GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2008) 13, 965-975. doi:10.1111/j.1365-2443.2008.01220.x
© 2008 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Funato, Y.
Right arrow Articles by Miki, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Funato, Y.
Right arrow Articles by Miki, H.

Nucleoredoxin regulates the Wnt/planar cell polarity pathway in Xenopus

 Yosuke Funato1,2,3, Tatsuo Michiue4,5, Takeshi Terabayashi1, Akira Yukita6, Hiroki Danno4,5, Makoto Asashima4,5,7 and Hiroaki Miki1,*

1 Laboratory of Intracellular Signaling, Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871, Japan
2 Graduate School of Medicine, Kobe University, 7-5-1, Kusunokicho, Chuo-ku, Kobe-shi, Hyogo 650-0017, Japan
3 Division of Biochemistry, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan
4 Organ Development Research Laboratory, National Institute of Advanced Industrial Science and Technology, AIST Tsukuba Central 4, Tsukuba-shi, Ibaraki 305-8562, Japan
5 Department of Life Sciences (Biology), Graduate School of Arts and Sciences, University of Tokyo, 3-8-1, Komaba, Meguro-ku, Tokyo 153-8902, Japan
6 Department of Oral Histology, Matsumoto Dental University, 1780, Gobara, Hirooka, Shiojiri-shi, Nagano 399-0781, Japan
7 ICORP, Japan Science and Technology Agency (JST), 3-8-1, Komaba, Meguro-ku, Tokyo 153-8902, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The Wnt signaling pathway is conserved across species, and is essential for early development. We previously identified nucleoredoxin (NRX) as a protein that interacts with dishevelled (Dvl) in vivo to negatively regulate the Wnt/β-catenin pathway. However, whether NRX affects another branch of the Wnt pathway, the Wnt/planar cell polarity (PCP) pathway, remains unclear. Here we show that NRX regulates the Wnt/PCP pathway. In Xenopus laevis, over-expression or depletion of NRX by injection of NRX mRNA or antisense morpholino oligonucleotide, respectively, yields the bent-axis phenotype that is typically observed in embryos with abnormal PCP pathway activity. In co-injection experiments of Dvl and NRX mRNA, NRX suppresses the Dvl-induced bent-axis phenotype. Over-expression or depletion of NRX also suppresses the convergent extension movements that are believed to underlie normal gastrulation. We also found that NRX can inhibit Dvl-induced up-regulation of c-Jun phosphorylation. These results indicate that NRX plays crucial roles in the Wnt/PCP pathway through Dvl and regulates Xenopus gastrulation movements.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Signaling pathways stimulated by secreted Wnt ligands are known to be essential for early development in multicellular species (Moon et al. 2004; Clevers 2006). The Wnt signaling pathway was first identified in Drosophila melanogaster, and it was later shown to be conserved through evolution, from nematodes to mammals. Genetic and biochemical studies have clarified the framework of the Wnt signaling pathway and showed that it can be divided into several branches. The Wnt/β-catenin pathway, the first identified Wnt pathway (also known as the "canonical" Wnt pathway), is involved in accumulation of β-catenin and subsequent activation of transcription factor T-cell factor/lymphoid enhancer factor (TCF/LEF). The Wnt/β-catenin pathway affects cell growth and cell fate through regulation of various target gene expression. Recent studies have shown that the Wnt/β-catenin pathway is important in stem cell maintenance. It is also widely known that aberrant activation of the Wnt/β-catenin pathway is a major cause of various types of human tumors, such as colorectal tumors.

Another well-characterized branch of the Wnt signaling pathway, the Wnt/planar cell polarity (PCP) pathway, governs cell polarity and movement. PCP signaling was also first identified in Drosophila. A mutant fly frizzled (fz), with abnormal orientation of cuticular hairs and bristles was first reported (Vinson & Adler 1987). Genetic screening in Drosophila identified many of the components of the PCP pathway, including dishevelled (Dvl), Van Gogh/Strabismus (Vang/Stbm), Rho and c-Jun (Theisen et al. 1994; Strutt et al. 1997; Boutros et al. 1998; Taylor et al. 1998; Wolff & Rubin 1998). Notably, Dvl is a component of both the Wnt/β-catenin pathway and the Wnt/PCP pathway and is regarded as a branchpoint between these two pathways (Axelrod et al. 1998; Boutros et al. 1998). Further studies showed that activation or loss-of-function of PCP pathway components affects various processes in many organisms, such as ommatidia polarity in the Drosophila compound eye, neuronal polarity in mammalian neurons, and gastrulation movements in vertebrates (Tada & Smith 2000; Wallingford et al. 2000, 2002; Ciani & Salinas 2005). Therefore, it is widely accepted that the Wnt/PCP pathway is conserved across species.

Xenopus has a number of advantages as a brilliant model organism for developmental analyses, such as large embryos, availability for microsurgeries and external development. Since the 19th century, numerous researchers have utilized Xenopus to clarify the mechanisms of early development. Many developmental processes and underlying signaling pathways, including the Wnt signaling pathway, have been investigated in Xenopus embryos. Hyperactivation or suppression of PCP pathway molecules, such as Dvl and Stbm, in Xenopus causes severe gastrulation defects and results in a bent-axis phenotype (Wallingford et al. 2000; Darken et al. 2002). This phenotype is caused by errors in convergent extension, a polarized intercalation movement of the sheet-formed cells, which results in narrowing in one dimension and perpendicular elongation (Keller et al. 1985).

In a previous study, we searched for novel interacting partners of Dvl and identified nucleoredoxin (NRX) (Funato et al. 2006). NRX is a member of the thioredoxin (TRX) redox-regulating protein family (Funato & Miki 2007; Lillig & Holmgren 2007). TRX family proteins have thiol-oxidoreductase activity, which is often exerted as a disulfide bond reducing reaction. NRX binds to Dvl in vivo in a redox-dependent manner. Over-expression and knockdown analyses in mammalian culture cells indicated that NRX inhibits the Wnt/β-catenin pathway. Developmental analyses of Xenopus embryos also supported this conclusion. Therefore, the negative effect of NRX on the Wnt/β-catenin pathway has been solidly confirmed. In contrast, the effect of NRX on the Wnt/PCP pathway remains unknown.

In the present study, we investigated the possible role of NRX in the Wnt/PCP pathway. We found that NRX can also regulate the Wnt/PCP pathway as well as Wnt/β-catenin pathway and that NRX is required for proper gastrulation movements in Xenopus. Moreover, NRX inhibited Dvl-induced phosphorylation of c-Jun, which is known to be a crucial biochemical mechanism regulating the PCP pathway.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Over-expression and inhibition of NRX causes bent-axis phenotype through Dvl

In our previous study, we identified NRX as a negative regulator of the Wnt/β-catenin pathway (Funato et al. 2006). To evaluate the role of NRX in the Wnt/PCP pathway in Xenopus, we injected NRX mRNA into the dorsoanimal (DA) region of 8-cell-stage fertilized Xenopus eggs. The NRX mRNA-injected embryos had a short, bent-axis or open blastopore with gastrulation defects (Fig. 1 A–D,H). The severity of each phenotype increased in a dose-dependent manner. These phenotypes of NRX mRNA-injected tadpoles were similar to those of embryos injected with Dvl mRNA (Fig. 1E–H). Over-expression/loss-of-function of Dvl is reported to perturb the Wnt/PCP pathway and cause gastrulation defects, resulting in a bent-axis phenotype (Sokol 1996; Wallingford et al. 2000). The effect of NRX mRNA injection was less severe than that of Dvl mRNA injection.


Figure 1
View larger version (70K):
[in this window]
[in a new window]

  		Figure 1  Bent-axis phenotype caused by NRX mRNA injection. Representative embryos with (A) no injection, (B–D) NRX mRNA injection (100, 250 or 500 pg), and (E–G) Dvl mRNA injection (100, 250 or 500 pg). (H) The ratio of bent-axis phenotype caused by NRX or Dvl mRNA injection. Representative embryos with "severe", "moderate", "weak" and "normal" phenotypes are also shown.

 
We previously reported that NRX functions as a negative regulator of the Wnt/β-catenin pathway by directly inhibiting the function of Dvl (Funato et al. 2006). Therefore, we co-injected both Dvl and NRX mRNAs to determine if there is a functional interaction between Dvl and NRX with respect to the bent-axis phenotype in Xenopus. Co-injection of NRX mRNA clearly reduced the severity of the bent-axis phenotype in Dvl mRNA-injected embryos in a dose-dependent manner (Fig. 2), suggesting that NRX can attenuate the Wnt/PCP pathway by inhibiting Dvl function.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

  		Figure 2  The effect of NRX mRNA co-injection with Dvl mRNA on bent-axis phenotypes. Representative embryos with (A) Dvl mRNA injection (100 pg) and (B) Dvl mRNA (100 pg) and NRX mRNA (100, 500 or 1000 pg) co-injection. (C) The ratio of bent-axis phenotype by injection of Dvl mRNA alone, or with NRX mRNA.

 
We carried out loss-of-function analyses with MO against Xenopus NRX. First, we examined whether Xenopus NRX is expressed during gastrulation. By reverse transcription-polymerase chain reaction (RT-PCR) analyses, we detected positive signals because of the Xenopus NRX expression in all areas we analyzed (dorsal, lateral and ventral marginal zones) at stage 10, a critical stage for gastrulation (Fig. 3A). Next, the specificity of NRX-MO was examined by using western blot analyses. We constructed a vector encoding GFP with an additional 5' sequence that is complementary to the sequence of NRX-MO (pCS2-NRX5'UTR-GFP). Embryos were co-injected with the above vector and NRX-MO or control MO, and the lysates were subjected to Western blot analyses with anti-GFP antibody. NRX-MO clearly suppressed the expression of GFP in a dose-dependent manner, whereas control MO did not (Fig. 3B). We then injected NRX-MO into the DA region of the eight-cell embryos. As a result, we observed a significant bent-axis phenotype (Fig. 3C,D,F). This phenotype was similar to that of embryos injected with MO against Idax, which also appears to regulate the Wnt/PCP pathway (Fig. 3E,F; Michiue et al. in preparation). As mentioned earlier, the bent-axis phenotype in Xenopus is caused both by the gain- and loss-of-function of PCP components (Wallingford et al. 2000; Darken et al. 2002). Therefore, the results obtained by injection of NRX mRNA or MO are consistent with the notion that NRX is probably involved in the Wnt/PCP pathway.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

  		Figure 3  Bent-axis phenotype caused by NRX-MO injection. (A) Total RNAs were collected from dissected stage 10 Xenopus embryos, and RT-PCR analyses for NRX were carried out (B) pCS2-NRX5'UTR-GFP (50 pg) and NRX-MO (5, 10 ng) or control MO (5, 10 ng) were injected, and the embryos were harvested and subjected to Western blot analyses. (C–E) Representative embryos with (C) no injection, (D) Idax-MO injection (10 ng), and (E) NRX-MO injection (10 ng). (F) The ratio of bent-axis phenotype by Idax- or NRX-MO injection.

 
We next carried out co-injection experiments with NRX mRNA and NRX-MO. The co-injection of NRX-MO clearly rescued the bent-axis phenotype observed in embryos injected with NRX mRNA alone, as well as Dvl mRNA co-injection (Fig. 4A–D). However, co-injection of β-catenin or GSK3β, well-characterized selective activator or inhibitor of the Wnt/β-catenin pathway, respectively, did not significantly alter the bent-axis phenotype induced by NRX mRNA injection (Fig. 4E–G). These results strongly suggest that NRX directly affects the Wnt/PCP pathway, but not indirectly through the suppression of the Wnt/β-catenin pathway. We also examined the expression of mesoderm marker Xenopus brachyury (Xbra) and confirmed that injection of neither NRX mRNA nor NRX-MO has significant effect on the expression pattern of Xbra (data not shown), suggesting the importance of NRX in the Wnt/PCP pathway.


Figure 4
View larger version (57K):
[in this window]
[in a new window]

  		Figure 4  Co-injection experiments with NRX mRNA and NRX-MO. (A–C) Representative embryos injected with (A) NRX mRNA alone (200 pg), (B) NRX mRNA and NRX-MO (5 ng), (C) NRX mRNA and Dvl mRNA (100 pg). (D) The ratio of bent-axis phenotype by injection of NRX mRNA alone, or with NRX-MO or Dvl mRNA. (E–G) Embryos injected with (E) NRX mRNA (500 pg) alone, (F) NRX (500 pg) and β-catenin (500 pg) mRNA, and (G) NRX (500 pg) and GSK3β (500 pg) mRNA. (H–J) Embryos injected with (H) Wnt11 mRNA alone (500 pg), (I) NRX-MO alone (5 ng), (J) Wnt11 mRNA (500 pg) and NRX-MO (5 ng).

 
To further confirm the physiological importance of NRX in the Wnt/PCP pathway, we also examined whether NRX functions cooperatively with Wnt11, a known Wnt ligand that governs the Wnt/PCP pathway (Heisenberg et al. 2000; Tada & Smith 2000). We injected Wnt11 mRNA and examined the effect of NRX co-injection. As reported previously, Wnt11 mRNA injection showed only weak dorsalizing effect (Glinka et al. 1996; Tada & Smith 2000). Actually, embryos injected with Wnt11 mRNA alone showed only weak bent-axis (Fig. 4H). However, NRX-MO co-injection with Wnt11 mRNA resulted in moderate or severe bent-axis phenotype even at the concentration of NRX-MO that can only induce weak bent-axis phenotype (Fig. 4I,J). This synergistic effect between Wnt11 mRNA and NRX-MO also strongly supports our idea that NRX is a component of the Wnt/PCP pathway.

NRX is required for convergent extension movements

Abrogation of the Wnt/PCP pathway in Xenopus is known to cause convergent extension errors, resulting in defects in gastrulation and the bent-axis phenotype (Wallingford et al. 2002). To evaluate the function of NRX in Xenopus convergent extension, we co-injected Alexa Fluor 488 with NRX mRNA or NRX-MO into the DA region. At stage 11, ectodermal cells were migrating toward the vegetal region with the involution of the mesoderm. At this stage, all embryos including NRX-MO-injected embryos showed a broad pattern of fluorescence throughout the presumptive ectoderm to the blastopore lip, and differences between embryos were not evident (Fig. 5, left column). After stage 11, migration of mesoderm had proceeded and, at stage 13, epiboly was almost complete, and the ectodermal cells had converged midiolaterally. As a result, control embryos injected with Alexa Fluor 488 alone showed a very narrow fluorescence pattern (Fig. 5, right column). However, NRX mRNA- or NRX-MO-injected embryos still showed a broad distribution of fluorescence, suggesting that there are defects in convergent extension of ectodermal cells in these embryos. NRX-MO-injected embryos showed open blastopores. Taken together, these results suggest that NRX is involved in epiboly.


Figure 5
View larger version (52K):
[in this window]
[in a new window]

  		Figure 5  Up-regulation/down-regulation of NRX causes convergent extension errors. Indicated mRNAs or MO were co-injected with Alexa 488 dye into dorsoanimal region (DA) of the 8 cell stage Xenopus eggs. Phase contrast images and Alexa 488 fluorescence signals at stages 11 and 13 are indicated.

 
We next carried out elongation assays with animal cap explants. In this in vitro culture model, elongation of animal cap explants in response to activin occurs as a result of convergent extension movements (Cunliffe & Smith 1992). Animal cap assays have been used to evaluate the possible effect on convergent extension. Animal cap cells were dissected from injected embryos and treated with 10 ng/mL activin A. We observed a significant elongation of animal caps derived from control (uninjected) embryos or LacZ mRNA- or control MO-injected embryos (Fig. 6A). However, animal caps derived from Dvl mRNA-, NRX mRNA- or NRX-MO-injected embryos elongated only slightly, indicating the importance of NRX in convergent extension movements. Animal cap elongation can also be affected by mesoderm induction (Cunliffe & Smith 1992). To exclude the possibility that the effect of NRX on animal cap elongation is due to mesoderm induction, we examined the expression of mesoderm marker genes by RT-PCR analysis of RNAs from animal cap explants. We found no significant difference in activin-induced expression of well-known mesoderm marker genes goosecoid (gsc) and Xbra after the injection of NRX mRNA or NRX-MO (Fig. 6B). Our data strongly suggest that NRX affects Xenopus gastrulation movements via regulation of convergent extension.


Figure 6
View larger version (86K):
[in this window]
[in a new window]

  		Figure 6  NRX mRNA/MO injection inhibits animal cap elongation. Indicated mRNAs or MOs were injected into the animal pole of the 8 cell stage Xenopus eggs. Animal caps were dissected, and cultured with/without activin. Representative images of animal caps are indicated with elongated ratios. (B) Total RNAs were collected from animal caps, and RT-PCR analyses were carried out with mesoderm markers Xbra and gsc. (C) Representative activin-treated animal caps from embryos injected with Xdd mRNA and/or NRX-MO.

 
To further examine the functional relationship between Dvl and NRX in convergent extension, we carried out animal cap explant assays using mRNA of Xdd, the central PDZ domain-lacking mutant form of Xenopus Dvl that shows a strong dominant-negative effect on convergent extension movements (Sokol 1996; Wallingford et al. 2000). As reported, Xdd mRNA-injected animal caps failed to elongate (Fig. 6C). However, we observed that the animal caps injected with both Xdd mRNA and NRX-MO elongated to the level comparable to that of noninjected animal caps (Fig. 6C). Considering that the injection of NRX-MO alone inhibits animal cap elongation (Fig. 6A), these data strongly support our notion that NRX functions antagonistically against Dvl in convergent extension movements.

Suppression of Dvl-induced c-Jun phosphorylation by NRX

Activation of the Wnt/PCP pathway induces JNK activation and subsequent phosphorylation of c-Jun (Boutros et al. 1998; Li et al. 1999; Moriguchi et al. 1999). Therefore, we examined the effect of NRX on c-Jun phosphorylation. When we expressed Dvl in mammalian cells, we observed a significant increase in phosphorylation of c-Jun (Fig. 7A, approximately 4.8-fold compared with cells expressing c-Jun alone). Expression of NRX reduced the phosphorylation of c-Jun.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

  		Figure 7  NRX suppresses c-Jun phosphorylation. NIH3T3 cells transfected with FLAG-c-Jun and indicated constructs were harvested, and their lysates were subjected to immunoblotting (IB) with indicated antibodies. The signal intensities of IB with anti-c-Jun (phospho Ser 63/73) were determined by densitometry and their relative values are indicated.

 
We next carried out co-expression experiments with Dvl and NRX. We found that Dvl-induced phosphorylation of c-Jun was reduced significantly by NRX (from 5.3-fold to 1.9-fold) as well as Par1b, a reported inhibitor of Dvl-induced c-Jun phosphorylation (Sun et al. 2001) (Fig. 7B).

Phosphorylation of c-Jun occurs downstream of Rac activation (Habas et al. 2003). To confirm that NRX exerts its effect on the Wnt/PCP pathway through Dvl (i.e., upstream of Rac), we carried out co-expression experiments with a dominant-active form of Rac (Rac G12V) and NRX. Expression of Rac G12V significantly increased the phosphorylation of c-Jun (Fig. 7C, approximately 2.2-fold). Co-expression of NRX did not suppress the c-Jun phosphorylation induced by Rac G12V at all. Taken together with the aforementioned Dvl/NRX co-expression data, we concluded that NRX exerts its inhibitory effect on c-Jun phosphorylation via Dvl, which is consistent with the direct interaction between these two proteins.


   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
In the present study, we investigated whether NRX influences the Wnt/PCP pathway as well as the Wnt/β-catenin pathway. On the basis of our results of all experiments (gross morphological analyses of embryos, visualization of convergent extension by Alexa Fluor dye injection, animal cap elongation assays in Xenopus and c-Jun phosphorylation experiments in mammalian culture cells), we concluded that NRX is a novel component in the Wnt/PCP pathway. Our previous characterization of NRX as a direct interacting molecule against Dvl (Funato et al. 2006), and the results from co-injection (Figs 2 and 4) and co-expression (Fig. 7B) experiments of Dvl and NRX suggest that NRX exerts its effect on the Wnt/PCP pathway via inhibition of Dvl activity. This idea is also supported by our findings that (i) animal cap elongation defect caused by inhibition of Dvl-function is rescued by NRX-MO co-injection (Fig. 6C), (ii) β-catenin or GSK3β mRNA co-injection did not rescue the bent-axis phenotype caused by NRX mRNA injection, whereas Dvl mRNA co-injection did (Fig. 4A–G), and (iii) NRX expression cannot suppress c-Jun phosphorylation induced by active form of Rac, Rac G12V (Fig. 7C).

We previously suggested the possibility that NRX functions as a selective inhibitor of the Wnt/β-catenin pathway because we could not detect any significant difference in Dvl-stimulated JNK-kinase activity even when NRX was over-expressed (Funato et al. 2006). However, the Dvl over-expression activated JNK-kinase activity only 2-fold, which may have masked the possible effect of NRX. In the present study, we examined activation of the PCP pathway by direct detection of phosphorylated c-Jun inside cells. With this method, we obtained much clearer activation of the Wnt/PCP pathway in response to Dvl over-expression. We found that c-Jun phosphorylation is increased approximately 4.8-fold over mock transfected cells (Fig. 7A), and therefore, we could observe the moderate but significant inhibitory effect of NRX (Fig. 7B). The data, along with the results of various analyses in Xenopus, support our conclusion that NRX participates in the Wnt/PCP pathway.

Among numerous Dvl-interacting proteins, Dapper/Frodo is reported to suppress both the Wnt/β-catenin signaling and the Wnt/PCP signaling (Cheyette et al. 2002). However, further examination of Dapper/Frodo showed that it functions as either a positive or negative regulator of the Wnt signaling pathway in a context-dependent manner (i.e., when expressed at low levels, Dapper/Frodo activates Wnt/β-catenin signaling Gloy et al. 2002; Hikasa & Sokol 2004). In contrast, NRX consistently inhibits both the Wnt/β-catenin and Wnt/PCP pathways irrespective of the expression level (Fig. 1 and Funato et al. 2006). Furthermore, Zhang et al. reported that Dapper/Frodo promotes Dvl degradation (Zhang et al. 2006), but NRX expression increases the amount of Dvl (Funato et al. 2006). Therefore, it appears that both Dapper/Frodo and NRX can negatively regulate both the Wnt/β-catenin and Wnt/PCP pathways, but they function in different manners.

How does NRX function as a negative regulator of the Wnt/PCP pathway? One possibility is that NRX may control phosphorylation of Dvl. Dvl phosphorylation is linked to Wnt/PCP pathway activation (Cong et al. 2004). In our previous study, we showed that NRX can suppress phosphorylation of Dvl (Funato et al. 2006). How this dephosphorylation or inhibition of phosphorylation occurs remains unclear; however, Lechward et al. reported that NRX can bind and activate protein phosphatase 2A (PP2A) (Lechward et al. 2006). Widerborst, a regulatory subunit of PP2A, is reported to activate PP2A phosphatase activity and to participate in Wnt/PCP signaling in both Drosophila and zebrafish in vivo (Hannus et al. 2002; Creyghton et al. 2005). Therefore, we speculate that NRX regulates the Wnt/PCP pathway by enhancing PP2A phosphatase activity and inducing dephosphorylation of Dvl.

We reported previously that NRX binds to the basic/PDZ domain of Dvl and competes out Frat, an activator of the Wnt/β-catenin pathway, from Dvl (Funato et al. 2006). Several molecules responsible for Wnt/PCP signaling, such as Vang/Stbm and Daam, are reported to bind to the PDZ domain of Dvl ((Habas et al. 2001; Park & Moon 2002). Therefore, it is also possible that NRX competes out these Dvl-PDZ domain-binding proteins, which should perturb the Wnt/PCP pathway. It will be interesting to investigate the mechanism by which NRX regulates the Wnt/PCP pathway in detail, which should be our future theme.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Constructs

cDNA constructs of human Dvl1, mouse NRX, human Par1b and human Rac1 are previously described (Funato et al. 2004, 2006; Terabayashi et al. 2007). Human c-Jun cDNA was generated from HEK293 cells mRNA with a standard RT-PCR method. pSP64T-Xwnt11 was a kind gift from Dr. Smith (Tada & Smith 2000). Xdd was generated from pCS2-Xdsh as described in the previous report (Sokol 1996). pCS2-NRX5'UTR-EGFP was constructed by inserting oligonucleotides into pCS2-EGFP, which was generated by insertion of EGFP fragment into EcoRI/XhoI site of pCS2.

Antibodies and materials

Anti-Myc rabbit polyclonal antibody, anti-GFP rabbit polyclonal antibody and anti-phospho c-Jun (Ser 63/Ser 73) rabbit polyclonal antibody were from Santa Cruz Biotechnology. Anti-FLAG mouse monoclonal antibody was from Sigma-Aldrich. Alexa 488 dye was from Invitrogen.

Injection experiments in Xenopus

Xenopus injection experiments were carried out according to the previous studies (Michiue et al. 2004; Funato et al. 2006). Briefly, in vitro fertilized Xenopus eggs were injected at the 4-cell to 8-cell stages with mRNAs or MOs. mRNAs were synthesized with mMassage mMachine Kit (Applied Biosystems). MOs were purchased from Gene tools. The sequences of MOs utilized were NRX-MO (against the 5'-UTR region of MGC84045, of which product protein shows 77% identity with mouse NRX protein): GCCTGGCCCCACCTCTCTTCTGTGT, Idax-MO: GCCT CTGGGAGTCATTTCTGTGCAT (The validity of Idax-MO is shown in the previous study (Michiue et al. 2004)), Control MO: CCTCTTACCTCAGTTACAATTTATA. These sequences do not match any other known Xenopus mRNAs. The observed bent-axis phenotypes are separated into "weak" (bent for less than 90 degrees), "moderate" (bent for 90 degrees or more) and "severe" (bent for 90 degrees or more and with spina bifida), respectively (Representative embryos are shown in Fig. 1H). Developmental stage was followed by normal table described by Nieuwkoop & Faber (1956).

Animal cap elongation assays

Animal cap assays were carried out according to Kobayashi et al. (Kobayashi et al. 2005). mRNAs or MOs were injected into the animal pole of eight-cell stage eggs. The animal caps were dissected from stage-8.5 embryos and cultured in 10 ng/mL activin A in 0.1% bovine serum albumin (BSA)/1 X Steinberg's solution. Activin A is prepared as previously described (Eto et al. 1987). Animal caps with elongation of more than its own diameter were counted as elongated.

RT-PCR

RT-PCR experiments were carried out as described previously (Michiue et al. 2004; Kobayashi et al. 2005). Total RNAs were prepared with Isogen (Wako Pure Chemical Industries, JAPAN), and cDNAs were synthesized with Superscript II (Invitrogen). The following primers were used: ornithine decarboxylase (ODC), 5'-GCCATTGTGAAGACTCTCTCCATTC-3' and 5'-TTCGG GTGATTCCTTGCCAC-3'; goosecoid (gsc), 5'-CACACAAAGT CGCAGAGTCTC-3' and 5'-GGAGAGCAGAAGTTGGGGCCA-3'; Xbrachyury (Xbra), 5'-AGCCTGTCTGTCAATGCTCC-3' and 5'-ACTGAGACACTGGTGTGATGG-3'; NRX (MGC84045), 5'-TCCCATACAGTGACGAAGCAAG-3' and 5'-ACAGGGTC CCTCATTTAATTGCAC-3'.

Cell culture and transfection

NIH3T3 murine fibroblasts were routinely maintained in our laboratory in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% calf serum and antibiotics. Cells were transfected with LipofectAmine2000 (Invitrogen) according to the manufacturers’ instructions.

Detection of c-Jun phosphorylation via immunoblotting

For detection of phosphorylated c-Jun, NIH3T3 cells were transfected with FLAG-tagged c-Jun together with various expression constructs and harvested 24 h later. The cells were rinsed once with ice-cold Tris-buffered saline (TBS) and harvested with ice-cold lysis buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100 and 1 mM phenylmethanesulfonyl fluoride). The lysates were centrifuged at 15 000 rpm for 10 min at 4 °C, and the supernatants were mixed with SDS sample buffer. Samples were separated by SDS-PAGE, and transferred to PVDF membranes (Millipore). Blocking was carried out with 10% BSA in TBS for 1 h at room temperature, and anti-phospho-c-Jun (Ser 63/Ser 73) antibody was diluted 1:2000 in TBS and incubated with the blot overnight at 4 °C. c-Jun phosphorylation was quantified with NIH Image software.


   Acknowledgements
 
We appreciate Dr Takuya Noguchi (University of Tokyo) for helpful advices with experiments monitoring phosphorylated c-Jun. This study was supported in part by Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


   Footnotes
 
Communicated by: Eisuke Nishida

* Correspondence: hmiki{at}protein.osaka-u.ac.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Axelrod, J.D., Miller, J.R., Shulman, J.M., Moon, R.T. & Perrimon, N. (1998) Differential recruitment of Dishevelled provides signaling specificity in the planar cell polarity and Wingless signaling pathways. Genes Dev. 12, 2610–2622.[Abstract/Free Full Text]

Boutros, M., Paricio, N., Strutt, D.I. & Mlodzik, M. (1998) Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94, 109–118.[CrossRef][Medline]

Cheyette, B.N., Waxman, J.S., Miller, J.R., Takemaru, K., Sheldahl, L.C., Khlebtsova, N., Fox, E.P., Earnest, T. & Moon, R.T. (2002) Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formation. Dev. Cell 2, 449–461.[CrossRef][Medline]

Ciani, L. & Salinas, P.C. (2005) WNTs in the vertebrate nervous system: from patterning to neuronal connectivity. Nat. Rev. Neurosci. 6, 351–362.[Medline]

Clevers, H. (2006) Wnt/beta-catenin signaling in development and disease. Cell 127, 469–480.[CrossRef][Medline]

Cong, F., Schweizer, L. & Varmus, H. (2004) Casein kinase Iepsilon modulates the signaling specificities of dishevelled. Mol. Cell. Biol. 24, 2000–2011.[Abstract/Free Full Text]

Creyghton, M.P., Roel, G., Eichhorn, P.J., Hijmans, E.M., Maurer, I., Destree, O. & Bernards, R. (2005) PR72, a novel regulator of Wnt signaling required for Naked cuticle function. Genes Dev. 19, 376–386.[Abstract/Free Full Text]

Cunliffe, V. & Smith, J.C. (1992) Ectopic mesoderm formation in Xenopus embryos caused by widespread expression of a Brachyury homologue. Nature 358, 427–430.[CrossRef][Medline]

Darken, R.S., Scola, A.M., Rakeman, A.S., Das, G., Mlodzik, M. & Wilson, P.A. (2002) The planar polarity gene strabismus regulates convergent extension movements in Xenopus. EMBO J. 21, 976–985.[CrossRef][Medline]

Eto, Y., Tsuji, T., Takezawa, M., Takano, S., Yokogawa, Y. & Shibai, H. (1987) Purification and characterization of erythroid differentiation factor (EDF) isolated from human leukemia cell line THP-1. Biochem. Biophys. Res. Commun. 142, 1095–1103.[CrossRef][Medline]

Funato, Y. & Miki, H. (2007) Nucleoredoxin, a novel thioredoxin family member involved in cell growth and differentiation. Antioxid. Redox Signal. 9, 1035–1057.[CrossRef][Medline]

Funato, Y., Terabayashi, T., Suenaga, N., Seiki, M., Takenawa, T. & Miki, H. (2004) IRSp53/Eps8 complex is important for positive regulation of Rac and cancer cell motility/invasiveness. Cancer Res. 64, 5237–5244.[Abstract/Free Full Text]

Funato, Y., Michiue, T., Asashima, M. & Miki, H. (2006) The thioredoxin-related redox-regulating protein nucleoredoxin inhibits Wnt-β-catenin signalling through dishevelled. Nat. Cell Biol. 8, 501–508.[CrossRef][Medline]

Glinka, A., Delius, H., Blumenstock, C. & Niehrs, C. (1996) Combinatorial signalling by Xwnt-11 and Xnr3 in the organizer epithelium. Mech. Dev. 60, 221–231.[CrossRef][Medline]

Gloy, J., Hikasa, H. & Sokol, S.Y. (2002) Frodo interacts with Dishevelled to transduce Wnt signals. Nat. Cell Biol. 4, 351–357.[Medline]

Habas, R., Kato, Y. & He, X. (2001) Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1. Cell 107, 843–854.[CrossRef][Medline]

Habas, R., Dawid, I.B. & He, X. (2003) Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for vertebrate gastrulation. Genes Dev. 17, 295–309.[Abstract/Free Full Text]

Hannus, M., Feiguin, F., Heisenberg, C.P. & Eaton, S. (2002) Planar cell polarization requires Widerborst, a B' regulatory subunit of protein phosphatase 2A. Development 129, 3493–3503.[Medline]

Heisenberg, C.P., Tada, M., Rauch, G.J., Saude, L., Concha, M.L., Geisler, R., Stemple, D.L., Smith, J.C. & Wilson, S.W. (2000) Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405, 76–81.[CrossRef][Medline]

Hikasa, H. & Sokol, S.Y. (2004) The involvement of Frodo in TCF-dependent signaling and neural tissue development. Development 131, 4725–4734.[Abstract/Free Full Text]

Keller, R.E., Danilchik, M., Gimlich, R. & Shih, J. (1985) The function and mechanism of convergent extension during gastrulation of Xenopus laevis. J. Embryol. Exp. Morphol. 89, 185–209.[Medline]

Kobayashi, H., Michiue, T., Yukita, A., Danno, H., Sakurai, K., Fukui, A., Kikuchi, A. & Asashima, M. (2005) Novel Daple-like protein positively regulates both the Wnt/β-catenin pathway and the Wnt/JNK pathway in Xenopus. Mech. Dev. 122, 1138–1153.[CrossRef][Medline]

Lechward, K., Sugajska, E., de Baere, I., Goris, J., Hemmings, B.A. & Zolnierowicz, S. (2006) Interaction of nucleoredoxin with protein phosphatase 2A. FEBS Lett. 580, 3631–3637.[CrossRef][Medline]

Li, L., Yuan, H., Xie, W., Mao, J., Caruso, A.M., McMahon, A., Sussman, D.J. & Wu, D. (1999) Dishevelled proteins lead to two signaling pathways. Regulation of LEF-1 and c-Jun N-terminal kinase in mammalian cells. J. Biol. Chem. 274, 129–134.[Abstract/Free Full Text]

Lillig, C.H. & Holmgren, A. (2007) Thioredoxin and related molecules—from biology to health and disease. Antioxid. Redox Signal. 9, 25–47.[CrossRef][Medline]

Michiue, T., Fukui, A., Yukita, A., Sakurai, K., Danno, H., Kikuchi, A. & Asashima, M. (2004) XIdax, an inhibitor of the canonical Wnt pathway, is required for anterior neural structure formation in Xenopus. Dev. Dyn. 230, 79–90.[CrossRef][Medline]

Moon, R.T., Kohn, A.D., De Ferrari, G.V. & Kaykas, A. (2004) WNT and β-catenin signalling: diseases and therapies. Nat. Rev. Genet. 5, 691–701.[CrossRef][Medline]

Moriguchi, T., Kawachi, K., Kamakura, S., Masuyama, N., Yamanaka, H., Matsumoto, K., Kikuchi, A. & Nishida, E. (1999) Distinct domains of mouse dishevelled are responsible for the c-Jun N-terminal kinase/stress-activated protein kinase activation and the axis formation in vertebrates. J. Biol. Chem. 274, 30957–30962.[Abstract/Free Full Text]

Nieuwkoop, P.D. & Faber, J. (1956) Normal Table of Xenopus laevis (Daudin). Amsterdam: North-Holland Publishing Company.

Park, M. & Moon, R.T. (2002) The planar cell-polarity gene stbm regulates cell behaviour and cell fate in vertebrate embryos. Nat. Cell Biol. 4, 20–25.[CrossRef][Medline]

Sokol, S.Y. (1996) Analysis of Dishevelled signalling pathways during Xenopus development. Curr. Biol. 6, 1456–1467.[CrossRef][Medline]

Strutt, D.I., Weber, U. & Mlodzik, M. (1997) The role of RhoA in tissue polarity and Frizzled signalling. Nature 387, 292–295.[CrossRef][Medline]

Sun, T.Q., Lu, B., Feng, J.J., Reinhard, C., Jan, Y.N., Fantl, W.J. & Williams, L.T. (2001) PAR-1 is a Dishevelled-associated kinase and a positive regulator of Wnt signalling. Nat. Cell Biol. 3, 628–636.[CrossRef][Medline]

Tada, M. & Smith, J.C. (2000) Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway. Development 127, 2227–2238.[Abstract]

Taylor, J., Abramova, N., Charlton, J. & Adler, P.N. (1998) Van Gogh: a new Drosophila tissue polarity gene. Genetics 150, 199–210.[Abstract/Free Full Text]

Terabayashi, T., Itoh, T.J., Yamaguchi, H., Yoshimura, Y., Funato, Y., Ohno, S. & Miki, H. (2007) Polarity-regulating kinase partitioning-defective 1/microtubule affinity-regulating kinase 2 negatively regulates development of dendrites on hippocampal neurons. J. Neurosci. 27, 13098–13107.[Abstract/Free Full Text]

Theisen, H., Purcell, J., Bennett, M., Kansagara, D., Syed, A. & Marsh, J.L. (1994) dishevelled is required during wingless signaling to establish both cell polarity and cell identity. Development 120, 347–360.[Abstract]

Vinson, C.R. & Adler, P.N. (1987) Directional non-cell autonomy and the transmission of polarity information by the frizzled gene of Drosophila. Nature 329, 549–551.[CrossRef][Medline]

Wallingford, J.B., Rowning, B.A., Vogeli, K.M., Rothbacher, U., Fraser, S.E. & Harland, R.M. (2000) Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405, 81–85.[CrossRef][Medline]

Wallingford, J.B., Fraser, S.E. & Harland, R.M. (2002) Convergent extension: the molecular control of polarized cell movement during embryonic development. Dev. Cell 2, 695–706.[CrossRef][Medline]

Wolff, T. & Rubin, G.M. (1998) Strabismus, a novel gene that regulates tissue polarity and cell fate decisions in Drosophila. Development 125, 1149–1159.[Abstract]

Zhang, L., Gao, X., Wen, J., Ning, Y. & Chen, Y.G. (2006) Dapper 1 antagonizes Wnt signaling by promoting dishevelled degradation. J. Biol. Chem. 281, 8607–8612.[Abstract/Free Full Text]

Received: 23 February 2008
Accepted: 18 June 2008





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Funato, Y.
Right arrow Articles by Miki, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Funato, Y.
Right arrow Articles by Miki, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS