GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2008) 13, 787-796. doi:10.1111/j.1365-2443.2008.01205.x
© 2008 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sihn, C.-R.
Right arrow Articles by Kim, S. H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sihn, C.-R.
Right arrow Articles by Kim, S. H.

CANu1, a novel nucleolar protein, accumulated on centromere in response to DNA damage

 Choong-Ryoul Sihn1, Yeon-Su Lee2,a, Jin-Sook Jeong3, Kyunghee Park2 and Sang Hoon Kim1,*

1 Department of Biology, Kyung Hee University, Seoul 130-701, Korea
2 Bio Lab, Samsung Advanced Institute of Technology, San14 Nongseo-ri, Giheung-eup Yongin-si, Kyoungki-do, Korea
3 Department of Pathology, Medical Center for Cancer Molecular Therapy, College of Medicine, Dong-A University, Busan, Korea


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Single nucleotide polymorphism is known to be an ideal marker to detect human diseases. We isolated a novel human gene, to be called as CANu1, by the large-scale genome-wide association analysis to screen specific Single nucleotide polymorphisms in colon cancer. It is mapped to chromosome 14q11.2 and its transcript contains a 948-nt open reading frame encoding a protein of 315 aa. Here, we observed that green fluorescence protein (GFP)-fused CANu1 protein was localized to nucleoli and the C-termini of CANu1 protein were essential for its localization. Moreover, the silencing of the CANu1 gene by siRNA caused ribosomal stress leading to G1 cell cycle arrest, the induction of p53 protein, and the translocation of B23 protein. In addition, CANu1 protein was translocated from nucleolus to nuclear foci in response to UV damage. Interestingly, the mobility of a GFP-CANu1 protein in the UV damaged cells was two times faster than non-irradiated cells. Taken together, we report that a novel nucleolar protein, CANu1, is essential to maintain ribosomal structure and responsive upon UV damage.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Nucleolus is a nuclear sub-compartment which is involved in ribosomal RNA biogenesis. The nucleolus is rapidly generated by RNA polymerase I from the nucleolar organizing regions (NORs), 300–400 copies of tandemly arrayed rRNA genes located in the five acrocentric chromosome (Carmo-Fonseca et al. 2000). The fibrillar center containing NORs is surrounded by a dense fibrillar component where rRNA genes are actively transcribing. In the nucleolus, rRNA transcripts are processed and modified for assembling with ribosomal proteins to form ribosomes (Lamond & Earnshaw 1998). However, many proteins that exist in the nucleolus have other functions such as exporting nuclear proteins, sequestering regulatory molecules, modifying small RNAs, assembling ribonucleoprotein and controlling aging (Olson et al. 2000; Leung et al. 2003). Proteomic studies of the nucleolus isolated from HeLa cell report that 692 proteins identified are in a variety of functional categories (Scherl et al. 2002; Leung et al. 2003; Andersen et al. 2005). Interestingly, 126 proteins among them are known as novel proteins, suggesting that the nucleolus has potential roles in many cellular functions besides ribosome biogenesis (Leung et al. 2003).

Many nucleolar proteins change their localizations in response to numerous cellular stresses (Chang et al. 1999; Blander et al. 2002; Gao et al. 2003; Rubbi & Milner 2003; Al-Baker et al. 2004). Under stress conditions, the nucleolus is disrupted and ARF is released inhibiting HDM2 which is a negative regulator of p53 for proteasome-dependent degradation (Olson 2004). In addition, the nucleolar proteins, nucleophosmin/B23 and nucleolin/C23, are also distributed to the nucleoplasm from the nucleolus under many sorts of stresses (Daniely et al. 2002; Kurki et al. 2004b). In response to stresses, nucleophosmin/B23 acts as the negative regulator of the p53-HDM2 complex (Kurki et al. 2004b) and nucleolin/C23 is associated with p53 for replication inhibition and DNA repair (Daniely et al. 2002).

The nucleolus has a wide range of functional categories inferred from the fact that nucleolar proteins possess a diversity of kinetics as well as a transient structure for the production of rRNA synthesis (Kurki et al. 2004a). In the present study, we report a novel nucleolar protein which has a role in the maintenance of ribosomal structure and the damage-response activity.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Isolation of the CANu1 gene

In the previous study, we performed a large-scale genome-wide association analysis to screen specific markers in colon cancer and found significant single nucleotide polymorphisms in c14orf120 gene region at chromosome 14q11.2 (data not shown). The sequence of c14orf120 cDNA was already registered in NCBI (GENBANK accession no. BC030817 [GenBank] ) and classified as a full-length cDNA encoding 315 aa (Strausberg et al. 2002). By in silico analysis, we found that the c14orf120 gene has a conserved protein sequence among species (Fig. 1A) and showed 88.9% and 86.1% homology with Mus musculus in amino acid and DNA sequence respectively. In addition, the c14orf120 protein contains the putative Sas10/Utp3 domain at the N-terminus region (9–107 aa) (Fig. 1B). Although the function of this domain is still unknown, yeast Sas10/Utp protein having a Sas10/Utp3 domain is known as a regulator of chromatin silencing (Kamakaka & Rine 1998) and a component of U3 ribonucleoprotein complex involved in 18S ribosomal RNA biogenesis (Dragon et al. 2002). In the present study, we found that the c14orf120 gene was localized in the centromere in response to DNA damage, so we propose this gene to be called as centromere accumulated nuclear protein 1 (CANu1) in this study.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

  		Figure 1  Highly conservated human CANu1 protein in Eukaryota. (A) ClustalW mutilple alignment of the deduced amino acid sequences from human c14orf120 (accession no. BC030817 [GenBank] ) and other specie's homologous sequences (accession no. NP081166, XP224181, NP608956, NP491806 and NP973785, respectively). Identical residues are shade of black and conserved substitutions are shade of gray. The numbers of right side represent the length of each sequence. (B) This scheme depicts CANu1 domain analyzed by conserved domain database (CDD) from NCBI. The numbers above the schematic structure indicate the length of the amino acids.

 
Expression pattern of CANu1 gene in cell lines and tissues

We performed PCR with the multiple tissue cDNA assay to investigate the expression pattern of CANu1 in normal human tissues. CANu1 mRNA was expressed in liver, placenta and pancreas (Fig. 2A). By northern blot analysis, CANu1 mRNA was expressed strongly in Gli3 cells, whereas Hep1 hepatoma cells had a very weak signal (Fig. 2B). In addition, CANu1 mRNA showed only a band at 1.2 kb without alternative splicing (Fig. 2B). To observe the localization of CANu1 in human skin tissue, we performed immunohistochemical assay. As shown in Fig. 2C, the signal of CANu1 localized densely as spots within nucleus. This pattern is very similar to nucleoli staining.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

  		Figure 2  The expression pattern of CANu1 in cell lines and tissues. (A) RT-PCR analysis for CANu1 was performed. GAPDH was used as a control. (B) Northern blot analysis of CANu1. RNA was isolated from human cancer cell lines and loaded in 1% formaldehyde–agarose gels. Membrane was hybridized with a CANu1 probe and developed using a Molecular Imager FX imaging system. RNA markers are provided at the right. Human β-actin was used as a loading control. (C) The distribution of CANu1 protein in human dorsal skin was analyzed by immunohistochemistry. Arrow head indicates nucleolus.

 
Intracellular localization of CANu1 protein in U2OS cells

The cellular localization of a certain protein could provide useful information for deducing protein function (Hoja et al. 2000). We observed the intracellular localization pattern of CANu1 protein in cells with the plasmid encoding a fusion GFP-CANu1 protein. As shown in Fig. 3A, GFP-CANu1 protein was localized in nucleolus. Nucleolin/C23 protein was used as a nucleolar marker. This result consists with other studies reporting that c14orf120 belongs to nucleoli protein by proteomic analysis (Andersen et al. 2005; Hinsby et al. 2006). These results indicate that CANu1 is a nucleolar protein and GFP-CANu1 fusion protein shows similar pattern to endogenous protein.


Figure 3
View larger version (17K):
[in this window]
[in a new window]

  		Figure 3  The subcellular localization of CANu1 protein in U2OS cells. (A) U2OS cells were transfected with the pEGFPC1-CANu1 plasmid and were stained by TRITC-conjugated {alpha}-nucleolin/C23 antibody to visualize nucleoli. DNA was stained by DAPI. (B) U2OS cells were transiently transfected with plasmids containing CANu1 fragments fused with GFP. Diagram of GFP-CANu1 truncated constructs and their nucleolar localizations were presented as (+), localized; (–), not localized. Black box indicates Sas10/Utp3 domain and dark grey box indicates GFP.

 
To determine the region of CANu1 protein required for nucleolar localization, truncated CANu1 mutants were constructed. Each fragment protein was fused with GFP for identifying its cellular localization. Because yeast Sas10/Utp3 protein has nucleolar localization, we expected that the N-terminus fragment (GFP-CANu1{Delta}C) including a Sas10/Utp3 motif was also localized to the nucleolus. However, Sas10/Utp3 domain-deleted mutant (CANu1{Delta}N) was continuously kept in the nucleolus, whereas CANu1{Delta}C mutant having only the Sas10/Utp3 domain was not localized in the nucleus (Fig. 3B). The C-terminus of CANu1 has many lysine and arginine residues, so this region may have putative NLS motif. These results suggest that the nucleolar localization signal could be embedded in the C-terminus of CANu1 protein outside the Sas10/Utp3 domain.

Ribosomal stress by the knock-down of CANu1 gene

A large portion of nucleolar proteins was identified by proteomic techniques, of which approximately 30% were uncharacterized. Andersen et al. (2005) assigned the uncharacterized nucleolar proteins to functional protein complexes of the human nucleolome based on the data from mRNA co-expression, protein interaction reproducibility, and nucleolus protein dynamics. Interestingly, we could find a CANu1 protein in the list of the ribosome biogenesis (mostly pre-40S) complex in the database, suggesting that it may be involved in exporting pre-40S ribosome. Generally, the impaired nucleolar proteins involved in ribosome biogenesis induce ribosomal stress leading to cell death by p53 activation (Pestov et al. 2001; Choesmel et al. 2007). We wonder whether the knock-down of CANu1 causes ribosomal stress to cells, as it is sorted in pre-40S ribosome complex. As a result, the knock-down of CANu1 gene expression by siRNA induced the G1 cell cycle arrest and the elevated level of both p53 and p21 protein expression (Fig. 4A,B). In addition, we tested the localization of B23 in CANu1-depleted cells, because the translocation of B23 protein has been known as a ribosomal stress marker in damaged cells. Interestingly, nucleolar GFP-fused B23 proteins had reduced nucleolar localization and showed shrinkage nucleolar morphology in cells transfected with CANu1 siRNAs (Fig. 4C). These results suggest that the knock-down of CANu1 gene expression leads to ribosomal stress in cells.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		Figure 4  Knock-down of CANu1 gene in U2OS cells by siRNAs. (A) U2OS cells were transfected with CANu1 siRNAs and scrambled siRNA (as a control). After 72 h, cells were fixed and were analyzed by flow cytometry to determine cell cycle stages. (B) siRNA-delivered cells were harvested and lysed for SDS-PAGE analysis. Samples were loaded to SDS-PAGE gel and analyzed by indicated antibodies. (C) Cells were delivered siRNAs. After 48 h, siRNA treated-cells were allowed expression of GFP-B23. These cells were fixed and observed by fluorescence microscopy.

 
Translocation of CANu1 protein in response to UV damage

Since many nucleolar proteins have been known to alter their subcellular localization by cellular stress (Chang et al. 1999; Blander et al. 2002; Gao et al. 2003; Rubbi & Milner, 2003; Al-Baker et al. 2004), we determined whether CANu1 protein could be redistributed in DNA damaged cells. U2OS cells expressing the GFP-CANu1 protein were irradiated by UV (40 J/m2) and then observed. As shown in Fig. 5A, the GFP-CANu1 protein was translocated from nucleolus to nucleoplasm and formed nuclear foci in cells exposed to UV. The translocation pattern of the GFP-CANu1 protein is reminiscent of the damage-induced translocation of WRN protein (Blander et al. 2002). However, cells expressing the GFP-CANu1{Delta}N protein, Sas10/Utp3 domain deleted mutant, did not form nuclear foci under UV irradiation (data not shown). These results support that the formation of nuclear foci is Sas10/Utp3 domain-dependent.


Figure 5
View larger version (37K):
[in this window]
[in a new window]

  		Figure 5  Translocation of CANu1 protein in DNA damaged-cells. (A) Cells expressing GFP-B23, GFP-CANu1 and its deletion mutants were irradiated by UV (40 J/m2). Six hours later, these samples were fixed and stained by DAPI. The patterns of localization were observed by fluorescence microscopy. (B) Under UV stress, GFP-CANu1 and HP1{alpha}-DsRed expressing cells were observed by confocal microscopy (left column). For HP1β-DsRed, same experiment was conducted as HP1{alpha}-DsRed accomplished (right column). (C) Cells expressing GFP-CANu1 protein were irradiated by UV. After 6 h, cells were stained by Cy3-conjugated {alpha}-CREST antibody as a centromere marker.

 
In order to characterize the nuclear foci of the damage-induced CANu1 protein, the signal of CANu1 protein was co-stained with several marker proteins for nuclear foci. After UV damage the foci induced by GFP-CANu1 protein was partially co-localized with the HP1{alpha} and HP1β-DsRed proteins (Fig. 5B). In addition, the localization of GFP-CANu1 foci was consistent with CREST antisera, a marker for centromeres (Fig. 5C). These results suggest that the GFP-CANu1 protein may associate with pericentromeric regions in cells in response to UV damage.

In order to define the upstream pathway for the translocation of CANu1 protein, we tested several known pathways involved in the induction of nucleolar protein dispersion. In our results, the translocation of CANu1 was independent for JNK2, ATM/ATR and Chk2 pathways (Fig. 6). CANu1 may have alternative pathway to be nucleoplasmic distribution in cells in response to UV.


Figure 6
View larger version (34K):
[in this window]
[in a new window]

  		Figure 6  The translocation of CANu1 protein in U2OS cells in response to DNA damage agents. GFP-CANu1 expressing cells were treated with SP600125 as a JNK2 inhibitor or caffeine followed by UVC (254 nm, 40 J/m2) or actinomycin D, respectively. Cells were observed by fluorescence microscopy.

 
Mobility change of CANu1 determined by fluorescence recovery after photobleaching (FRAP)

We next analyzed the relevance of CANu1 mobility in the formation of the damage-induced foci in living cells. The FRAP assay was performed with the GFP-CANu1 plasmids. The mobility of GFP-CANu1 in UV-damaged cells was enhanced by 2-times compared to that of control cells (Fig. 7A,B). In contrast, the mobility of GFP-CANu1{Delta}N protein did not changed under UV damage (data not shown). Taken together, the mobility of CANu1 protein in U2OS cells was enhanced by UV damage and the Sas10/Utp3 domain of CANu1 was required for both the formation of nuclei foci and protein mobility under UV stress.


Figure 7
View larger version (29K):
[in this window]
[in a new window]

  		Figure 7  FRAP analysis of GFP-CANu1 (A) GFP-CANu1 expressing cell lines were irradiated by UV. After 6 h, cells were bleached at ROI (region of interest) and captured image at indicated time intervals. Non-irradiated UV cells were used as a control. White circles indicate ROI. (B) Quantitation of FRAP analysis of GFP-CANu1 exchange in ROI after UV irradiation. Green squares represent the bleaching length (about 1 s).

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
When cells are exposed to various types of stress, nucleolar disassembly occurs by stalling RNA pol I. However, the translocation of nucleolar proteins does not depend on nucleolar disassembly. Several nucleolar proteins such as topoisomerase I and nucleolin/C23 protein are induced to translocalize via a p53-dependent pathway under stress (Gao et al. 2003; Rubbi & Milner 2003; Al-Baker et al. 2004; Kurki et al. 2004b), whereas other nucleolar proteins are induced in a p53-independent manner. Nucleolar TIF-IA, an essential transcriptional factor for RNA pol I, is translocated by c-Jun N-terminal kinase 2 (JNK2) under stress (Mayer & Grummt 2005). These reports indicate that different dependency in the translocation of nucleolar proteins may attribute to perform various functional category including DNA repair, cell cycle regulation, etc. After the treatment of nucleolar harmful drugs such as actinomycin D, endogenous levels of C14orf120 gene are decreased in the nucleolus (Andersen et al. 2005). It is consistent with our result that CANu1 protein was released from the nucleolus under UV stress. A recent study reports that the mouse homolog of CANu1, Neuroguidin (Ngd), binds eukaryotic initiation factor 4E (eIF4E) as a regulator of neural development for the translation of cytoplasmic polyadenylation element-containing mRNA (Jung et al. 2006). In neuron cells, Ngd proteins are located in both axons and dendrites (Jung et al. 2006). Notably, N-terminal Ngd is highly conserved in various species and overlaps with the Sas10/Utp3 domain, by having three eIF4E binding regions. Interestingly, eIF4E is co-localized with PML bodies and forms nuclear foci in the nucleus. In our results, the Sas10/Utp3 domain is also essential to form nuclear foci in response to damages. It is implicated that eIF4E may support the assembly site to form the nuclear foci in cells. Therefore, a further study will be focused on the relationship between eIF4E and CANu1 under stress.

Centromeres are made up histone proteins and other component proteins. Centromeric heterochromatin lies on the flank region of centromeres termed the pericentromeric region and is essential for centromere formation (Amor et al. 2004). The exposure of human cells to DNA-damaging agents induces pairing of the homologous paracentromeric heterochromatin dependent on DNA repair (Abdel-Halim et al. 2005, 2006). The heterochromatin protein 1 (HP1) family is localized at centromeric heterochromatin to maintain its structure (Sugimoto et al. 2001; Hayakawa et al. 2003; Maison & Almouzni 2004). HP1 family belongs to non-histone proteins consisting of three type forms, HP1{alpha}, HP1β and HP1{gamma} in human (Maison & Almouzni 2004). In our study, the foci-induced by GFP-CANu1 protein was partially co-localized with the HP1{alpha} and HP1β-DsRed proteins. HP1{alpha} and HP1{gamma} are primarily localized at PML nuclear bodies and HP1β is mainly localized at centromeres during interphase (Hayakawa et al. 2003). These results suggest that the GFP-CANu1 protein may associate with the pairing of the homologous paracentromeric heterochromatin dependent on DNA repair.

We also demonstrated that the Sas10/Utp3 domain of CANu1 is essential for the formation of nuclear foci and the alteration of mobility. In yeast, Sas10/Utp3 protein was localized in the nucleolus (Dragon et al. 2002) and induced the derepression of HMR and HML genes when over-expressed (Kamakaka & Rine 1998). In contrast, when Sas10/Utp3 gene is repressed, cells are arrested at late S or G2/M phases with the abnormal nuclear morphology (Kamakaka & Rine 1998). Based on these results, yeast Sas10/Utp3 protein regulates the acetylation state at silenced region or the higher-order chromatin structure to regulate on–off state of gene (Kamakaka & Rine 1998). Therefore, CANu1 performs as a higher-order chromatin structure regulator by accumulating at centromeric heterochromatin using Sas10/Utp3 domain under stress.

In conclusion, our studies provide several evidences that CANu1 protein is a novel nucleolar protein to be accumulated at nuclear foci upon damages.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Cell culture and transfection

Human osteosarcoma U2OS cells were cultured in Dulbecco's modified medium supplemented with 10% fetal bovine serum, and incubated in a humidified incubator at 37 °C with 5% CO2. U2OS cells were grown on 35 mm dishes with coverslip and were transfected by using ExGen500 reagent (MBI Fermentas, Hanover, MD) by following the manufacturer's instructions. At 24 h post-transfection, cells were irradiated with UVC (ULTRA-LUM; 254 nm, 40 J/m2). To block ATM/ATR and JNK2 pathway, cells were treated with caffeine (2 mM for 1 h) and SP600125 (5 µM for 30 min) respectively in prior to the treatment of the stress. To suppress the mRNA level of the CANu1, we obtained short-interfering RNA (siRNA) against CANu1 (target sequence: TCCCAGCAATATGATGAGCAA) and scrambled siRNA (cat. no.: 1027281) from Qiagen (Santa Clarita, CA). At 24 h after plating the cells were transfected by Oligofectin transfection reagent (Invitrogen Life Technologies, Carlsbad, CA), following the manufacturer's instructions.

Cloning of CANu1 cDNA

To obtain the full length of human CANu1 cDNA, total RNA was isolated with Trizol reagent (Invitrogen Life Technologies). Total RNA was reacted with oligo(dT) primer and MMLV reverse transcriptase (TaKaRa, Bio Inc., Shiga, Japan) at 42 °C for 60 min. To generate EGFP-CANu1, EGFP-CANu1{Delta}N, GFP-B23, B23-DsRed, HP1{alpha}-DsRed and HP1β-DsRed constructs, cDNAs were amplified by PCR using the CANu1 (forward: 5'-atggcg gcgctgggggtg-3' and reverse: 5'-tcaccgccgcctccgaaa-3'), B23 (forward: 5'-atggaagattcgatggac-3' and reverse: 5'-aagagacttcctccactg-3'), HP1{alpha} (forward: 5'-atgggaaagaaaaccaagcg-3' and reward: 5'-ttagctcttt gctgtttctt-3') and HP1β (forward: 5'-atggggaaaaaacaaaacaag-3' and reward: 5'-ttagttcttgtcatctttttt-3') primers and then were TA-cloned (Promega, Madison, WI). After amplification by using specific primers to generate enzyme sites, PCR products were digested by appropriate enzymes. Digested products were cloned into pEGFPC1 (BD Biosciences, Palo Alto, CA) or pDsRed2N1 plasmids (BD Biosciences). All clones were confirmed by DNA sequencing.

Immunofluorescence microscopy

U2OS cells expressing GFP-CANu1 fusion protein or HP1-DsRed constructs were cultured on coverslips for 24 h and were irradiated by UV (40 J/m2). Six hours later, cells were fixed with 4% paraformaldehyde for 15 min and washed three times with PBS. After blocking with 10% horse serum, coverslips were incubated with primary antibodies at a 1 : 250 dilution ({alpha}-CREST and {alpha}-{gamma}H2AX) in a humidified chamber for 1 h. After washing with PBS containing 0.1% NP-40, samples were incubated with secondary antibodies conjugated to Cy-3 or TRITC (Sigma-Aldrich, Saint Louis, MO) at a dilution of 1 : 100 in PBS (0.1% NP-40) for 45 min. Cells were stained by DAPI (0.1 µg/mL) for 5 min to detect nuclei. We used a nucleolin/C23 primary antibody (1 : 20 dilution, Santa Cruz Biotechnology, Santa Cruz, CA) with TRITC-conjugated secondary antibody (1 : 150 dilution) to stain nucleoli. Samples were mounted and visualized using a LSM 510 microscope (Carl Zeiss, Oberkochen, Germany).

Northern blot and multiple tissue cDNA assay

Total RNA was isolated from several cell lines with the Trizol (Invitrogen Life Technologies) by following the manufacturer's instructions. For northern blot analysis, 10 µg of RNA was separated in 1% formaldehyde-agarose gels. Gels were transferred to nylon membranes and the RNA was fixed by UV-cross-linking. Membranes were prehybridized at 65 °C for 1 h in ExpressHyb buffer (BD Biosciences). cDNA probes for CANu1 full-length (948 bp) and β-actin were labeled by a random priming kit (Roche, Meylan, France) using [32P]-dCTP (3000 Ci/mmol) and Klenow DNA polymerase (Roche). Probes were purified, diluted in Rapid-Hyb buffer (BD Biosciences), and incubated with membranes for 3 h at 65 °C. After hybridization, membranes were washed with a buffer (1x SSC and 1% SDS). Membranes were exposed and developed using a Molecular Imager FX imaging system (Bio-Rad, Hercules, CA). To analyze the expression pattern of CANu1 in tissues, the human multiple tissue cDNA panel (BD Biosciences) was used. Human cDNAs were amplified by PCR using the CANu1 (forward: 5'-atggcggcgctgggggtg-3' and reverse: t caccgccgcctccgaaa-3') and GAPDH (forward: 5'-catcac catcttccaggagc-3', reverse: 5'-ccacctggtgctcagtgtag-3') primers. Amplification was carried out for 30 cycles. Cycling conditions were as follow: denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min and extension at 72 °C for 1 min. PCR products were visualized in 1% agarose gels stained with ethidium bromide.

Cell cycle analysis

Cells were incubated with siRNA (50 nM) for 72 h. Cells were fixed in ethanol, washed with PBS, and resuspended in PI staining buffer (100 µg/mL PI and 1 mg/mL RNAse). DNA content was evaluated by flow cytometry (Cytomics FC 500, Becton Dickinson, Miami, FL).

FRAP analysis

FRAP analysis was performed with a Zeiss LSM 510 inverted confocal laser scanning microscope equipped with an on-stage heating chamber. We determined the region of interest (ROI) from cells expressing GFP fused proteins. ROI was bleached with maximum laser power (488-nm, 6.5 mW) for 15 iterations. Subsequently, the recovery of fluorescence in the ROI was monitored at intervals of 500 ms with the same laser at 3% of the power applied for bleaching using a dichroic beam splitter (488/543 nm) and an additional 515–540 nm band pass filter for emission detection. Bleaching occurred after 5 pre-bleach images.

Antibody production

A glutathione S-transferase (GST)-tagged full-length CANu1 fusion protein was amplified in transformant bacteria (BL21) and purified using Glutathione Sepharose 4B (Peptron, Daejon, Korea). Purified GST-CANu1 proteins were injected into New Zealand White rabbits. Polyclonal antibodies obtained from the immunized rabbits were purified by affinity-purification with His6-CANu1 immobilized on nitrocellulose membrane.

Cell fraction and immunoblotting

U2OS cells were treated with siRNA (50 nM for 72 h) by Oligofectamin reagent (Invitrogen Life Technologies) and were lysed into NP-40 lysis buffer [50 mM Tris–HCl, 150 mM NaCl, 1% NP-40, 50 mM NaF, 200 µM Na3VO4, protease inhibitor cocktail tablets (Roche) and 0.1% SDS]. The concentrations of separated protein were determined by a Bio-Rad protein assay (Bio-Rad) and were normalized for SDS-PAGE analysis. Protein extracts were resolved by electrophoresis on SDS polyacrylamide gels. After electrophoretic transfer to nitrocellulose, reactive proteins were detected using antibodies specific against CANu1 (1 : 100 dilution), p53 (1 : 1000 dilution, Santa Cruz Biotechnology, sc-126) and p21 (1 : 500 dilution, Upstate, 05-345) with the ECL kit (Santa Cruz Biotechnology).

Immunohistochemistry

Resected skin tissue was processed through formalin-fixation and paraffin-embedding. The immunostaining was performed with DAKO EnVision Kit (DakoCytomation, Glostrup, Denmark). Briefly, tissue sections in 4 µm in thickness were dewaxed and rehydrated at graded alcohols. Endogenous peroxidase was blocked by dipping sections in 3% aqueous hydrogen peroxide for 10 min. Antigen retrieval was added for 10 min in microwave by treatment of 10 mmol/L citrate buffer, pH 6.0. Primary antibody for a mouse homolog of CANu1 NGDN (1 : 100 in dilution; Atlas Antibodies, Cleveland, OH) was treated for 1 h at room temperature. Next, the sections were incubated with EnVisionTM reagent (DakoCytomation), which is a peroxidase-conjugated polymer backbone, carrying secondary antibody molecules. The sections were lightly counterstained with hematoxylin. NGDN localized in nucleoli of epidermal keratinocytes.


   Acknowledgements
 
This work was supported by grants from the Basic Atomic Energy Research Institute of the Korean Science and Engineering Foundation and from Kyung Hee University.


   Footnotes
 
Communicated by: Eisuke Nishida

aPresent address: Research Institute, National Cancer Center, Gyeonggi-do Goyang-si 410-769, Republic of Korea. Back

* Correspondence: shkim{at}khu.ac.kr


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Abdel-Halim, H.I., Mullenders, L.H. & Boei, J.J. (2006) Pairing of heterochromatin in response to cellular stress. Exp. Cell Res. 312, 1961–1969.[CrossRef][Medline]

Abdel-Halim, H.I., Natarajan, A.T., Mullenders, L.H. & Boei, J.J. (2005) Mitomycin C-induced pairing of heterochromatin reflects initiation of DNA repair and chromatid exchange formation. J. Cell Sci. 118, 1757–1767.[Abstract/Free Full Text]

Al-Baker, E.A., Boyle, J., Harry, R. & Kill, I.R. (2004) A p53-independent pathway regulates nucleolar segregation and antigen translocation in response to DNA damage induced by UV irradiation. Exp. Cell Res. 292, 179–186.[CrossRef][Medline]

Amor, D.J., Kalitsis, P., Sumer, H. & Choo, K.H. (2004) Building the centromere: from foundation proteins to 3D organization. Trends Cell Biol. 14, 359–368.[CrossRef][Medline]

Andersen, J.S., Lam, Y.W., Leung, A.K., Ong, S.E., Lyon, C.E., Lamond, A.I. & Mann, M. (2005) Nucleolar proteome dynamics. Nature 433, 77–83.[CrossRef][Medline]

Blander, G., Zalle, N., Daniely, Y., Taplick, J., Gray, M.D. & Oren, M. (2002) DNA damage-induced translocation of the Werner helicase is regulated by acetylation. J. Biol. Chem. 277, 50934–50940.[Abstract/Free Full Text]

Carmo-Fonseca, M., Mendes-Soares, L. & Campos, I. (2000) To be or not to be in the nucleolus. Nat. Cell Biol. 2, E107–112.[CrossRef][Medline]

Chang, M.S., Sasaki, H., Campbell, M.S., Kraeft, S.K., Sutherland, R., Yang, C.Y., Liu, Y., Auclair, D., Hao, L., Sonoda, H., Ferland, L.H. & Chen, L.B. (1999) HRad17 colocalizes with NHP2L1 in the nucleolus and redistributes after UV irradiation. J. Biol. Chem. 274, 36544–36549.[Abstract/Free Full Text]

Choesmel, V., Bacqueville, D., Rouquette, J., Noaillac-Depeyre, J., Fribourg, S., Crétien, A., Leblanc, T., Tchernia, G., Da Costa, L. & Gleizes, P.E. (2007) Impaired ribosome biogenesis in Diamond-Blackfan anemia. Blood 109, 1275–1283.[Abstract/Free Full Text]

Daniely, Y., Dimitrova, D.D. & Borowiec, J.A. (2002) Stress-dependent nucleolin mobilization mediated by p53-nucleolin complex formation. Mol. Cell Biol. 22, 6014–6022.[Abstract/Free Full Text]

Dragon, F., Gallagher, J.E., Compagnone-Post, P.A., Mitchell, B.M., Porwancher, K.A., Wehner, K.A., Wormsley, S., Settlage, R.E., Shabanowitz, J., Osheim, Y., Beyer, A.L., Hunt, D.F. & Baserga, S.J. (2002) A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. Nature 417, 967–970.[CrossRef][Medline]

Gao, H., Chen, X.B. & McGowan, C.H. (2003) Mus81 endonuclease localizes to nucleoli and to regions of DNA damage in human S-phase cells. Mol. Biol. Cell 14, 4826–4834.[Abstract/Free Full Text]

Hayakawa, T., Haraguchi, T., Masumoto, H. & Hiraoka, Y. (2003) Cell cycle behavior of human HP1 subtypes: distinct molecular domains of HP1 are required for their centromeric localization during interphase and metaphase. J. Cell Sci. 116, 3327–3338.[Abstract/Free Full Text]

Hinsby, A.M., Kiemer L., Kaarlberg E.O., Lage K., Fausboll, A., Juncker A.S., Andersen J.S., Mann, M. & Brunak, S. (2006) A wiring of the human nucleolus. Mol. Cell 22, 285–295.[CrossRef][Medline]

Hoja, M.R., Wahlestedt, C. & Höög, C. (2000) A visual intracellular classification strategy for uncharacterized human proteins. Exp. Cell Res. 259, 239–246.[CrossRef][Medline]

Jung, M.Y., Lorenz, L. & Richter, J.D. (2006) Translational control by neuroguidin, a eukaryotic initiation factor 4E and CPEB binding protein. Mol. Cell Biol. 26, 4277–4287.[Abstract/Free Full Text]

Kamakaka, R.T. & Rine, J. (1998) Sir- and silencer-independent disruption of silencing in Saccharomyces by Sas10p. Genetics 149, 903–914.[Abstract/Free Full Text]

Kurki, S., Peltonen, K. & Laiho, M. (2004a) Nucleophosmin, HDM2 and p53: players in UV damage incited nucleolar stress response. Cell Cycle 3, 976–979.[Medline]

Kurki, S., Peltonen, K., Latonen, L., Kiviharju, T.M., Ojala, P.M., Meek, D. & Laiho M. (2004b) Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell 5, 465–475.[CrossRef][Medline]

Lamond, A.I. & Earnshaw, W.C. (1998) Structure and function in the nucleus. Science 280, 547–553.[Abstract/Free Full Text]

Leung, A.K., Andersen, J.S., Mann, M. & Lamond, A.I. (2003) Bioinformatic analysis of the nucleolus. Biochem. J. 376, 553–569.[CrossRef][Medline]

Maison, C. & Almouzni, G. (2004) HP1 and the dynamics of heterochromatin maintenance. Nat. Rev. Mol. Cell Biol. 5, 296–304.[CrossRef][Medline]

Mayer, C. & Grummt, I. (2005) Cellular stress and nucleolar function. Cell Cycle 4, 1036–1038.[Medline]

Olson, M.O. (2004) Sensing cellular stress: another new function for the nucleolus? Sci. STKE. 224, 10–11.

Olson, M.O., Dundr, M. & Szebeni, A. (2000) The nucleolus: an old factory with unexpected capabilities. Trends Cell Biol. 10, 189–196.[CrossRef][Medline]

Pestov, D.G., Strezoska, Z. & Lau, L.F. (2001) Evidence of p53-dependent cross-talk between ribosome biogenesis and the cell cycle: effects of nucleolar protein Bop1 on G(1)/S transition. Mol. Cell Biol. 21, 4246–4255.[Abstract/Free Full Text]

Rubbi, C.P. & Milner, J. (2003) Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses. EMBO. J. 22, 6068–6077.[CrossRef][Medline]

Scherl, A., Couté, Y., Déon, C., Callé, A., Kindbeiter, K., Sanchez, J.C., Greco, A., Hochstrasser, D. & Diaz, J.J. (2002) Functional proteomic analysis of human nucleolus. Mol. Biol. Cell 13, 4100–4109.[Abstract/Free Full Text]

Strausberg, R.L., Feingold, E.A., Grouse, L.H. et al.; Mammalian Gene Collection Program Team. (2002) Generation and initial analysis of more than 15 000 full-length human and mouse cDNA sequences. Proc. Natl. Acad. Sci. USA 99, 16899–16903.[Abstract/Free Full Text]

Sugimoto, K., Tasaka, H. & Dotsu, D. (2001) Molecular behavior in living mitotic cells of human centromere heterochromatin protein HPL{alpha} ectopically expressed as a fusion to red fluorescent protein. Cell Struct. Funct. 26, 705–718.[CrossRef][Medline]

Accepted: 23 April 2008





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sihn, C.-R.
Right arrow Articles by Kim, S. H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sihn, C.-R.
Right arrow Articles by Kim, S. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS