|
|
||||||||

1 Centre for Integrative Physiology, and
2 Centre for Translational and Chemical Biology, University of Edinburgh, Edinburgh, UK
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
For these related but distinct functions, proneural proteins are considered to activate directly both common (generic) and specific target genes. Examples of common target genes (those activated by both Sc and Ato) include senseless (sens) (Nolo et al. 2000; Jafar-Nejad et al. 2003; Acar et al. 2006) and Bearded (Brd) (Singson et al. 1994; Powell et al. 2004), both of which are genes needed for SOP selection from the proneural cluster (PNC). Subtype-specific target genes (those activated by only one proneural protein) are suggested to have a role in sense organ subtype differentiation. Few direct target genes are known so far in this category. One example is TakR86C, an Ato target gene, which encodes a neuropeptide receptor expressed in a subset of embryonic chordotonal precursor cells (Rosay et al. 1995). In addition, the ato and sc genes are themselves specific targets of their own gene products via autoregulatory enhancers (Culí & Modolell 1998; zur Lage et al. 2004).
To activate target genes, the proneural proteins bind as heterodimers with the ubiquitously expressed Class I bHLH protein Daughterless (Da) to specific DNA sequences known as E boxes (CANNTG) in the target regulatory regions. By analogy with other bHLH factors (Ma et al. 1994) basic regions of the bHLH domains contact the residues of the E box core via the major groove of the double helix. Predicted DNA binding residues are conserved between Sc and Ato (Chien et al. 1996), and the basic regions of Amos and Ato are almost identical. Although this is consistent with their regulation of common targets, the molecular mechanisms underlying the differences in target gene specificity of Sc and Ato proneural proteins are poorly known. Differences in functional specificity between Sc and Ato have been mapped to a number of bHLH domain residues (Chien et al. 1996). As these are predicted to face away from the DNA, it has been proposed that these variable residues make contacts with tissue-specific cofactors and that this underlies proneural protein specificity (Chien et al. 1996). However, we have shown that for Ato and Sc, differential utilization of variant E-box DNA binding sites also makes a significant contribution to specificity of target gene activation (Powell et al. 2004). By comparing the E box binding sites for a number of target genes, we defined an Ato-specific E-box motif (EAto: awCAKGTGk) that differed from the previously defined Sc motif (ESc: gCAGSTGk) in its 5' flanking bases and central bases (underlined). However, this is based on few sequences and it is not clear whether such motifs explain specific regulation of all Ato and Sc target genes. In vivo, these variants were shown to be important for specificity, but in a manner that is strongly influenced by developmental context, suggesting that cofactor interactions are also important (Powell et al. 2004). Some examples of the interplay of DNA and cofactor interactions come from studies of mouse. The DeltaM enhancer has an E box and an adjacent POU protein binding site, but whilst bHLH proteins Mash1 and Ngn2 are both generally capable of synergizing with the POU proteins (Brn1 and Brn2) selective E box utilization determines that only Mash1 synergizes at the DeltaM enhancer (Castro et al. 2006). A different explanation has been suggested for the mouse Hb9 promoter. Whilst proneural factor homologues NeuroM and Mash1 can both bind an E box in the Hb9 promoter (at least in vitro), only NeuroM can synergize with Lim-HD cofactors bound to the same promoter. Although not proven, it is suggested that this selective protein interaction provides the Hb9 promoter's specificity (Lee & Pfaff 2003).
Here, we have explored the influence of DNA binding site variation on Sc and Ato protein specificity in cell culture and in vivo reporter gene assays, and in vitro Surface Plasmon Resonance (SPR) analysis. Artificial enhancers consisting of concatemerised short (20 bp) E box sites from known target genes were tested for responsiveness to activation by Ato and Sc. In a number of cases we found that these sites can support specific reporter gene expression by their predicted cognate proneural protein in cell culture. In these cases it seems that 20 bp of DNA is sufficient for specificity without the need for additional specialized cofactors. There is, however, much variation in E box activity in cell culture despite similar E box motifs. This highlights the importance of other bases adjacent to the Sc and Ato E box motifs, and potentially the need for cofactors in vivo. Mutational analysis of E boxes confirms this. Additionally, we show that the proneural cofactor, Senseless (Sens) (Jafar-Nejad et al. 2003), can augment the function of Sc and Ato on their cognate E boxes and therefore may contribute to proneural specificity.
| Results |
|---|
|
|
|---|
We have used a Drosophila S2 cell culture (Schneider 1972) cotransfection assay with luciferase reporter constructs to explore the effect of E-box DNA sequence variation on transcriptional activation by Ato and Sc. Such a system has been used successfully in previous studies of bHLH protein interactions (Shirokawa & Courey 1997; Jafar-Nejad et al. 2003; Giagtzoglou et al. 2005). Artificial enhancers were constructed consisting of several copies of short (20 bp) E-box-containing sequences driving a luciferase reporter gene (Table 1). Such concatemers of Ato-type or Sc-type E boxes have been shown to drive GFP-reporter expression in highly Ato- or Sc-specific patterns, respectively, in vivo (Powell et al. 2004).
|
|
Having established that specific interactions can be reproduced in this assay, we then tested concatemers of other functional E-box sequences (Table 1). TakR86C-E2 and Brd-E3 are from Ato-responsive enhancers of the TakR86C and Brd genes, respectively (Rosay et al. 1995; Powell et al. 2004), whereas Brd-E1 is from a Sc-responsive enhancer (Singson et al. 1994; Powell et al. 2004). It is notable that these E boxes are activated less well in the S2 cell assay than ato-E1 and sc-E1 (Fig. 1B). However, some specificity is retained in each case. In vivo, a (TakR86C-E2)6-GFP concatemer was previously shown to give rise to expression in a subset of Ato-dependent precursors (Powell et al. 2004). This Ato specificity is partially retained by (TakR86C-E2)6-luc in the S2 cell assay. The Brd gene E boxes have not been tested in concatemeric reporter gene constructs in vivo. In the S2 cell assay, Brd-E3 shows Ato specificity as predicted, whilst Brd-E1 retains Sc specificity. In summary, five E boxes show evidence of differentially responding to Ato or Sc proneural proteins in a manner predicted from their in vivo enhancer properties (summarized in Table 2). Moreover, this specificity correlates well with the presence of an ESc or EAto sequence motif (Table 1).
|
An E box with a GC core activates very strongly
All the above E boxes have a G in the 4th position of the 6-bp core sequence (CANGTG—usually CAGGTG). However, a number of E boxes in proneural-responsive enhancers have a C in this position (CAGCTG). To examine the influence of this variant, we investigated an E box from the E(spl)m
gene (E(spl)m
-E2). The enhancer containing this E box appears to respond largely to Ato in vivo (Nellesen et al. 1999, and unpublished observations). However, the palindromic core of this E box means that it matches the Sc consensus sequence motif in one orientation (gCAGCTGt) and almost matches the Ato consensus sequence motif in the other (aaCAGCTGc) (Table 1; Fig. 1C). Indeed, in the S2 cell assay E(spl)m
-E2 is activated very strongly indeed by both Ato/Da and Sc/Da (Fig. 1D). Subsequently, the activation of (E(spl)m
-E2)6-luc was tested at 20-fold lower levels of cotransfected proneural protein construct. At this level of proneural factor, neither (ato-E1)7-luc nor (sc-E1)7-luc showed activation, whereas (E(spl)m
-E2)6-luc still gave significant activation (Fig. 1E). Interestingly, at high proneural concentrations, this E box showed some specificity for Sc, but at low proneural concentrations it showed specificity for Ato, reflecting better its predicted in vivo role.
The influence of the central two nucleotides of E(spl)m
-E2 on both its strong activity and proneural specificity was tested by mutating the core GC. In one mutation, the E box was changed from gCAGCTGt to gCAGGTGt (C4 > G; Fig. 1C), which still conforms completely to the Sc consensus binding site sequence. A second mutation was also examined: in this case gCAGCTGt was mutated to gCACCTGt (G3 > C; Fig. 1C), which in reverse continues to match partially the Ato consensus binding sequence (aaCAGGTGc). Both mutated sequences show a loss of activity at low proneural concentration (Fig. 1E) and a drastic reduction in activation at high proneural concentration (Fig. 1D). Nevertheless, activity is still considerably higher than for other unmutated E boxes despite the fact that the 8-bp core of the sequence (gCAGGTGt) is exactly the same as that of sc-E1 and sens-E1 (Table 1). We conclude that a C in the fourth position of the E box core contributes to high E box activity, but other sequences flanking the E box motif must also contribute strongly to the activity of the E(spl)m
-E2 site. In both mutations, no clear changes in specificity were observed.
Surface plasmon resonance (SPR) analysis of interaction of Ato with cognate and non-cognate sites
Previous in vitro binding experiments by gel retardation showed no difference in equilibrium binding affinities of Ato/Da or Sc/Da to ato-E1 or sc-E1 (Powell et al. 2004). To extend this analysis, an SPR assay (Teh et al. 2007) was used to explore further the relative affinities for Ato/Da interaction with cognate, non-cognate and mutated E-boxes. In SPR analysis, Ato/Da binding to immobilized ato-E1 or sc-E1 was characterized by a slow association step followed by a very slow dissociation (Fig. 2A lower two curves). Normalized curves (data not shown) indicated that the association and dissociation phases were not markedly different in kinetics (dissociation parameters for ato-E1: k– = 9.7 x 10–4 s–1, t1/2 = 715 s; sc-E1 k– = 1.04 x 10–3 s–1, t1/2 = 666 s). Subsequently, a competition assay was used to test the relative affinities for Ato/Da of various E box sequences in competition with immobilized ato-E1. In this assay, non-immobilized double-stranded competitor DNA was incubated with Ato/Da protein before SPR analysis. The reduction in the SPR signal for Ato/Da heterodimer binding to ato-E1 in the presence of 10 nM competitor (Fig. 2B) shows that ato-E1 itself competes most efficiently, with sc-E1 and E(spl)m
-E2 competing less well. A mutated E box (ato-E1M) does not compete for binding at this concentration. A subsequent titration experiment determined the relative concentrations at which the four competitors competed 50% of the Ato/Da binding to ato-E1 (Fig. 2C). This again revealed ato-E1 to be the most efficient competitor (10 nM yields 50% competition), followed by E(spl)m
-E2 (35 nM) and sc-E1 (50 nM). In comparison, ato-E1M competed extremely poorly (2.3 µM). Thus, in the competition assay Ato/Da showed only a slightly higher affinity for ato-E1 than for sc-E1. Moreover, it is notable that the highly active E(spl)m
-E2 site does not show an unusually high affinity in vitro. There is no simple correlation of binding affinity with E box activity or specificity in the S2 assay or in vivo.
|
Our analyses have shown that differences in E box behavior in vivo and in the cell culture assay do not strongly correlate with differences in protein–DNA interaction in vitro. In considering a possible molecular basis of in vivo specificity, we explored the role of cooperative binding to adjacent E box binding sites. Cooperative binding has been shown to be an important aspect of transcriptional activation, and the bHLH protein, MyoD, is known to bind cooperatively to adjacent E box binding sites in vitro (Weintraub et al. 1990). We speculated that cooperativity of proneural protein binding may be observed with cognate but not non-cognate E box sequences. To test this, SPR was used to analyze Ato/Da protein binding to immobilized DNAs containing either one E box (Fig. 2A, lower two curves) or two tandem E boxes (Fig. 2A, upper two curves) in the same configuration as used in the concatemer reporter gene constructs. For both ato-E1 and sc-E1, much slower Ato/Da dissociation from tandem sites was observed compared with one-site DNAs, suggesting the formation of complexes that are 4–5 times more stable (ato-E1 dimer: k– = 2.8 x 10–4 s–1, t1/2 = 2460 s; sc-E1 dimer: k– = 2.2 x 10–4 s–1, t1/2 = 3150 s). This is indicative of cooperative interactions between Ato/Da heterodimers bound to adjacent sites. This shows for the first time that proneural protein dimers are capable of homotypic interactions that result in cooperative binding to E-box binding sites. Comparison of normalized (ato-E1)2 and (sc-E1)2 curves (results not shown), however, reveals no great difference in the level of cooperativity seen with the cognate (ato-E1)2 and non-cognate (sc-E1)2 sites, and so differences in cooperative protein interaction would appear not to underlie E box specificity.
Effect of mutagenesis of concatemer E-box flanking sequence on specificity of activation in S2 cells
Although there is much variability in the activity of the E boxes tested in the S2 cell assay, E box specificity correlates quite well with the identity of the two nucleotides immediately flanking 5' of the E box core, which previously defined distinct EAto and ESc motifs (Powell et al. 2004). The importance of these flanking nucleotides was assessed by mutagenesis. First, the 5' flanking sequence of ato-E1 was mutated from AA to GG, thereby converting the EAto motif to ESc (ato-E1 AA > GG, Fig. 3A). In the S2 luciferase assay, ato-E1 AA > GG showed a small but significant specificity for activation by Sc (Fig. 3B). This largely results from a reduction in activation by Ato rather than an increase by Sc. Thus, the flanking AA 5' is necessary for Ato-specific activation of ato-E1; a flanking G, however, is not sufficient for full Sc-specific activation in the context of this concatemer construct. We conclude that the immediate 5' flanking residues are important for specificity but further flanking residues strongly influence E box activity.
|
In vivo expression patterns for transgenic flies with (sc-E1 GG > AA)6-GFP
In S2 cells, mutating the sc-E1 concatemer to resemble an EAto motif (sc-E1 GG > AA) (Fig. 3C) did not result in regulation by Ato. To assess whether developmental context would improve specificity, the same concatemer construct was tested in vivo as a GFP reporter gene. In the embryo, unmutated (sc-E1)6-GFP gives strong expression in Sc-dependent SOPs (marked by Ac expression in Fig. 4) and little or no detectable expression in Ato-expressing SOPs (Powell et al. 2004) (Fig. 4D,G). In comparison, the concatemer reporter with sc-E1 GG > AA showed much reduced expression in Sc-dependent SOPs consistent with the loss of the ESc motif (Fig. 4E,H). In contrast, this construct showed some expression in Ato-dependent precursors, consistent with the EAto motif now present in this concatemer (Fig. 4F,I). Similarly in third instar larval imaginal discs, sc-E1 GG > AA supported reduced expression in Sc-dependent precursors in the wing, eye and leg imaginal discs compared to sc-E1 (Fig. 5A–D, and unpublished data). Additionally, a partial gain of expression was observed in some Ato-expressing cells in the eye-antennal and wing discs (Fig. 5A–D), although no expression was observed in most Ato-expressing cells of the antenna or leg discs (data not shown). In conclusion, unlike in S2 cells, mutating sc-E1 to resemble an EAto motif appears in vivo to result in a partial switch of regulation from Sc to Ato.
|
|
Sens protein accentuates the specificity of Ato and Sc in the S2 cell assay
In the S2 cell assay, Ato and Sc have clear intrinsic specificities for cognate E boxes. However, specificity is not complete: the proteins can also activate non-cognate E boxes to some extent, whereas the same concatemer constructs (where tested) support more specific patterns of expression in vivo (Powell et al. 2004). One possibility is that interactions with other protein factors enhance proneural specificity and that these factors are not expressed in S2 cells. One such factor might be the Zn finger protein Sens, which has an important role in facilitating the selection of the single SOP from the PNC (Nolo et al. 2000; Jafar-Nejad et al. 2003; Acar et al. 2006). Sens associates with Sc, Ac, Ato and Da in pulldown assays (Acar et al. 2006; Jafar-Nejad et al. 2006) and it can enhance the activity of Ac in S2 cells in a non-DNA binding dependent manner (Jafar-Nejad et al. 2003). This suggests that Sens is a general proneural coactivator. Here, we address the questions of whether Sens influences the activity of all proneural factors, and whether it influences specificity. Transfection with Sens-expressing plasmid alone has little effect on transcriptional activation of any concatemer reporter construct except Brd-E1 (see below). In contrast, cotransfection of Sens with proneural proteins generally resulted in higher levels of reporter activation than observed with proneural proteins alone (data not shown). This was observed with all combinations of protein and reporter construct tested (including Da alone and Amos). Thus, Sens can indeed synergize with all proneural proteins tested in this assay, as predicted from pulldown experiments. These preliminary observations were carried out at high levels of proneural protein (see Experimental procedures). In case the high levels of activation observed were masking differences between different protein combinations, transfections were repeated with low levels of proneural protein. Under these conditions, there is normally very little activation of ato-E1 or sc-E1 reporter constructs by Ato/Da and Sc/Da (Fig. 6A,B). In the presence of Sens, however, a large increase in activation was observed for ato-E1 with Ato/Da and for sc-E1 with Sc/Da (Fig. 6A,B). Significantly, Sens did not stimulate the activation of ato-E1 by Sc/Da or sc-E1 by Ato/Da. Thus, in this assay Sens enhances proneural activity in an E-box motif-specific manner.
|
-E2 construct (Fig. 1E) supported high transcriptional activation even at low proneural concentration. In this case, Sens increased overall activity but did not alter the degree of specificity observed (Fig. 6F). In summary. specificity for cognate proneural proteins was enhanced by Sens for five out of six E boxes tested (summarized in Table 2). Hence, in many cases Sens enhances the specificity of both Sc and Ato for their cognate E boxes. | Discussion |
|---|
|
|
|---|
Proneural specificity is exhibited in S2 cells
Transcription factor activity depends on a complex interplay of interactions with DNA and with other protein factors, including those bound to other sites within the enhancer. To concentrate on the role that proneural protein interaction with E-box binding sites plays in specificity, we analyzed synthetic enhancers of concatemers of E-box-containing sequences in a cell culture reporter gene assay. Our previous study of Ato or Sc-specific enhancers relied on the analysis of expression patterns produced in transgenic flies carrying GFP reporter gene constructs (Powell et al. 2004). In that study, specific regulation by Sc or Ato was inferred indirectly from patterns of GFP expression. Here we show that much of this inferred specificity is also seen in a cell culture reporter gene assay, strongly supporting the conclusion that Ato and Sc directly use different E box motifs. Thus, in general, the specificity of E box response (ratio of response to Sc and Ato) could be predicted from matches to ESc or EAto motifs identified previously (Powell et al. 2004). In most cases, this specificity also corresponded to the specificity of the native enhancer from which the E box was taken. An interesting exception is sens-E1: whilst this E box is proposed to respond to both Ato and Sc in vivo (Jafar-Nejad et al. 2003), it responds slightly better to Sc than to Ato in culture, which is more consistent with its ESc motif. It will be important to determine what other enhancer features allow such an E box to function as a common target of Ato and Sc in vivo.
Importantly, E box specificity is achieved without the appropriate cellular and developmental context of neurogenesis: S2 cells are embryonic, non-neural cells of likely hematopoietic origin (Schneider 1972; Ramet et al. 2002) and are not expected to contain neural-specific factors. Our results therefore indicate that proneural factors have intrinsic ability to use different E box motifs without the need for interactions with neural specific cofactors. The ESc and EAto motifs differ most notably in the bases immediately flanking the 5' end of the 6-bp core sequence (NG vs. AW). There is evidence from the crystal structure of the MyoD bHLH domain–DNA complex that protein contacts are made with bases in this position (Ma et al. 1994), suggesting that similar direct contacts may influence E box utilization by proneural proteins. The basic region amino acids making these contacts (R110, R117 and E118) are conserved in the proneural proteins, but in Ato the arginines are separated by three amino acids (LAA, equivalent to MyoD KAA) that are absent in Sc. Thus despite the apparent conservation of DNA-contacting residues, one might predict strong differences in how the proneural proteins interact with the flanking nucleotides. SPR analysis shows Ato/Da to bind to ato-E1 and sc-E1 with similar affinity. Rather than affecting E box affinity, it is possible that subtle differences in binding contacts may cause conformational effects that affect the transactivation ability of the proneural protein.
Determinants of E box function are complex
The above results point to the importance of distinct Ato and Sc E box motifs for proneural specificity. Several findings, however, demonstrate that these motifs are heavily dependent on the wider DNA context. For instance, the E(spl)m
-E2(C4 > G), sens-E1 and sc-E1 binding sites show very large differences in activity in cell culture, even though they have identical perfect ESc motifs at their core (gCAGGTGt). The effect of DNA context is also seen in the general inability, in the cell culture assay, to swap the proneural specificities of sc-E1 and ato-E1 by mutating the immediate 5' flanking bases of the core E box. Such changes generally result in loss of E box activity rather than a clear change in specificity. These results indicate that the ESc and EAto motifs are generally not sufficient for activity or specificity in the cell culture assay and that the surrounding DNA context is important (even within the short 20-bp sequences used).
Interestingly, in some circumstances specificity could be manipulated more successfully in vivo: (sc-E1 GG > AA)6-GFP transgenic flies showed GFP expression consistent with strongly reduced activation by Sc and a gain of activation in some specific locations by Ato. However, this mutated motif did not respond to ectopically expressed Ato, perhaps suggesting that improved specificity in vivo results from cofactors expressed in locations of endogenous Ato expression and function.
Overall, our results above show that further sequences on both flanks of the ESc and EAto box motifs are also important for specificity and activity. One possibility is that the 20-bp DNA sequences used to construct the concatemers may include flanking sequences that interact with other protein factors to influence proneural specificity. Such adjacent sites have been identified for some mouse proneural E box binding sites (Lee & Pfaff 2003; Castro et al. 2006). Moreover, in its native enhancer, ato-E1 is adjacent to an Ets-domain transcription factor binding site (zur Lage et al. 2004) (although this site is mutated in the constructs used in this study). However, such cofactors would need to be expressed in S2 cells. Moreover, although the flanking sequences of the ato-E1 and sc-E1 sites are strongly conserved among Drosophila species (unpublished observations), we find no obvious shared sequence motifs in the 5' and 3' flanks of known Drosophila E boxes that might be cofactor binding sites. Whilst there is a potential POU factor binding sequence 5' of the ato-E1 site, no members of the Drosophila POU family appear to be expressed during early neurogenesis (unpublished observations and data not shown). Alternatively, the further flanking bases may influence bHLH heterodimer interaction either through direct contacts or through indirect conformational effects. It is interesting that 3' bases appear important as these may be predicted to affect Da interaction (zur Lage et al. 2004). It is notable that the Da homologue, E2A, has different half-site preferences when bound to Twi or MyoD (Kophengnavong et al. 2000).
Sens as a specificity cofactor for both Sc and Ato
The specificity of E-box concatemer constructs is generally more complete in vivo than in the S2 luciferase assay—notably proneural proteins can generally activate non-cognate E boxes to some extent in cell culture but not in vivo. One possibility is that the intrinsic specificity of proneural proteins must normally be enhanced by interaction with cofactors that are not present in S2 cells. In the cell culture assay, at high proneural levels we found that Sens enhanced proneural activity in a general manner. None of the constructs tested contain Sens binding motifs, so it is likely that enhancement occurs in a DNA-binding independent manner via protein–protein interactions as previously proposed (Jafar-Nejad et al. 2003; Acar et al. 2006). At low proneural concentrations, however, the effect of Sens enhancement becomes selective. For many of the constructs tested, Sens only enhanced the activity of proneural proteins for concatemers consisting of their cognate E box. We suggest that proneural–Sens interaction may enhance the specificity of proneural–E box interaction. Thus, this is an interesting case in which proneural specificity can be influenced by a common cofactor, rather than requiring interaction with different subtype-specific cofactors. It remains to be determined whether Sens would enhance specificity on native enhancers as well as concatemer constructs. Moreover, it seems unlikely that Sens is a specificity factor for all proneural target genes. However, our results are consistent with Sens acting as a specificity cofactor in certain contexts—such as the proneural autoregulatory enhancers active in SOPs where there are high levels of Sens and proneural proteins present. Other non-DNA binding proneural protein interactors, such as Chip (Ramain et al. 2000) and Kohtalo (Lim et al. 2007) may have a similar effect in other contexts.
The effect of Sens could be explained by two models. First, interaction of a proneural protein with a specific E-box motif may give rise to a specific conformation which results in an increased affinity for Sens protein. Alternatively, the Sens–proneural protein interaction may alter the proneural bHLH domain conformation thereby increasing its affinity for its cognate binding site (i.e. an induced fit model) (Spolar & Record 1994). Indeed, variation in MyoD bHLH protein DNA sequence preferences have been previously observed to be the result of effects on basic region conformation arising because of binding partner differences (Kophengnavong et al. 2000) or amino acid composition of the basic region (Huang et al. 1998). In this view, proneural specificity relies on a combination of cognate DNA sequence recognition and protein–protein interactions. Important future work will be the identification of the amino acid residues of Ato and Sc necessary for their interaction with Sens and the determination of whether these influence DNA recognition.
| Experimental procedures |
|---|
|
|
|---|
Protein purification was as described previously (Powell et al. 2004) from pRSET-Ato, pRSET-Da and pRSET-Sc expression plasmids, except the resin used was His-Select Cobalt Affinity Gel (Sigma, St Louis, MO). For SPR Experiments (Biacore, Uppsala, Sweden) an additional ion-exchange chromatography step was included before refolding to improve the protein purity to greater than 95%.
Plasmid constructs
Protein expression constructs RactHAdh, RactH-Adh-Da and pAc-Sc were donated by Christos Delidakis (Giagtzoglou et al. 2005), and pAc-Sens was donated by Hamed Jafar-Nejad (Jafar-Nejad et al. 2003; Majka & Speck 2007). pAc-5.1-Ato was made as follows. The protein coding region of ato was amplified from pBS-84F#2 (Jarman et al. 1994) primers: 5'-CGCGAATTC CCATACAGCAGCAGCAACATG-3' and 5'-ATATCTAGA GCGCAGCAGATCCCCGAG-3'). The resulting PCR product was cloned in pAc5.1 (Invitrogen, Carlsbad, CA) using the underlined primer EcoRI and XbaI sites. pGL3-p (Promega, Madison, WI) luciferase reporter constructs were made by transferring the appropriate concatemer sequences from pHStinger (ato-E1, sc-E1, TAKR86C-E2) or pBluescript (Brd-E1, Brd-E3, sens-E1, E(spl)m
-E2, E(spl)m
-E2mutA, E(spl)m
-E2mutS, sc-E1 GG > AA, ato-E1 AA > GG). Concatemer constructs were made as described in (Powell et al. 2004) (see Table 1 for sequences). For the ato-E1 concatemer and its derivatives, a mutation was introduced to remove an adjacent Pointed protein binding site (zur Lage et al. 2004).
Cell culture and cotransfection
Drosophila S2 cells were grown at 27 °C in Schneider's insect medium (Sigma) plus 10% FBS (Invitrogen) and split on the day before cotransfection. Cells were used at 0.5 x 106 cells/mL for transfection with a mix of protein-expression (pAc5.1a. RactHAdh), luciferase reporter (pGL3-p) and control Renilla luciferase constructs (pRLCMV, Promega), using Effectene Transfection reagent (Qiagen, Valencia, CA) at a ratio of 25 µL Effectene per µg DNA. In each case total DNA per cotransfection was made up to 200 ng using empty protein expression vector. Unless stated to the contrary, cotransfections used 20 ng of proneural and Da expression constructs (high proneural levels), but in some experiments as described in the Results, low proneural levels were achieved using 1 ng of these expression constructs for cotransfection. The cells were incubated for 24 h at 27 °C before harvesting.
Luciferase assays
Transfected cells were pelleted at 8000 rpm for 6 min and resuspended in 200 µL Passive Lysis buffer (Promega). Dual Luciferase assays were carried out according to the standard protocol (Promega) in a Turner 20/20 or multiplate luminometer (Promega). Results are presented as the ratio of fold activation relative to a control cotransfection with empty protein expression vector. Experiments were carried out in triplicate and results shown are plus and minus standard deviation. Additionally, similar results were obtained for at least three separate experiments for each expression and reporter construct combination. Standard Students t-tests were carried out.
Germ-line transformation
The sc-E1 GG > AA mutant concatemer sequence was cloned in pHStinger, to make (sc-E1 GG > AA)6-GFP and used in germ-line transformation as described previously (Powell et al. 2004) to make transgenic flies. Other transformant lines are as described by Powell et al. (2004). Two independent insertions were analyzed, with identical results.
Immunohistochemistry
Immunohistochemical procedures are as described in Powell et al. (2004). Rabbit anti-Ac antibody (A.P.J. unpublished data) was used as a surrogate for characterizing Sc expression as the patterns of the two proneural proteins that are similar and Sc antibodies are not available.
Surface plasmon resonance (SPR)
SPR (Majka & Speck 2007) experiments were carried out using a Biacore T100 instrument. HBS-EP+ buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, 0.05% P20 surfactant) plus 0.1 mg/mL BSA was used for all experiments. All oligonucleotides for SPR were HPLC purified and from MWG. Biotinylated oligonucleotides (modified with 5' Biotin TEG) were hybridized to complementary unmodified oligonucleotides. Biotinylated double-stranded DNA was immobilized on the sensor surface of flow cell 2 or 4 of a 4-flow cell Biacore SA (Streptavidin) Sensor chip as follows: Flow cells 1–4 were treated with three times 60 s injections of 50 mM NaOH, 1.5 M NaCl at a flow rate of 10 µL/min, with 60 s buffer washes in between. DNA was immobilized on the surface of flow cell 2 or 4 by injecting 25 nM DNA at 10 µL/min for 12 s. Flow cell 1 was used as no DNA control for flow cell 2 (and flow cell 3 for 4). The top strands for the double-stranded oligonucleotides (E-boxes underlined) immobilized on Streptavidin-modified chips were as follows:
40 bp 2 site oligonucleotides:
These biotinylated oligonucleotides were hybridized to unmodified complementary strands before immobilization to the SA chip. 0–400 nM Ato/Da was bound to the chip. Scrubber 2 (version 2c; from BioLogic Software, Australia) was used to fit the dissociation curves (for 50–120 nM protein concentrations) to a single exponential in order to derive dissociation rate constants and half times for the 1 and 2 site ato-E1 and sc-E1 DNAs, respectively. For the competition assay, unlabelled oligonucleotides were used as described in Teh et al. (2007) to determine relative binding affinities for the following double stranded DNAs (top strand only shown):
-E2: 5' CAAATCTAGAAACGGCAGCTGTT CGCTCTGCAAATT 3' In each case the E box is underlined. The nucleotides mutated to ablate the E-box in ato-E1M are shown in bold. Ato and Da (1 µM each) were pre-incubated for 20 min before incubating with varying amounts of competitor DNA for 20 min to allow the binding to come to equilibrium (as previously determined by EMSA) before application to the SA chip with immobilized ato-E1. The assay therefore tested for the availability of protein in an equilibrium mixture with competitor DNA. Percentage binding was expressed relative to the response achieved in the absence of competitor.
| Acknowledgements |
|---|
| Footnotes |
|---|
Present address: Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, UK. | References |
|---|
|
|
|---|
Berkes, C.A. & Tapscott, S.J. (2005) MyoD and the transcriptional control of myogenesis. Semin. Cell Dev. Biol. 16, 585–595.[CrossRef][Medline]
Bertrand, N., Castro, D.S. & Guillemot, F. (2002) Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517–530.[CrossRef][Medline]
Bloor, A.J., Sanchez, M.J., Green, A.R. & Gottgens, B. (2002) The role of the stem cell leukemia (SCL) gene in hematopoietic and endothelial lineage specification. J. Hematother. Stem Cell Res. 11, 195–206.[CrossRef][Medline]
Campuzano, S. & Modolell, J. (1992) Patterning of the Drosophila nervous system: the achaete–scute gene complex. Trends Genet. 8, 202–208.[Medline]
Castro, D.S., Skowronska-Krawczyk, D., Armant, O., Donaldson, I.J., Parras, C., Hunt, C., Critchley, J.A., Nguyen, L., Gossler, A., Göttgens, B., Matter, J.M. & Guillemot, F. (2006) Proneural bHLH and Brn proteins coregulate a neurogenic program through cooperative binding to a conserved DNA motif. Dev. Cell 11, 831–844.[CrossRef][Medline]
Chae, J.H., Stein, G.H. & Lee, J.E. (2004) NeuroD: the predicted and the surprising. Mol. Cells 18, 271–288.[Medline]
Chien, C.-T., Hsiao, C.-D., Jan, L.Y. & Jan, Y.N. (1996) Neuronal type information encoded in the basic-helix-loop-helix domain of proneural genes. Proc. Natl. Acad. Sci. USA 93, 13239–13244.
Culí, J. & Modolell, J. (1998) Proneural gene self-stimulation in neural precursors: an essential mechanism for sense organ development that is regulated by Notch signalling. Genes Dev. 12, 2036–2047.
Ghysen, A. & Dambly-Chaudière, C. (1993) The specification of sensory neuron identity in Drosophila. BioEssays 15, 202–208.
Giagtzoglou, N., Koumbanakis, K.A., Fullard, J., Zarifi, I. & Delidakis, C. (2005) Role of the Sc C terminus in transcriptional activation and E(spl) repressor recruitment. J. Biol. Chem. 280, 1299–1305.
Goulding, S.E., zur Lage, P. & Jarman, A.P. (2000) amos, a proneural gene for Drosophila olfactory sense organs that is regulated by lozenge. Neuron 25, 69–78.[CrossRef][Medline]
Huang, J., Weintraub, H. & Kedes, L. (1998) Intramolecular regulation of MyoD activation domain conformation and function. Mol. Cell. Biol. 18, 5478–5484.
Jafar-Nejad, H., Acar, M., Nolo, R., Lacin, H., Pan, H., Parkhurst, S.M. & Bellen, H.J. (2003) Senseless acts as a binary switch during sensory organ precursor selection. Genes Dev. 17, 2966–2978.
Jafar-Nejad, H., Tien, A.C., Acar, M. & Bellen, H.J. (2006) Senseless and Daughterless confer neuronal identity to epithelial cells in the Drosophila wing margin. Development 133, 1683–1692.
Jarman, A.P. & Ahmed, I. (1998) The specificity of proneural genes in determining Drosophila sense organ identity. Mech. Dev. 76, 117–125.[CrossRef][Medline]
Jarman, A.P., Grau, Y., Jan, L.Y. & Jan, Y.N. (1993) atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell 73, 1307–1321.[CrossRef][Medline]
Jarman, A.P., Grell, E.H., Ackerman, L., Jan, L.Y. & Jan, Y.N. (1994) atonal is the proneural gene for Drosophila photoreceptors. Nature 369, 398–400.[CrossRef][Medline]
Kophengnavong, T., Michnowicz, J.E. & Blackwell, T.K. (2000) Establishment of distinct MyoD, E2A, and twist DNA binding specificities by different basic region–DNA conformations. Mol. Cell. Biol. 20, 261–272.
Lee, S. & Pfaff, S. (2003) Synchronization of neurogenesis and motor neuron specification by direct coupling of bHLH and homeodomain transcription factors. Neuron 38, 731–745.[CrossRef][Medline]
Lim, J., Lee, O.K., Hsu, Y.C., Singh, A. & Choi, K.W. (2007) Drosophila TRAP230/240 are essential coactivators for Atonal in retinal neurogenesis. Dev. Biol. 308, 322–330.[CrossRef][Medline]
Ma, P.C.M., Rould, M.A., Weintraub, H. & Pabo, C.O. (1994) Crystal structure of MyoD bHLH domain–DNA complex: perspectives on DNA recognition and implications for transcriptional activation. Cell 77, 451–459.[CrossRef][Medline]
Majka, J. & Speck, C. (2007) Analysis of protein–DNA interactions using surface plasmon resonance. Adv. Biochem. Eng. Biotechnol. 104, 13–36.[Medline]
Nellesen, D.T., Lai, E.C. & Posakony, J.W. (1999) Discrete enhancer elements mediate selective responsiveness of enhancer of split complex genes to common transcriptional activators. Dev. Biol. 213, 33–53.[CrossRef][Medline]
Nolo, R., Abbott, L.A. & Bellen, H.J. (2000) Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila. Cell 102, 349–362.[CrossRef][Medline]
Powell, L.M., zur Lage, P.I., Prentice, D.R.A., Senthinathan, B. & Jarman, A.P. (2004) The proneural proteins Atonal and Scute regulate neural target genes through different E-box binding sites. Mol. Cell. Biol. 24, 9517–9526.
Quan, X.-J. & Hassan, B.A. (2005) From skin to nerve: flies, vertebrates and the first helix. Cell. Mol. Life Sci. 62, 2036–2049.[CrossRef][Medline]
Ramain, P., Khechumian, R., Khechumian, K., Arbogast, N., Ackermann, C. & Heitzler, P. (2000) Interactions between chip and the achaete/scute-daughterless heterodimers are required for pannier-driven proneural patterning. Mol. Cell 6, 781–790.[CrossRef][Medline]
Ramet, M., Manfruelli, P., Pearson, A., Mathey-Prevot, B. & Ezekowitz, R.A. (2002) Functional genomic analysis of phagocytosis and identification of a Drosophila receptor for E. coli. Nature 416, 644–648.[CrossRef][Medline]
Rosay, P., Colas, J.F. & Maroteaux, L. (1995) Dual organisation of the Drosophila neuropeptide receptor NKD gene promoter. Mech. Dev. 51, 329–339.[CrossRef][Medline]
Schneider, I. (1972) Cell lines derived from late embryonic stages of Drosophila melanogaster. J. Embryol. Exp. Morphol. 27, 353–365.[Medline]
Shirokawa, J.M. & Courey, A.J. (1997) A direct contact between the dorsal rel homology domain and Twist may mediate transcriptional synergy. Mol. Cell. Biol. 17, 3345–3355.[Abstract]
Singson, A., Leviten, M.W., Bang, A.G., Hua, X.H. & Posakony, J.W. (1994) Direct downstream targets of proneural activators in the imaginal disc include genes involved in lateral inhibitory signaling. Genes Dev. 8, 2058–2071.
Spolar, R.S. & Record, M.T. Jr. (1994) Coupling of local folding to site-specific binding of proteins to DNA. Science 263, 777–784.
Teh, H.F., Peh, W.Y., Su, X. & Thomsen, J.S. (2007) Characterization of protein–DNA interactions using surface plasmon resonance spectroscopy with various assay schemes. Biochemistry 46, 2127–2135.[CrossRef][Medline]
Weintraub, H., Davis, R., Lockshon, D. & Lassar, A. (1990) MyoD binds cooperatively to two sites in a target enhancer sequence: occupancy of two sites is required for activation. Proc. Natl. Acad. Sci. USA 87, 5623–5627.
zur Lage, P.I., Powell, L.M., Prentice, D.R., McLaughlin, P. & Jarman, A.P. (2004) EGF receptor signalling triggers recruitment of Drosophila sense organ precursors by stimulating proneural gene autoregulation. Dev. Cell 7, 687–696.[CrossRef][Medline]
Received: 11 April 2008
Accepted: 26 May 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |