| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Physics, Graduate School of Science, Nagoya University, Furo, Chikusa, Nagoya 464-8602, Japan
2 Center for Gene Research, Nagoya University, Furo, Chikusa, Nagoya 464-8602, Japan
3 Division of Biological Science, Graduate School of Science, Nagoya University, Furo, Chikusa, Nagoya 464-8602, Japan
4 RIKEN Harima Institute/SPring-8, 1-1-1, Kouto, Mikazuki, Sayo, Hyogo 679-5148, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
3 helix and wing region of Pex on in vitro DNA-binding activity and in vivo rhythm functions. Mutant AnaPex proteins carrying a substitution in the wing region displayed no specific DNA-binding activity, whereas those carrying a substitution in the 3 helix did display specific binding activity. But the latter were less thermostable than wild-type AnaPex and their in vitro functions were defective. We concluded that Pex binds a kaiA upstream DNA sequence via its wing region and that its 3 helix is probably important to its stability. |
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Cyanobacteria are the simplest organisms that exhibit circadian rhythms (Sweeney & Borgese 1989). The cyanobacterial system is regulated by three clock genes—kaiA, kaiB and kaiC (Ishiura et al. 1998). kaiB and kaiC constitute an operon, and kaiBC expression is regulated by both positive feedback through KaiA and negative feedback through KaiC (Ishiura et al. 1998). KaiA is a homodimer of known crystal structure (Uzumaki et al. 2004; Ye et al. 2004). KaiA interacts with KaiC via the C-terminal domain of KaiA and enhances the activity of KaiC phosphorylation (Iwasaki et al. 2002; Williams et al. 2002; Uzumaki et al. 2004). KaiB has an unusual homotetramer structure composed of two asymmetric dimers, as revealed by crystal structure (Hitomi et al. 2005; Iwase et al. 2005). KaiB is believed to attenuate the enhancing effect of KaiA on KaiC phosphorylation (Kitayama et al. 2003). KaiC is a homohexamer that has a hexagonal, pot-shaped structure composed of six identical dumbbell-shaped subunits as revealed by cryo-electron microscopy (Hayashi et al. 2003) and X-ray crystallography (Pattanayek et al. 2004). KaiC self phosphorylates and dephosphorylates (Iwasaki et al. 2002; Williams et al. 2002; Uzumaki et al. 2004). The level of KaiC phosphorylation oscillates in cyanobacterial cells (Iwasaki et al. 2002), and the phosphorylation–dephosphorylation rhythm of KaiC has been reconstituted in vitro by incubating KaiC with KaiA and KaiB in the presence of ATP (Nakajima et al. 2005).
The clock-related genes identified in cyanobacteria (Williams 2007) are the output pathway genes sasA (Iwasaki et al. 2000), rpaA (Takai et al. 2006b) and labA (Taniguchi et al. 2007), and the input pathway period-extender gene pex (Kutsuna et al. 1998; Takai et al. 2006a). pex was originally isolated as a genomic DNA segment that suppressed the short period (22 h) phenotype of the sp22 mutant (Kutsuna et al. 1998). Deletion of pex shortens the period by approximately 1 h whereas pex over-expression is associated with a long (28 h) period (Kutsuna et al. 1998). Because the level of kaiA mRNA is significantly higher in pex-deleted cells than in wild-type cells (Kutsuna et al. 2007), Pex may be a repressor that suppresses kaiA expression. Mutational analysis showed that a 5-bp cis-element (AGAGA) in the kaiA upstream region is essential to the negative regulation of kaiA by Pex (Kutsuna et al. 2007).
Pex has a PadR domain, which is conserved (approximately 30% similarity) among PadR proteins. In Pediococcus pentosaceus (Barthelmerbs et al. 2000) and Lactobacillus plantarum (Gury et al. 2004), PadR is a transcriptional regulator with DNA-binding activity. PadR proteins form a winged-helix structure (De Silva et al. 2005) that has, topologically, a compact /β structure consisting of three helixes and two β strands (Gajiwala et al. 2000). The N-terminal half of the winged-helix protein is largely helical, whereas the C-terminal half is composed of two β strands that form a twisted anti-parallel β sheet. A loop connects the twisted anti-parallel β sheet like the wings of a butterfly, inspiring the name. The co-crystal structure of the winged helix protein–DNA complex (transcription factor E2F-DP, Zheng et al. 1999; human regulatory factor X (hRFX) DNA-binding domain, Gajiwala et al. 2000) demonstrates that both the 3 helix and the wing region are important to the protein's DNA-binding properties.
Recently, the crystal structure of Synechococcus Pex with an N-terminal deletion (Synechococcus Pex (15–148)) has been solved (Arita et al. 2007). Pex is a homodimer forming a winged-helix structure and interacts with a DNA sequence in the kaiA upstream region (Arita et al. 2007).
Here, we solved the crystal structures of Anabaena Pex (AnaPex) and Synechococcus Pex (23–148) (SynPex-short) and compared each other. Using the DNase I protection and electrophoresis mobility shift assays on a Synechococcus kaiA upstream region, we determined the minimal DNA binding sequence they bind to. Based on the crystal structures, we predicted the amino acid residues essential for Pex's DNA-binding activity and examined the effects of various Ala-substitutions in the 3 helix and wing region of Pex on the DNA-binding activity of Pex in vitro. We showed that mutant AnaPex proteins carrying a substitution in the wing region displayed no specific DNA-binding activity, whereas those carrying a substitution in the 3 helix did display specific binding activity. But the latter were less thermostable than wild-type AnaPex, and their in vivo functions were defective.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
On gel filtration chromatography, AnaPex eluted as a single peak with an apparent molecular mass of 29 ± 1 kDa, corresponding to the molecular mass of a dimer (2.1 ± 0.1 mer); SynPex-short eluted as a single peak with an apparent molecular mass of 24 ± 1 kDa, corresponding to the molecular mass of a 1.6 ± 0.1 mer (data not shown). The findings suggest that AnaPex and SynPex-short exist as homodimers in solution. SynPex-long (full-length Synechococcus Pex, 1–148), however, eluted as two peaks with apparent molecular masses of 29 ± 7 kDa, corresponding to the molecular mass of a dimer (1.7 ± 0.4 mer), and 58 ± 6 kDa, corresponding to the molecular mass of a trimer or tetramer (3.4 ± 0.4 mer) (data not shown).
Structural analysis by X-ray crystallography
X-ray crystallography (Table 1) showed AnaPex to be composed of five -helixes (0, residues 3–11; 1, 20–33; 2, 38–49; 3, 56–69; 4, 93–113) and two β-strands (β1, 72–76; β2, 86–90) (Figs 1 and 2A). The winged-helix motif consists of 1–4 and β1–2. A loop connecting helixes 0 and 1 had three successive Pro residues (Fig. 2B) and is likely to be comparatively rigid. Based on the chemical components of the crystallization solution we used, 
is located near basic residues such as Arg82 and Arg86 in the wing region and Thr39 in the 2 helix (Fig. 2C). Those three residues (Arg82, Arg86 and Thr39) are conserved in the five cyanobacteria we examined (Fig. 1). We found regions of highly concentrated positive charges around the wing (Lys77, Lys78, Arg82, Arg84, Arg86 and Arg87) (Fig. 2D,E). The interface between the 1, 2 and 3 helixes was hydrophobic and included Ile24, Ile27, Leu28 and Leu31 in the 1 helix, Ala62, Phe65 and Leu66 in the 3 helix, and Leu41, Ile42 and Leu45 in the 2 helix (Fig. 2F).
|
|
|
atoms from residues 1 to 115. The most distinguished difference between the two chains was found in the wing region (β1 and β2) (Fig. 2G). Chains A and B were in close contact. There was a hydrogen bond between Tyr7 on the 0 helix of chain A and Gln98 on the 4 helix of chain B (Fig. 2H) (that between Tyr7 of chain B and Gln98 of chain A, too). Several hydrophobic residues were located at the interface between chains A and B; they include residues Ile6 and Phe10 in the 0 helix of chain A and Leu102, Leu105 in the 4 helix of chain B (Fig. 2H) (the reverse is also true). These residues are conserved in the five cyanobacteria species we examined (Fig. 1). Comparison of AnaPex with SynPex-short
SynPex-short (Table 1) also forms a homodimer of structurally similar chains A and B (the RMSD between the two chains is 0.596 Å for the C atoms from residues 1 to 115) (Fig. 3A). SynPex-short and AnaPex were similar in structure (the RMSD between them was 2.924; Fig. 3B), especially at the wing regions (the RMSD between residues 94 and 113 of SynPex-short and residues 72–91 of AnaPex was 0.747 for chain A (Fig. 3C) and 0.849 for chain B (data not shown)). The distinguished difference between SynPex-short and AnaPex was found in the inclination angle between chains A and B (Fig. 3B). Based on the chemical components of the crystallization solution used here, 
in place of in AnaPex is located near basic residues such as Arg104, Arg106 and Arg108 (corresponding to Arg82, Arg84 and Arg86 residues in AnaPex, respectively; Fig. 1) in the wing region and Thr61 (corresponding to Thr39 in AnaPex; Fig. 1) in 2 helix (data not shown).
|
In the absence of Pex, DNase I digested the DNA sense strand fragment, and variously sized DNA fragments were detected (Fig. 4A). Signal intensities from –61 to –66 (position 1 marks the translation initiation site (GTG)), corresponding to 168–173-bp fragments, were weak, suggesting that a secondary structure was inhibiting DNase I digestion. In the presence of 15 or 50 pmol SynPex-short, however, 168–197-bp DNA fragments could not be detected, suggesting that SynPex-short protected the strand from DNase I digestion (–37 to –66) (Fig. 4A).
|
SynPex-long also protected the sense strand from –66 to –37 and the anti-sense strand from –29 to –57, but 15 pmol SynPex-long conferred more limited protection than 15 pmol SynPex-short (Fig. 4A,B), suggesting that SynPex-long had lower DNA-binding activity. Neither 15 nor 50 pmol SynPex-long protected the anti-sense strand from –58 to –70 (Fig. 4B).
AnaPex (15 or 50 pmol), too, protected the sense strand from –66 to –37 and the anti-sense strand from –29 to –57 (Fig. 4A,B). It did not protect the anti-sense strand from –58 to –70 (Fig. 4B), but the Anabaena pex gene in vivo functioned in both circadian period extension and kaiA suppression in Synechococcus 
pex mutant cells (Fig. 5 and Table 2). Therefore, the protection of the anti-sense strand from –58 to –70 may not be essential for Pex function.
|
|
In summary, the DNA region protected by Pex, –66 to –37 of the sense strand and –57 to –29 of the anti-sense strand (Fig. 4F), and that required for Pex binding (–60 to –36) overlapped but were not identical.
Determination of the 5' terminus of kaiA mRNA
Primer extension analysis indicated that the cDNA comprised 183 bases (Fig. 4E, upper panel), indicating that the 5' terminus of Synechococcus kaiA mRNA, which is likely to be the transcription initiation site, was U at –56. Pex must therefore bind to a region around the Synechococcus kaiA transcription initiation site (Fig. 4E, bottom panel).
Structure–function analysis of Pex by the in vivo rhythm assay
In a pex genetic background, the PkaiBC::luxAB reporter shortened the bioluminescence rhythm period to 23.3 ± 0.1 h (n = 34) from the wild-type period of 24.3 ± 0.1 h (n = 33) (Fig. 5A and Table 2). The PkaiA::luxAB reporter shortened the period to 23.0 ± 0.1 h (n = 19) from the wild-type period of 24.3 ± 0.1 h (n = 15) (Fig. 5A and Table 2). These results were consistent with previous findings in our laboratory (Kutsuna et al. 1998). Transfer of the Synechococcus wild-type pex gene into a pex strain (pex + pexSyn) extended the period to 23.8 ± 0.2 h (n = 37), which was approximately 98% of the wild-type period (Fig. 5A and
Table 2), but for unknown reasons, the period length could not be recovered perfectly. Transfer of the wild-type Anabaena pex gene into a pex strain (pex + pexAna) extended the period length to 24.5 ± 0.2 h (n = 26) (Fig. 5A and Table 2). When transferred to the wild-type strain, Anabaena pex extended the period more than Synechococcus pex did (Fig. 5A and Table 2). We obtained similar results with PkaiA::luxAB and PkaiBC::luxAB (Fig. 5A and Table 2).
Over the time course of the rhythms, the level of bioluminescence from the PkaiA::luxAB reporter (the level of kaiA expression monitored as bioluminescence) in pex was twice the wild-type level (Fig. 5A and Table 2). Transfer of the Synechococcus wild-type pex gene into pex strains (pex + pexSyn) suppressed kaiA expression almost to the wild-type level (139% of wild type) (Fig. 5A and Table 2). The level of kaiA expression could not be recovered as well as the period length. Transfer of the wild-type Anabaena pex gene (pex +
pexAna) also extended period length and suppressed the level of kaiA expression to the wild-type level, with activity that exceeded that of the Synechococcus pex gene in the wild-type strain and that of the Synechococcus pex gene in the pex strain (Fig. 5A and Table 2). We obtained similar results in three independent experiments (Fig. 5A–C).
Pex has a winged-helix motif, which is a well-known DNA-binding motif. The co-crystal structure of other winged helix protein and DNA (Zheng et al. 1999; Gajiwala et al. 2000) demonstrated that both the 3 helix and wing region of the protein are important to its DNA-binding activities. To establish whether both the 3 helix and wing region of Pex play important roles in the DNA binding activity of Pex, we examined some mutant Pex proteins carrying an Ala-substitution in the 3 helix or wing region of Pex. Cells expressing AnaPexL66A in place of Synechococcus Pex had a shortened period with both PkaiBC::luxAB (22.9 ± 0.1 h, n = 53) and PkaiA::luxAB (23.1 ± 0.1 h, n =
36) reporters and expressed higher levels of kaiA, much like pex cells (Fig. 5B and Table 2). Thus, AnaPexL66A lacked in vivo Pex function. Cells expressing AnaPexK64A or AnaPexF65A had a slightly shortened period with the PkaiBC::luxAB reporter (23.5 ± 0.1 h, n = 47; 23.4 ± 0.1 h, n = 57) (Fig. 5B and Table 2). We observed little or no difference in either bioluminescence rhythms or the level of kaiA expression monitored as bioluminescence among mutant cells carrying the T57A, Y60A, E67A or D68A mutation or between the wild-type and mutant cells (Fig. 5A,B,
Table 2).
Cells expressing AnaPexR84A showed a shortened period with both the PkaiBC::luxAB reporter (22.8 ± 0.1 h, n = 37) and the PkaiA::luxAB (23.0 ± 0.1 h, n = 29) reporter, much like pex cells, and a higher level of kaiA expression (Fig. 5C and Table 2). Cells expressing AnaPexR87A in place of Synechococcus Pex showed a slightly shortened circadian period with the PkaiBC::luxAB reporter (23.4 ± 0.1 h, n = 46) and the PkaiA::luxAB reporter (23.3 ± 0.1 h, n = 32) (Fig. 5C,
Table 2). Cells expressing AnaPexK78A (23.5 ± 0.1 h, n = 38 and 23.8 ± 0.1 h, n = 39) and AnaPexR86A (23.9 ± 0.1 h, n = 43 and 23.8 ± 0.1 h, n =
22) in place of Synechococcus Pex were phenotypically similar to wild-type AnaPex (Fig. 5C and Table 2). Cells expressing mutant AnaPexK78A/R84A/R86A/R87A were phenotypically similar to pex cells expressing AnaPexR84A (Fig. 5C and Table 2). Thus, both the 3 helix and the wing region played important roles in in vivo Pex function.
DNA-binding activity and thermostability of Pex
Although AnaPex mutants carrying an Ala-substitution in the 3 helix (AnaPexT57A, AnaPexY60A, AnaPexK64A, AnaPexF65A and AnaPexL66A) could bind to oligonucleotide Seq-1A-6 (Fig. 6A), those carrying an Ala-substitution in the wing region (AnaPexK78A, AnaPexR84A, AnaPexR86A and AnaPexR87A) could not (Fig. 6A), even when the concentration of the mutant AnaPexK78A was increased to 2.0 µM (Fig. 6B).
|
3 helix (AnaPexF65A, AnaPexL66A), in contrast, showed greatly reduced thermostability (Tm
values: AnaPexF65A, 50.7 ± 0.9 °C; AnaPexL66A, 43.0 ± 0.4 °C) (Table 3).
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Pex interacted with DNA via its wing region, not its 3 helix (Fig. 6A), whereas the winged-helix proteins hRFX and E2F-DP interact with DNA via both the wing region and the 3 helix (Zheng et al. 1999; Gajiwala et al. 2000). Therefore, although Pex has a winged-helix structure, its mechanism for DNA recognition may differ from that of hRFX and E2F-DP. Pex differs from other winged-helix proteins in the linker region between 2 and 3 and in dimer subunit arrangement, as reported previously (Arita et al. 2007).
Pex bound to the same 25-bp kaiA upstream sequence (Fig. 4C) (5'-atttttcctttgtccagagattaat-3') that was previously identified as the Pex binding sequence (Arita et al. 2007). The 5-bp AGAGA segment is a cis-element required for the negative regulation of kaiA by Pex (Kutsuna et al. 2007). In P. pentosaceus, PadR binds to a DNA sequence that contains the padAR promoter region and a perfect inverted repeat sequence (tttatgttgataacaacataaa). A similar inverted repeat sequence is found around the promoter region of the padA genes from L. plantarum, Bacillus subtilis, and B. pumilus (Barthelmerbs et al. 2000). In human, a hRFX protein binds to an inverted repeat sequence with variable spacing between two half-sites (5'-cgttaccaggtaactg-3') (Gajiwala et al. 2000). Its protein–DNA complex is perfectly symmetrical with a crystallographic twofold axis passing through the center of the DNA. Because the Pex binding sequence determined here (Fig. 4) has an imperfect inverted repeat sequence (5'-atttttcctttgtccagagattaat-3'), it will be interesting to see how Pex recognizes it—a question that will be solved when the crystal structure of Pex–DNA complex is determined.
Our determination of the 5'-terminus of kaiA mRNA as –56 (Fig. 4E) means that Pex binds near the kaiA transcription initiation site (–60 to –36) (Fig. 4A–D). In a previous study (Kutsuna et al. 2007), we assigned the kaiA transcriptional initiation site to –66 using radio-labeled primers, and we do not know the reason for the discrepancy. We proposed that the recognition and binding of Pex to a DNA sequence containing the kaiA transcription initiation site suppresses the transcription of kaiA as a repressor (Kutsuna et al. 2007). The binding region of P. pentosaceus PadR is also found near the transcription initiation site (Barthelmerbs et al. 2000).
Even though AnaPexL66A carrying an Ala-substitution in the 3 helix was able to bind to DNA in vitro, Synechococcus cells expressing the mutant AnaPexL66A had defects in both extending the circadian period and repressing kaiA expression (Figs 5 and 6A), as did pex. Synechococcus cells expressing AnaPexF65A were also somewhat defective in those Pex functions (Figs 5 and 6A). The in vitro thermostabilities of the AnaPex mutants were low compared with the wild type (Fig. 6C), and that instability probably accounts for the loss of Pex function in vivo. The region around the Phe65 and Leu66 residues of AnaPex is mostly hydrophobic (Fig. 2F). The hydrophobic properties of those residues are highly conserved in the five cyanobacterial Pex proteins we examined (Fig. 1), suggesting that the hydrophobic core is essential to Pex structure. In fact, as described above, an Ala-substitution at either Phe65 or Leu66 reduced AnaPex thermostability (Fig. 6C). The hydrophilic residues in the 3 helix (Thr57, Tyr60, Lys64, Glu67 and Asp68), in contrast, are located on the surface of Pex (Fig. 2F).
An Ala substitution in the wing region of AnaPex mutants did not affect Pex thermostability (Fig. 6C). Positively charged amino acid residues in the wing region were highly concentrated, and those residues (Lys78, Arg84, Arg86 and Arg87) were all involved in DNA-binding (Fig. 6A). This was consistent with the crystal structure of AnaPex, where Arg86 was coordinated with (Fig. 2C). We think that Arg86 may coordinate with the negatively charged phosphate groups in DNA. Our finding that each Ala-substitution in the wing region greatly reduced AnaPex DNA-binding activity (Fig. 6A,B) indicated that the specific DNA sequence was recognized by the positively charged residues. The effect of those Ala-substitutions in vivo, however, was different: Synechococcus cells expressing AnaPexR84A had the same phenotype as pex, whereas cells expressing AnaPexR87A were partially defective in both extending the circadian period and suppressing kaiA expression. In contrast, cells expressing AnaPexK78A or AnaPexR86A showed essentially the same phenotype as wild-type AnaPex. These results suggest that Pex could function in vivo even though its in vitro DNA-binding activity was greatly reduced. Although we could not detect in vitro DNA-binding activity by EMSA, AnaPexK78A, AnaPexR86A and AnaPexR87A should interact with the specific DNA sequence at least weakly in vivo.
The PadR protein family has some conserved motifs with unknown function, including LN9GY(D/E), YN2(L/I) and (K/R)(K/N)N(Y/F)NNTNNG (Huillet et al. 2006); those motifs partially conserved in Pex (Fig. 1) include LYVLLQGESYGTE (residues 28–40 in 1 and 2 helixes of AnaPex), YSAI (residues 60–63 in 3 helix of AnaPex) and RRMYQVSPEW (residues 86–95 in β2 strand of AnaPex). Both Leu23 in the first motif and Leu63 in the second motif are located around the Phe65 and Leu66 residues. As described above, the hydrophobic contact around the Phe65 and Leu66 residues is essential to AnaPex structure (Fig. 6C) and in vivo function (Fig. 5). An Ala substitution at either Arg86 or Arg87 in the third motif (RRMYQVSPEW) of AnaPex resulted in the loss of DNA-binding activity (Fig. 6A). Because is assigned to near the Arg86 residue in the third motif in crystal (Fig. 2C), and because AnaPex mutants carrying an Ala-substitution in the wing region lost DNA-binding activity (Fig. 6A), the third motif is probably involved in DNA-binding activity.
Recently, it was reported that mutants of Synechococcus Pex (15–148) carrying an Ala-substitution at residue 104, 106 or 108 (corresponding to residue 84, 86 or 88 in AnaPex) located in the wing region lost the DNA-binding activity detected by EMSA (Arita et al. 2007), whereas mutants carrying an Ala-substitution at residue 82, 84, 86 or 90 (corresponding to residue 62, 63, 66 or 70 in AnaPex) located in the 3 helix could bind to DNA (Arita et al. 2007). Synechococcus cells expressing mutant Synechococcus Pex (15–148) carrying an Ala-substitution at Arg106 (corresponding to AnaPexR84A) showed an abnormal bioluminescence rhythm with a period 1 h shorter than wild type, as did pex (Arita et al. 2007). Those results are consistent with the results we reported here.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
We subcloned pex genes derived from Synechococcus sp. strain PCC 7942 (SynPex-long, residues 1–148), the N-terminal deletion mutant of Synechococcus Pex (SynPex-short, residues 23–148), and Anabaena sp. strain PCC 7120 Pex (AnaPex) into expression vector pGEX-6P-1 (GE Healthcare, Buckinghamshire, UK) at the BamHI–EcoRI site. We constructed plasmids expressing AnaPex with a single Ala substitution at Thr57, Tyr60, Lys64, Phe65, Leu66, Lys78, Arg84, Arg86 or Arg87 by PCR-mediated in vitro mutagenesis (Hayashi et al. 2004b), yielding, respectively, AnaPexT57A, AnaPexY60A, AnaPexK64A, AnaPexF65A, AnaPexL66A, AnaPexK78A, AnaPexR84A, AnaPexR86A and AnaPexR87A. We similarly constructed a plasmid expressing AnaPex with Ala substitutions at Lys78, Arg84, Arg86 and Arg87, yielding AnaPexK78A/R84A/R86A/R87A. We introduced the plasmids into Escherichia coli BL21 and grew the cells in Luria–Bertani broth or Terrific broth. Wild-type and mutant Pex proteins were expressed as fusion proteins of glutathione-S-transferase (GST) and were prepared as described previously (Hayashi et al. 2003). We estimated yield using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA).
Molecular weight determination
We estimated the molecular weight of Pex by gel filtration chromatography at 4 °C on a Superdex 75 column (GE Healthcare) equilibrated with 20 mM Tris–HCl (pH 7.5) containing 1 mM DTT and 150 mM NaCl. We used bovine serum albumin (66 kDa), carbonic anhydrase (29 kDa) and cytochrome c (12.4 kDa) as molecular mass standards. We detected proteins absorbance at 280 nm (A280).
Structure determination
We carried out the first screening for crystallization at 4, 10 and 20 °C using Crystal Screens I and II (Hampton Research, Aliso Viejo, CA) and Wizard I and II (Emerald BioSystems, Inc., Bainbridge Island, WA). We obtained AnaPex crystals belonging to the space group P212121 ( = β = 
= 90°) (Table 1) in 0.85 M (NH4)3PO4 and 0.1 M Na citrate (pH 5.0) at 4 °C and prepared the platinum derivatives by soaking the crystals in a solution containing 1–10 mM PtCl4. We obtained SynPex-short crystals belonging to the space group P63 ( = β = 90°, = 120°) (Table 1) in 1.26 M (NH4)2SO4, 0.1 M Tris–HCl (pH 8.5) and 0.2 M Li2SO4 at 10 °C.
We measured X-ray diffraction at beamlines SPring8-BL26B1 and -BL41XU, where a single crystal kept at –173 °C was exposed to a monochromatic X-ray beam with a flux rate of approximately 5 x 1012 photons/mm2/s. We collected diffraction data using a CCD detector (ADSC Quantum 4) with an oscillation range of 1° and an X-ray flux of approximately 1 x 1013 photons/mm2/image. We used MOSFLM 6.1 (Steller et al. 1997) for the indexing and integration of diffraction spots and scaled the data using SCALA in the CCP4 program suite (Collaborative Computating Project Number 4, 1994).
We solved the crystal structure of AnaPex at 1.7 Å resolution by the SIRAS (single isomorphous replacement with anomalous scattering) method (Blow & Rossmann 1961) and refined it with CNS (Brunger et al. 1998). We solved the crystal structure of SynPex-short at 2.9 Å resolution by the molecular replacement method (Rossmann 1990). The figures were generated by PYMOL (DeLano 2002). We have deposited the coordinates for AnaPex (2DQL) and SynPex-short (2ZFW) in the protein databank of the Research Collaboratory for Structural Bioinformatics.
DNase I protection assay
We determined Pex-binding sequences on the upstream region of Synechococcus kaiA with the DNase I protection assay (Galas & Schumitz 1978) using Genetic Analyzer 3100-Avant (Applied Biosystems, Tokyo, Japan) and 6-carboxyfluorescein (6-FAM)-labeled DNA sequences. We prepared double-stranded (ds) DNA fragments of a 6-FAM-labeled 365-bp upstream kaiA sequence by the polymerase chain reaction (PCR) using KOD polymerase (Toyobo, Osaka, Japan) and either a primer pair of 6-FAM-labeled PkA_FP-F (5'-cattttcagccgtagaggtggcta-3') and non-labeled PkA_FP-R (5'-atactccaagagcatttcgccaga-3') (for sense strand labeling) or a primer pair of non-labeled PkA_FP-F and 6-FAM-labeled PkA_FP-R (for anti-sense strand labeling). We purified the 6-FAM-labeled dsDNA fragments using a GENECLEAN III Kit (Qbiogene, Morgan Irvine, CA). Reaction mixtures contained 1.5 µL 10 x DNase I Buffer (Takara Bio, Ohtsu, Japan), 1 µL 70% (w/v) glycerol (Sigma, Tokyo, Japan), 1 µL 100 mM DTT (Invitrogen, Tokyo, Japan), 1 µL 0.1% (w/v) BSA (Takara Bio), 15 or 50 pmol Pex (AnaPex, SynPex-short, or SynPex-long) and 500 fmol of the 6-FAM-labeled dsDNA fragments contained in 14 µL. We incubated the mixtures at 30 °C for 1 h, added 1 µL 0.5 U/µL DNase I (Takara Bio), and incubated them further at 25 °C for 2 min. We then added 400 µL ice-cold 99.5% ethanol (Sigma) to stop the reaction. We recovered the precipitated DNase I-digested DNA fragments by centrifugation, washed them with 70% ethanol, and dissolved them in 10 µL Hi-Di Formamide (Applied Biosystems). We added 0.5 µL LIZ-labeled single-stranded DNA standard (GeneScan-600LIZ Size Standard; Applied Biosystems) to the solution, incubated it at 95 °C for 3 min, cooled it on ice for 2 min, and applied it to the Genetic Analyzer with a filter set G5. We also carried out the sequencing reaction using non-labeled PkA_FP-F primer or non-labeled PkA_FP-R primer and a BIGDYE TERMINATOR v1.1 Cycle Sequencing Kit (Applied Biosystems) and applied the sequencing products along with the GeneScan-600LIZ size standard to the Genetic Analyzer with filter set E5. We used GENEMAPPER software v4.0 (Applied Biosystems) to estimate the sizes of the DNase I-protected DNA fragments and the sequencing products, and we then compared them.
Primer extension of kaiA mRNA
We determined the transcription initiation site of Synechococcus kaiA by the primer extension method (Sambrook et al. 1989) using 6-FAM-labeled primers and the Genetic Analyzer as follows. We isolated DNase I-treated total RNA from Synechococcus cells using an RNeasy Mini Kit (Qiagen KK, Tokyo). A reaction mixture contained 20 nM of 6-FAM-labeled PkA_PE-R2 primer (5'-actccaagagcatttcgccag-3'), and 30 µg of total RNA in 21 µL RNase-free water. We incubated the mixture at 70 °C for 5 min, cooled it on ice for 5 min, incubated it at 25 °C for 15 min, and then added 6 µL 5 x First Strand Buffer (Invitrogen), 1 µL 100 mM DTT, 1 µL each of 10 mM dNTPs (GE Healthcare), and 1 µL 200 U/µL reverse transcriptase (Superscript II; Invitrogen). We incubated the mixture at 42 °C for 1 h, added 200 U fresh enzyme, and similarly carried out a second reverse transcriptase reaction to enrich the concentration of reaction products. After the reaction, we added 1 µL 10 ng/µL RNaseA (Sigma) and incubated the reaction mixture at 37 °C for 15 min. We precipitated the 6-FAM-labeled cDNAs with 99.5% ethanol, washed them with 70% ethanol, and then dissolved them in 10 µL Hi-Di Formamide. We added 0.5 µL GeneScan-600LIZ Size Standard and incubated the reaction mixture at 95 °C for 3 min, cooled it on ice for 2 min, and applied it to the Genetic Analyzer with filter set G5. We also carried out the sequencing reaction using a non-labeled PkA_PE-R2 primer and a BIGDYE TERMINATOR v1.1 Cycle Sequencing Kit and loaded the sequencing products along with GeneScan-600LIZ onto the Genetic Analyzer with filter set E5. We estimated the sizes of the cDNAs and the sequencing products.
Analysis of in vitro DNA-binding activity
We used the electrophoretic mobility shift assay (EMSA) (Sambrook et al. 1989) to analyze the DNA-binding activity of Pex. Oligonucleotides containing various regions of the kaiA upstream sequence (Fig. 4D) were synthesized and purified by Hokkaido System Science (Sapporo, Japan). The dsDNAs were prepared by annealing after the mixing of complementary oligonucleotides in a 1 : 1 molar ratio. The dsDNAs were incubated (0.2 µM final concentration) with various concentrations of wild-type or mutant Pex proteins in 20 mM Tris–HCl (pH 7.5) buffer containing 5 mM MgCl2, 2 mM DTT and 10% glycerol. Aliquots of the reaction mixtures were subjected to electrophoresis at 4 °C on a 6% polyacrylamide gel in 45 mM Tris–borate buffer containing 1 mM EDTA (pH 8.2). The DNA bands in the gel were stained with SYBR Green I (Cambrex, Rockland, ME) and analyzed by Gel Documentation System (model AE-6911, ATTO, Tokyo) with a SYBR Green Gel Stain Photographic Filter (Cambrex).
In vivo bioluminescence rhythm assay
We maintained Synechococcus cells in BG-11 liquid medium (BG-11; Rippka et al. 1979; Castenholz 1988) or on BG-11 solid medium containing 1.5% Bacto Agar (Nippon BD, Tokyo) under constant light conditions at 42 µmol/m2/s from white fluorescent lamps. We constructed a chimeric pex gene (pexAna) consisting of a Synechococcus promoter (nucleotides (nt) 7–540 in AB009574
[GenBank]
) and an Anabaena coding region (nt 4 793 740–4 794 087 in BA000019
[GenBank]
). We mutated the chimeric gene by PCR-mediated site-directed in vitro mutagenesis (Hayashi et al. 2004a). We introduced either wild-type Synechococcus pex (pexSyn; complementary to nt 671 981–673 001 in CP000100
[GenBank]
), wild-type pexAna, or mutated pexAna into TS2 (Ishiura et al. 1998) in the genome of a pex-deleted (pex) Synechococcus strain (Kutsuna et al. 1998) carrying a PkaiBC:: luxAB reporter gene or a PkaiA:: luxAB reporter gene (Ishiura et al. 1998).
We measured circadian rhythms at 30 °C under constant light conditions using a bioluminescence monitoring apparatus (Okamoto et al. 2005a) and the RAP program (Okamoto et al. 2005b), as described previously (Onai et al. 2004).
Heat denaturation curve
We measured the circular dichroism (CD) spectra and denaturation curves of wild-type and mutant AnaPex proteins (AnaPexF65A, AnaPexL66A, AnaPexK78A, AnaPexR84A and AnaPexR87A) and calculated their thermostability (Tm) as described previously (Hayashi et al. 2006). Briefly, we incubated 3 µM protein in 20 mM Tris–HCl buffer (pH 7.5) containing 50 mM NaCl and measured the CD spectra at 222 nm as we increased the temperature by 1 °C/min from 25 to 70 °C. We used a spectropolarimeter equipped with a thermally jacketed quartz cuvette with a 1-mm path length (Jasco JA-720W, Jasco, Japan).
|
Acknowledgements |
|---|
This work was supported by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT) and the "National Project on Protein Structural and Function Analysis" promoted by MEXT. The Division of Biological Science, Graduate School of Science, Nagoya University, was supported by a 21st Century Center of Excellence grant from MEXT.
|
Footnotes |
|---|
These authors contributed equally to this work. 
Present address: Graduate School of Science, Kyoto University, Kitashirakawa, Sakyo, Kyoto 606-8502, Japan.
Present address: Graduate school of Engineering, Gunma University, 1-5-1 Tenjin, Kiryu, Gunma 376-8515, Japan.
* Correspondence: kouyama{at}bio.phys.nagoya-u.ac.jp or ishiura{at}gene.nagoya-u.ac.jp |
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Barthelmerbs, L., Lecomte, B., Divies, C. & Cavin, J.F. (2000) Inducible metabolism of phenolic acids in Pediococcus pentosaceus is encoded by an autoregulated operon which involves a new class of negative transcriptional regulator. J. Bacteriol. 182, 6724–6731.
Blow, D.M. & Rossmann, M.G. (1961) The single isomorphous replacement technique. Acta Crystallogr. 14, 1195–1202.[CrossRef]
Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros, P., Grosse-Kunstleve, R.W., Jiang, J.S., Kuszewski, J., Nilges, M. & Pannu, N.S. (1998) Crystallography and NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D5, 905–921.
Bünning, E. (1973) The Physiological Clock: Circadian Rhythms and Biological Chronometry, 3rd edn. New York: Springer-Verlag.
Castenholz, R.W. (1988) Culturing methods for cyanobacteria. Methods Enzymol. 167, 68–93.[CrossRef]
Collaborative Computating Project Number 4 (1994) Programs for protein crystallography. Acta Crystallogr. D50, 760–763.
De Silva, R.S., Kovacikova, G., Lin, W., Taylorm R.K., Skorupski, K. & Kull, F.J. (2005) Crystal structure of the virulence gene activator AphA from Vibrio cholerae reveals it is a novel member of the winged helix transcription factor superfamily. J. Biol. Chem. 280, 13779–13783.
DeLano, W.L. (2002) The PyMOL Molecular Graphics System. San Carlos, CA: DeLano Scientific.
Gajiwala, K.S., Chen, H., Cornille, F., Roques, B.P., Reith, W., Mach, B. & Burley, S.K. (2000) Structure of the winged-helix protein hRFX1 reveals a new mode of DNA binding. Nature 403, 916–921.[CrossRef][Medline]
Galas, D. & Schumitz, A. (1978) DNAse footprinting: a simple method for the detection of protein–DNA binding specificity. Nucleic Acids Res. 5, 3157–3170.
Gury, J., Barthelmebs, L., Tran, N.P., Divies, C. & Cavin, J.F. (2004) Cloning, deletion, and characterization of PadR, the transcriptional repressor of the phenolic acid decarboxylase-encoding padA gene of Lactobacillus plantarum. Appl. Environ. Microbiol. 70, 2146–2153.
Hayashi, F., Ito, H., Fujita, M., Iwase, R., Uzumaki, T. & Ishiura, M. (2004a) Stoichiometric interactions between cyanobacterial clock proteins KaiA and KaiC. Biochem. Biophys. Res. Commun. 316, 195–202.[CrossRef][Medline]
Hayashi, F., Itoh, N., Uzumaki, T., Iwase, R., Tsuchiya, Y., Yamakawa, H., Morishita, M., Onai, K., Itoh, S. & Ishiura, M. (2004b) Roles of two ATPase-motif-containing domains in cyanobacterial circadian clock protein KaiC. J. Biol. Chem. 279, 52331–52337.
Hayashi, F., Iwase, R., Uzumaki, T. & Ishiura, M. (2006) Hexamerization by the N-terminal domain and intersubunit phosphorylation by the C-terminal domain of cyanobacterial circadian clock protein KaiC. Biochem. Biophys. Res. Commun. 348, 864–872.[CrossRef][Medline]
Hayashi, F., Suzuki, H., Iwase, R., Uzumaki, T., Miyake, T., Shen, J.R., Imada, K., Furukawa, Y., Yonekura, K., Namba, K. & Ishiura, M. (2003) ATP-induced hexameric ring structure of the cyanobacterial circadian clock protein KaiC. Genes Cells 8, 287–296.[Abstract]
Hitomi, K., Oyama, T., Han, S., Arvai, A.S. & Getzoff, E.D. (2005) Tetrameric architecture of the circadian clock protein KaiB. A novel interface for intermolecular interactions and its impact on the circadian rhythm. J. Biol. Chem. 280, 19127–19135.
Huillet, E., Velge, P., Vallaeys, T. & Pardon, P. (2006) LadR, a new PadR-related transcriptional regulator from Listeria monocytogenes, negatively regulates the expression of the multidrug efflux pump MdrL. FEMS Microbiol. Lett. 254, 87–94.[CrossRef][Medline]
Ishiura, M., Kutsuna, S., Aoki, S., Iwasaki, H., Andersson, C.R., Tanabe, A., Golden, S.S., Johnson, C.H. & Kondo, T. (1998) Expression of a gene cluster kaiABC as a circadian feedback process in cyanobacteria. Science 28, 1519–1523.
Iwasaki, H., Nishiwaki, T., Kitayama, Y., Nakajima, M. & T. Kondo (2002) KaiA-stimulated KaiC phosphorylation in circadian timing loops in cyanobacteria. Proc. Natl. Acad. Sci. USA 99, 15788–15793.
Iwasaki, H., Williams, S.B., Kitayama, Y., Ishiura, M., Golden, S.S. & Kondo, T. (2000) A kaiC-interacting sensory histidine kinase, SasA, necessary to sustain robust circadian oscillation in cyanobacteria. Cell 10, 223–233.
Iwase, R., Imada, K., Hayashi, F., Uzumaki, T., Morishita, M., Onai, K., Furukawa, Y., Namba, K. & Ishiura, M. (2005) Functionally important substructures of circadian clock protein KaiB in a unique tetramer complex. J. Biol. Chem. 280, 43141–43149.
Kitayama, Y., Iwasaki, H., Nishiwaki, T. & Kondo, T. (2003) KaiB functions as an attenuator of KaiC phosphorylation in the cyanobacterial circadian clock system. EMBO J. 22, 2127–2134.[CrossRef][Medline]
Kondo, T. & Ishiura, M. (1999) The circadian clocks of plants and cyanobacteria. Trends Plant Sci. 4, 171–176.[CrossRef][Medline]
Kutsuna, S., Kondo, T., Aoki, S. & Ishiura, M. (1998) A period-extender gene, pex, that extends the period of the circadian clock in the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol. 180, 2167–2174.
Kutsuna, S., Kondo, T., Ikegami, H., Uzumaki, T., Katayama, M. & Ishiura, M. (2007) The circadian clock-related gene pex regulates a negative cis element in the kaiA promoter region. J. Bacteriol. 189, 7690–7696.
Nakajima, M., Imai, K., Ito, H., Nishiwaki, T., Murayama, Y., Iwasaki, H., Oyama, T. & Kondo, T. (2005) Reconstitution of circadian oscillation of cyanobacterial KaiC phosphorylation in vitro. Science 308, 414–415.
Okamoto, K., Onai, K., Furusawa, T. & Ishiura, M. (2005a) A portable integrated automatic apparatus for the real-time monitoring of bioluminescence in plants. Plant Cell Environ. 28, 1305–1315.[CrossRef]
Okamoto, K., Onai, K. & Ishiura, M. (2005b) RAP, an integrated program for monitoring bioluminescence and analyzing circadian rhythms in real time. Anal. Biochem. 340, 193–200.[CrossRef][Medline]
Onai, K., Morishita, M., Itoh, S., Okamoto, K. & Ishiura, M. (2004) Circadian rhythms in the thermophilic cyanobacterium Thermosynechococcus elongatus: compensation of period length over a wide temperature range. J. Bacteriol. 186, 4972–4977.
Pattanayek, R., Wang, J., Mori, T., Xu, Y., Johnson, C.H. & Egli, M. (2004) Visualizing a circadian clock protein: crystal structure of KaiC and functional insights. Mol. Cell 15, 375–388.[CrossRef][Medline]
Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M. & Stanier, R.Y. (1979) Generic assignments, strain histories, and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111, 1–61.
Rossmann, M.G. (1990) The molecular replacement method. Acta Crystallogr. A46, 73–82.
Sambrook, J., Fritsch, E.F. & Maniatis, T. (eds) (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Steller, I., Bolotovsky, B. & Rossmann, M.G. (1997) An algorithm for automatic indexing of oscillation images using Fourier analysis. J. Appl. Cryst. D30, 1036–1040.[CrossRef]
Sweeney, B.M. & Borgese, M.B. (1989) A circadian rhythm in cell division in a prokaryote, the cyanobacterium Synechococcus WH7803. J. Phycol. 25, 183–186.[CrossRef]
Takai, N., Ikeuchi, S., Manabe, K. & Kutsuna, S. (2006a) Expression of the circadian clock-related gene pex in cyanobacteria increases in darkness and is required to delay the clock. J. Biol. Rhythms 21, 235–244.
Takai, N., Nakajima, M., Oyama, T., Kito, R., Sugita, C., Sugita, M., Kondo, T. & Iwasaki, H. (2006b) A KaiC-associating SasA-RpaA two-component regulatory system as a major circadian timing mediator in cyanobacteria. Proc. Natl. Acad. Sci. USA 103, 12109–12114.
Taniguchi, Y., Katayama, M., Ito, R., Takai, N., Kondo, T. & Oyama, T. (2007) labA: a novel gene required for negative feedback regulation of the cyanobacterial circadian clock protein KaiC. Genes Dev. 21, 60–70.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.
Uzumaki, T., Fujita, M., Nakatsu, T., Hayashi, F., Shibata, H., Itoh, N., Kato, H. & Ishiura, M. (2004) Crystal structure of the C-terminal clock-oscillator domain of the cyanobacterial KaiA protein. Nat. Struct. Mol. Biol. 11, 623–631.[CrossRef][Medline]
Williams, S.B. (2007) A Circadian timing mechanism in the cyanobacteria. Adv. Microb. Physiol. 52, 229–296.[Medline]
Williams, S.B., Vakonakis, I., Golden, S.S. & LiWang, A.C. (2002) Structure and function from the circadian clock protein KaiA of Synechococcus elongatus: a potential clock input mechanism. Proc. Natl. Acad. Sci. USA 99, 15357–13562.
Ye, S., Vakonakis, I., Ioerger, T.R., LiWang, A.C. & Sacchettini, J.C. (2004) Crystal structure of circadian clock protein KaiA from Synechococcus elongatus. J. Biol. Chem. 279, 20511–20518.
Zheng, N., Fraenke, L.E., Pabo, C.O. & Pavletich, N.P. (1999) Structural basis of DNA recognition by the heterodimeric cell cycle transcription factor E2F-DP. Genes Dev. 13, 666–674.
Accepted: 24 September 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
of AnaPex. The 
