kennaway, N.G. & Shoubridge, E.A. (2006) The molecular basis for tissue specificity of the oxidative phosphorylation deficiencies in patients with mutations in the mitochondrial translation factor EFG1. Hum. Mol. Genet. 15, 1835–1846.
Barrell, B.G., Bankier, A.T. & Drouin, J. (1979) A different genetic code in human mitochondria. Nature 282, 189–194.[CrossRef][Medline]
Bibb, M.J., Van Etten, R.A., Wright, C.T., Walberg, M.W. & Clayton, D.A. (1981) Sequence and gene organization of mouse mitochondrial DNA. Cell 26, 167–180.[CrossRef][Medline]
Bonnefond, L., Fender, A., Rudinger-Thirion, J., Giege, R., Florentz, C. & Sissler, M. (2005) Toward the full set of human mitochondrial aminoacyl–tRNA synthetases: characterization of AspRS and TyrRS. Biochemistry 44, 4805–4816.[CrossRef][Medline]
Bullard, J.M., Cai, Y.C., Demeler, B. & Spremulli, L.L. (1999) Expression and characterization of a human mitochondrial phenylalanyl–tRNA synthetase. J. Mol. Biol. 288, 567–577.[CrossRef][Medline]
Bullard, J.M., Cai, Y.C. & Spremulli, L.L. (2000) Expression and characterization of the human mitochondrial leucyl–tRNA synthetase. Biochim. Biophys. Acta 1490, 245–258.[Medline]
Cavdar Koc, E., Burkhart, W., Blackburn, K., Moseley, A. & Spremulli, L.L. (2001) The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present. J. Biol. Chem. 276, 19363–19374.
Chihara, T., Luginbuhl, D. & Luo, L. (2007) Cytoplasmic and mitochondrial protein translation in axonal and dendritic terminal arborization. Nat. Neurosci. 10, 828–837.[CrossRef][Medline]
Chrzanowska-Lightowlers, Z.M., Temperley, R.J., Smith, P.M., Seneca, S.H. & Lightowlers, R.N. (2004) Functional polypeptides can be synthesized from human mitochondrial transcripts lacking termination codons. Biochem. J. 377, 725–731.[Medline]
Craigen, W.J., Lee, C.C. & Caskey, C.T. (1990) Recent advances in peptide chain termination. Mol. Microbiol. 4, 861–865.[CrossRef][Medline]
Edvardson, S., Shaag, A., Kolesnikova, O., Gomori, J.M., Tarassov, I., Einbinder, T., Saada, A. & Elpeleg, O. (2007) Deleterious mutation in the mitochondrial arginyl–transfer RNA synthetase gene is associated with pontocerebellar hypoplasia. Am. J. Hum. Genet. 81, 857–862.[CrossRef][Medline]
Frolova, L., Le Goff, X., Zhouravleva, G., Davydova, E., Philippe, M. & Kisselev, L. (1996) Eukaryotic polypeptide chain release factor eRF3 is an eRF1- and ribosome-dependent guanosine triphosphatase. RNA 2, 334–341.[Abstract]
Frolova, L.Y., Tsivkovskii, R.Y., Sivolobova, G.F., Oparina, N.Y., Serpinsky, O.I., Blinov, V.M., Tatkov, S.I. & Kisselev, L.L. (1999) Mutations in the highly conserved GGQ motif of class 1 polypeptide release factors abolish ability of human eRF1 to trigger peptidyl–tRNA hydrolysis. RNA 5, 1014–1020.[Abstract]
Hengartner, M.O. (2000) The biochemistry of apoptosis. Nature 407, 770–776.[CrossRef][Medline]
Ito, K., Ebihara, K., Uno, M. & Nakamura, Y. (1996) Conserved motifs in prokaryotic and eukaryotic polypeptide release factors: tRNA-protein mimicry hypothesis. Proc. Natl. Acad. Sci. USA 93, 5443–5448.
Ito, K. & Nakamura, Y. (1997) Cloning and overexpression of polypeptide release factor 1 of Thermus thermophilus. Biochimie 79, 287–792.[Medline]
Ito, K., Uno, M. & Nakamura, Y. (2000) A tripeptide "anticodon" deciphers stop codons in messenger RNA. Nature 403, 680–684.[CrossRef][Medline]
Jacobs, H.T. (2003) Disorders of mitochondrial protein synthesis. Hum. Mol. Genet. 12, 293R–301R.
Jacobs, H.T. & Turnbull, D.M. (2005) Nuclear genes and mitochondrial translation: a new class of genetic disease. Trends Genet. 21, 312–314.[CrossRef][Medline]
Janosi, L., Mottagui-Tabar, S., Isaksson, L.A., Sekine, Y., Ohtsubo, E., Zhang, S., Goon, S., Nelken, S., Shuda, M. & Kaji, A. (1998) Evidence for in vivo ribosome recycling, the fourth step in protein biosynthesis. EMBO J. 17, 1141–1151.[CrossRef][Medline]
Janosi, L., Shimizu, I. & Kaji, A. (1994) Ribosome recycling factor (ribosome releasing factor) is essential for bacterial growth. Proc. Natl. Acad. Sci. USA 91, 4249–4253.
Jesina, P., Tesarova, M., Fornuskova, D., Vojtiskova, A., Pecina, P., Kaplanova, V., Hansikova, H., Zeman, J. & Houstek, J. (2004) Diminished synthesis of subunit a (ATP6) and altered function of ATP synthase and cytochrome c oxidase due to the mtDNA 2 bp microdeletion of TA at positions 9205 and 9206. Biochem. J. 383, 561–571.[CrossRef][Medline]
Koc, E.C., Burkhart, W., Blackburn, K., Moyer, M.B., Schlatzer, D.M., Moseley, A. & Spremulli, L.L. (2001) The large subunit of the mammalian mitochondrial ribosome. Analysis of the complement of ribosomal proteins present. J. Biol. Chem. 276, 43958–43969.
Koike, K., Kobayashi, M., Yaginuma, K., Taira, M., Yoshida, E. & Imai, M. (1982) Nucleotide sequence and evolution of the rat mitochondrial cytochrome b gene containing the ochre termination codon. Gene 20, 177–185.[CrossRef][Medline]
Lee, C., Timms, K., Trotman, C. & Tate, W. (1987) Isolation of a rat mitochondrial release factor. Accommodation of the changed genetic code for termination. J. Biol. Chem. 262, 3548–3552.
Liu, M. & Spremulli, L. (2000) Interaction of mammalian mitochondrial ribosomes with the inner membrane. J. Biol. Chem. 275, 29400–29406.
Maraganore, D.M., de Andrade, M., Lesnick, T.G., Strain, K.J., Farrer, M.J., Rocca, W.A., Pant, P.V., Frazer, K.A., Cox, D.R. & Ballinger, D.G. (2005) High-resolution whole-genome association study of Parkinson disease. Am. J. Hum. Genet. 77, 685–693.[CrossRef][Medline]
Miller, C., Saada, A., Shaul, N., Shabtai, N., Ben-Shalom, E., Shaag, A., Hershkovitz, E. & Elpeleg, O. (2004) Defective mitochondrial translation caused by a ribosomal protein (MRPS16) mutation. Ann. Neurol. 56, 734–738.[CrossRef][Medline]
Nakamura, Y., Ito, K. & Ehrenberg, M. (2000) Mimicry grasps reality in translation termination. Cell 101, 349–352.[CrossRef][Medline]
Nakamura, Y., Ito, K. & Isaksson, L.A. (1996) Emerging understanding of translation termination. Cell 87, 147–150.[CrossRef][Medline]
O’Brien, T.W., Fiesler, S.E., Denslow, N.D., Thiede, B., Wittmann-Liebold, B., Mougey, E.B., Sylvester, J.E. & Graack, H.R. (1999) Mammalian mitochondrial ribosomal proteins (2). Amino acid sequencing, characterization, and identification of corresponding gene sequences. J. Biol. Chem. 274, 36043–36051.
O’Brien, T.W., Liu, J., Sylvester, J.E., Mougey, E.B., Fischel-Ghodsian, N., Thiede, B., Wittmann-Liebold, B. & Graack, H.R. (2000) Mammalian mitochondrial ribosomal proteins (4). Amino acid sequencing, characterization, and identification of corresponding gene sequences. J. Biol. Chem. 275, 18153–18159.
Papapetropoulos, S., Ffrench-Mullen, J., McCorquodale, D., Qin, Y., Pablo, J. & Mash, D.C. (2006) Multiregional gene expression profiling identifies MRPS6 as a possible candidate gene for Parkinson's disease. Gene Expr. 13, 205–215.[CrossRef][Medline]
Pepe, G., Holtrop, M., Gadaleta, G., Kroon, A.M., Cantatore, P., Gallerani, R., De Benedetto, C., Quagliariello, C., Sbisa, E. & Saccone, C. (1983) Non-random patterns of nucleotide substitutions and codon strategy in the mammalian mitochondrial genes coding for identified and unidentified reading frames. Biochem. Int. 6, 553–563.[Medline]
Saada, A., Shaag, A., Arnon, S., Dolfin, T., Miller, C., Fuchs-Telem, D., Lombes, A. & Elpeleg, O. (2007) Antenatal mitochondrial disease caused by mitochondrial ribosomal protein (MRPS22) mutation. J. Med. Genet. 44, 784–786.
Scheffler, I. (1999) Mitochondria. New York: Wiley-Liss, Inc.
Scheper, G.C., van der Klok, T., van Andel, R.J., et al. (2007a) Mitochondrial aspartyl–tRNA synthetase deficiency causes leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation. Nat. Genet. 39, 534–539.[CrossRef][Medline]
Scheper, G.C., van der Knaap, M.S. & Proud, C.G. (2007b) Translation matters: protein synthesis defects in inherited disease. Nat. Rev. Genet. 8, 711–723.[CrossRef][Medline]
Seit-Nebi, A., Frolova, L., Justesen, J. & Kisselev, L. (2001) Class-1 translation termination factors: invariant GGQ minidomain is essential for release activity and ribosome binding but not for stop codon recognition. Nucleic Acids Res. 29, 3982–3987.
Shimizu, Y., Inoue, A., Tomari, Y., Suzuki, T., Yokogawa, T., Nishikawa, K. & Ueda, T. (2001) Cell-free translation reconstituted with purified components. Nat. Biotechnol. 19, 751–755.[CrossRef][Medline]
Shoubridge, E.A. & Sasarman, F. (2007) Mitochondrial translation and human disease. In: Translational Control in Biology and Medicine (eds M.B. Mathews, N. Sonenberg & J.W. Hershey), pp. 775–801, New York: Cold Spring Harbor Laboratory Press.
Smeitink, J.A., Elpeleg, O., Antonicka, H., et al. (2006) Distinct clinical phenotypes associated with a mutation in the mitochondrial translation elongation factor EFTs. Am. J. Hum. Genet. 79, 869–877.[CrossRef][Medline]
Smits, P., Smeitink, J.A., van den Heuvel, L.P., Huynen, M.A. & Ettema, T.J. (2007) Reconstructing the evolution of the mitochondrial ribosomal proteome. Nucleic Acids Res. 35, 4686–4703.
Soleimanpour-Lichaei, H.R., Kuhl, I., Gaisne, M., Passos, J.F., Wydro, M., Rorbach, J., Temperley, R., Bonnefoy, N., Tate, W., Lightowlers, R. & Chrzanowska-Lightowlers, Z. (2007) mtRF1a is a human mitochondrial translation release factor decoding the major termination codons UAA and UAG. Mol. Cell 27, 745–757.[CrossRef][Medline]
Spencer, A.C., Heck, A., Takeuchi, N., Watanabe, K. & Spremulli, L.L. (2004) Characterization of the human mitochondrial methionyl–tRNA synthetase. Biochemistry 43, 9743–9754.[CrossRef][Medline]
Spremulli, L.L., Coursey, A., Navratil, T. & Hunter, S.E. (2004) Initiation and elongation factors in mammalian mitochondrial protein biosynthesis. In: Progress in Nucleic Acid Research and Molecular Biology, Vol. 77 (ed. K. Moldave), pp. 211–261, New York: Academic Press.
Stansfield, I., Jones, K.M. & Tuite, M.F. (1995) The end in sight: terminating translation in eukaryotes. Trends Biochem. Sci. 20, 489–491.[CrossRef][Medline]
Suzuki, H., Ueda, T., Taguchi, H. & Takeuchi, N. (2007) Chaperone properties of mammalian mitochondrial translation elongation factor Tu. J. Biol. Chem. 282, 4076–4084.
Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A. & Watanabe, K. (2001a) Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28 S small subunit. J. Biol. Chem. 276, 33181–33195.
Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A. & Watanabe, K. (2001b) Structural compensation for the deficit of rRNA with proteins in the mammalian mitochondrial ribosome. Systematic analysis of protein components of the large ribosomal subunit from mammalian mitochondria. J. Biol. Chem. 276, 21724–21736.
Takeuchi, N., Kawakami, M., Omori, A., Ueda, T., Spremulli, L.L. & Watanabe, K. (1998) Mammalian mitochondrial methionyl–tRNA transformylase from bovine liver. Purification, characterization, and gene structure. J. Biol. Chem 273, 15085–15090.
Takeuchi, N. & Ueda, T. (2003) Down-regulation of the mitochondrial translation system during terminal differentiation of HL-60 cells by 12-O-tetradecanoyl-1-phorbol-13-acetate: comparison with the cytoplasmic translation system. J. Biol. Chem. 278, 45318–45324.
Tate, W.P. & Brown, C.M. (1992) Translational termination: "stop" for protein synthesis or "pause" for regulation of gene expression. Biochemistry 31, 2443–2450.[CrossRef][Medline]
Temperley, R.J., Seneca, S.H., Tonska, K., Bartnik, E., Bindoff, L.A., Lightowlers, R.N. & Chrzanowska-Lightowlers, Z.M. (2003) Investigation of a pathogenic mtDNA microdeletion reveals a translation-dependent deadenylation decay pathway in human mitochondria. Hum. Mol. Genet. 12, 2341–2348.
Tolkunova, E., Park, H., Xia, J., King, M.P. & Davidson, E. (2000) The human lysyl–tRNA synthetase gene encodes both the cytoplasmic and mitochondrial enzymes by means of an unusual alternative splicing of the primary transcript. J. Biol. Chem. 275, 35063–35069.
Valente, L., Tiranti, V., Marsano, R.M., Malfatti, E., Fernandez-Vizarra, E., Donnini, C., Mereghetti, P., De Gioia, L., Burlina, A., Castellan, C., Comi, G.P., Savasta, S., Ferrero, I. & Zeviani, M. (2007) Infantile encephalopathy and defective mitochondrial DNA translation in patients with mutations of mitochondrial elongation factors EFG1 and EFTu. Am. J. Hum. Genet. 80, 44–58.[CrossRef][Medline]
Yokogawa, T., Shimada, N., Takeuchi, N., Benkowski, L., Suzuki, T., Omori, A., Ueda, T., Nishikawa, K., Spremulli, L.L. & Watanabe, K. (2000) Characterization and tRNA recognition of mammalian mitochondrial seryl–tRNA synthetase. J. Biol. Chem. 275, 19913–19920.
Zhang, Y. & Spremulli, L.L. (1998) Identification and cloning of human mitochondrial translational release factor 1 and the ribosome recycling factor. Biochim. Biophys. Acta 1443, 245–250.
Accepted: 27 January 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
