GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2009) 14, 155-166. doi:10.1111/j.1365-2443.2008.01262.x
© 2009 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirano, Y.
Right arrow Articles by Horigome, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Hirano, Y.
Right arrow Articles by Horigome, T.

Proteomic and targeted analytical identification of BXDC1 and EBNA1BP2 as dynamic scaffold proteins in the nucleolus

 Yasuhiro Hirano1,*, Kohei Ishii2, Masahiro Kumeta1, Kazuhiro Furukawa2, Kunio Takeyasu1 and Tsuneyoshi Horigome2,*

1 Graduate School of Biostudies, Kyoto University, Yoshida-konoe-cho, Kyoto 606-8501, Japan
2 Graduate School of Science and Technology, Niigata University, Igarashi-2, Niigata 950-2181, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The nuclear matrix has classically been assumed to be a solid structure coherently aligning nuclear components, but its real nature remains obscure. We separated the proteins in a ribonucleoprotein-containing nuclear matrix fraction of HeLa cells by reversed-phase HPLC followed by SDS-PAGE, and identified 83 proteins through peptide mass fingerprint (PMF) analysis. Many nucleolar proteins, classical nuclear matrix proteins, RNA binding proteins, cytoskeletal proteins and five uncharacterized proteins were identified in this fraction. Four of the latter proteins were localized to the cell nucleus, BXDC1 and EBNA1BP2 being especially localized to the nucleolus. Fluorescence recovery after photobleaching and RNAi knockdown analyses suggested that BXDC1 and EBNA1BP2 function in a dynamic scaffold for ribosome biogenesis.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
The genome is tightly packed in the interior of the cell nucleus forming DNA–protein complexes such as chromatin. The nuclear interior is divided into two regions: the chromosome territory, the region occupied by chromatin and the interchromatin space, defined as the entire nuclear interior except the chromosome territory (Cremer & Cremer 2001). It is known that the interchromatin space is spatially and functionally compartmentalized, and contains nuclear bodies and speckles such as the nucleolus (Andersen et al. 2005; Pendle et al. 2005), promyelocytic leukemia (PML) (Zhong et al. 2000), Cajal bodies (Gall 2000) and nuclear speckles (Lamond & Spector 2003). Proteins important for particular nuclear functions tend to be specifically localized to nuclear bodies and speckles rather than to be spread throughout the nucleus (Lamond & Spector 2003; Stein et al. 2003). These nuclear bodies and speckles drastically change their macroscopic morphology, for example, number and shape, in response to cell cycle progression, differentiation, development and other environmental changes. Although the microscopic mechanisms underlying the formation and maintenance of these structures are not yet fully understood, the idea that the nuclear matrix exists as a structural framework for the interchromatin space and thereby contributes to spatial organization of the nuclear compartments has been proposed (Pederson 1998, 2000).

The nuclear matrix has been biochemically defined as an insoluble structure as to detergent- and high salt-extraction followed by removal of chromatin (Fey et al. 1986). From electron (Fey et al. 1986) and atomic force (Yoshimura et al. 2003; Hirano et al. 2008) microscopic observations, it has been expected that the nuclear matrix consists of filamentous structures, and functions as a scaffold for DNA packing and regulation of the genome function. Indeed, DNA binds to this scaffold structure via a matrix-attached region (MAR)/scaffold-attached region (SAR) that contains an AT-rich sequence, forms a scaffolding-loop structure, and then is packed into the nucleus (Glazko et al. 2003).

Several interesting candidate components which form the scaffold structure have been revealed by analysis involving two-dimensional electrophoresis in combination with protein identification (Fey et al. 1986; Gerner et al. 1998). The nuclear lamina is a well-studied scaffold structure in the nucleus consisting of A- and B-type lamin (Fawcett 1966; Gruenbaum et al. 2003). Topoisomerase II{alpha} (Christensen et al. 2002; Maeshima & Laemmli 2003; Tsutsui et al. 2005), enhanced adult sensory threshold (EAST) protein (Wasser & Chia 2000) and SATB1 protein (Cai et al. 2003) also form filamentous and/or cage-like structures and perhaps play a role in attachment of chromatin. The nuclear matrix consists of not only proteins but also RNA, as the filamentous structure of the nuclear matrix is mostly disrupted by RNase A treatment (Fey et al. 1986). In contrast, the proteins which are considered to form the nuclear matrix move relatively quickly in the nucleus, suggesting that the nuclear matrix is a dynamic structure rather than a steady and solid structure (Christensen et al. 2002). Therefore, proteome analysis of a nuclear matrix fraction, including ribonucleoprotein (RNP), would be critical for revealing what the nuclear matrix is, and how the nuclear matrix functions in the packing and regulation of the genome.

In this study, we analyzed proteins included in a RNP-containing nuclear matrix fraction of HeLa cells by the peptide mass fingerprint (PMF) method and identified 83 proteins including five novel ones. Two of the latter proteins were suggested to be components of a dynamic scaffold for ribosome biogenesis.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Protein composition of the RNP-containing nuclear matrix

Six milligrams of a RNP-containing nuclear matrix fraction (Fey et al. 1986) was subjected to two sequential isolation steps; reversed-phase HPLC on a polymer-based reversed phase column followed by SDS-PAGE with an exponential gradient gel (Kikuchi et al. 1997; Segawa et al. 2005) (Fig. 1). Coomassie Brilliant Blue R250 (CBB) staining revealed 138 components, including a protein as large as 200 kDa. The separated proteins were excised, digested with trypsin, and then analyzed by the PMF method using matrix-assisted laser desorption ionization-time of flight/mass spectrometry (MALDI-TOF/MS). Eighty-three of the 138 isolated proteins could be identified (Fig. 1 and Supporting Table S1). The major components found on SDS-PAGE, that is, bands 47, 53, 61, 68, 69 and 75, were lamin A/C, lamin B1, vimentin, keratin 18, keratin 8 and β-actin, respectively, which are all filamentous proteins. The localizations (Fig. 2A) and functions (Fig. 2B) predicted by the Human Protein Reference Database (HPRD) suggested that (i) 80% of the proteins identified (66 of 83 proteins) were nuclear ones and seven of them were known as nuclear matrix proteins (Fig. 1, bands 34, 47, 53, 61, 62, 68 and 80), and (ii) 72% of the proteins (60 of 83 proteins) were structural and RNA binding ones. Namely, the nuclear matrix fraction mainly consists of RNA-binding proteins, nuclear filaments, cytoskeleton and partially nucleolar proteins as many ribosomal proteins were identified. The inclusion of nucleolar proteins in this fraction is consistent with that RNase treatment was omitted in the preparation of the nuclear matrix fraction in this study to obtain a nuclear matrix fraction containing nucleolar scaffold proteins. It is known that a nucleoli-containing nuclear matrix structure is observed on electron microscopy when the matrix is prepared without RNase-treatment (Fey et al. 1986).


Figure 1
View larger version (61K):
[in this window]
[in a new window]

  		Figure 1  Identification of HeLa cell nuclear matrix proteins. A HeLa cell nuclear matrix fraction (6 mg) was separated by reversed-phase high performance liquid chromatography (HPLC) on a Poros 10R1 column (7.5 mm x 75 mm) equilibrated with solvent A (60% formic acid, 0.1% trifluoroacetic acid (TFA), v/v). Proteins were eluted with a 140-min linear gradient from 5% to 40% of solvent B (33% n-butanol, 60% formic acid, 0.1% TFA, v/v) at 1.5 mL/min. The eluate was fractionated. A half of each fraction was separated by SDS-PAGE with an exponential gradient gel, and the gel was stained with CBB. The numbers next to protein bands correspond to the protein numbers in Supporting Table S1. Examples of identified proteins are indicated in the bottom table.

 

Figure 2
View larger version (40K):
[in this window]
[in a new window]

  		Figure 2  Subcellular localization and known or deduced functions of proteins detected in the nuclear matrix fraction. (A) The 83 proteins found in the nuclear matrix fraction were classified based on their subcellular localization. Subcellular localization was examined with the Human Protein Reference Database (HPRD). (B) The 83 proteins identified in the nuclear matrix fraction were classified based on their known or deduced functions. Molecular functions were examined with the HPRD. The numbers in parentheses indicate the numbers of proteins in each category.

 
Interestingly, five proteins, that is, similar to hnRNPG (shnRNPG), chromosome 19 open reading frame 21 gene product (C19orf21), steroidogenic acute regulatory protein (STAR), EBNA1 binding protein 2 (EBNA1BP2) and brix-domain containing 1 (BXDC1), were uncharacterized ones (Fig. 1, bands 3, 16, 27, 48 and 56, respectively). These uncharacterized proteins were transiently expressed in HeLa cells as green fluorescent protein (GFP)-fused molecules (Fig. 3). BXDC1 and EBNA1BP2 were localized to the nucleolus, especially the granular component (GC). STAR was localized to the nuclear envelope and nucleoplasm. shnRNPG was observed in both the nuclear and cytoplasmic regions. In the nucleoplasm, shnRNPG was excluded from the heterochromatic region. C19orf21 was localized to the cytoplasm with a filamentous or speckle structure.


Figure 3
View larger version (30K):
[in this window]
[in a new window]

  		Figure 3  Subcellular localization of uncharacterized proteins detected. The cDNAs for proteins of which the cellular localizations were not known were fused to green fluorescent protein (GFP) and transiently expressed in HeLa cells as described under "Experimental procedures". The cells were fixed and counter-stained DNA with DAPI. Then, the cells were observed by fluorescence microscopy. Control indicates cells expressing GFP. Bar: 10 µm.

 
BXDC1 and EBNA1BP2 tightly associate with the nucleolus

Immuno-staining revealed that endogenous BXDC1 and EBNA1BP2 were localized to the GC region in nucleoli like the GFP-fused proteins (Fig. 4A,B). During mitosis, both proteins were dispersed throughout the cell at the prophase, although some of them were on the chromosome surface until the anaphase. At the beginning of the telophase, the proteins gradually associated with the pre-nucleolar bodies (PNB), and were finally localized to the nucleolus. This mitotic behavior was comparable to those of well-known GC proteins such as B23 and nucleolin. When cells were sequentially treated with a detergent, high-salt buffer and DNase-I, GFP-BXDC1 and EBNA1BP2 remained in the nuclear matrix, whereas other well-known nucleolar proteins, that is, B23, nucleolin and fibrillarin, were eluted out at the detergent-, high-salt buffer- and DNase-I-treatment steps, respectively (Fig. 4C). Namely, the properties of GFP-BXDC1 and EBNA1BP2 were similar to those of endogenous proteins, at least as to the localization and the resistance to chemical extraction.


Figure 4
View larger version (50K):
[in this window]
[in a new window]

  		Figure 4  Characterization of GFP-BXDC1 and EBNA1BP2. (A and B) Intra-cellular localization of BXDC1 and EBNA1BP2. Endogenous BXDC1 (A, upper panels) and EBNA1BP2 (B, upper panels) in HeLa cells were immuno-stained with their specific antibodies. GFP-BXDC1 (A, bottom panels) and EBNA1BP2 (B, bottom panels) were expressed in HeLa cells. The cells were fixed and counter-stained with DAPI. Cells in the inter-phase and undergoing mitosis were observed by conventional fluorescence microscopy. Bars: 10 µm. (C) GFP-BXDC1 and EBNA1BP2 are nuclear matrix proteins. GFP-tagged fibrillarin, nucleolin, B23, BXDC1 and EBNA1BP2 were expressed in HeLa cells. Cells were sequentially treated with a detergent, high-salt buffer and DNase-I, and then stained with propidium iodide. The nuclear matrices were observed by confocal fluorescence microscopy. Bars: 10 µm.

 
The mobility of these proteins within the nucleolus was measured by fluorescence recovery after photobleaching (FRAP) (Fig. 5A, see pre- and after-bleach). The mobilities of GFP-B23 and histone H3 was rapid and slow, respectively (Fig. 5A, B23 and histone H3), whereas those of GFP-BXDC1 and EBNA1BP2 were significantly slower than that of GFP-B23, but still faster than that of GFP-histone H3 (Fig. 5A). When an entire nucleolus was photobleached and fluorescence recoveries were determined by exponential curve fitting (Fig. 5B, see Experimental procedures for details), different kon values were obtained for BXDC1 (7.75 x 10–2 s–1) and EBNA1BP2 (1.89 x 10–1 s–1), whereas the koff values for BXDC1 (8.06 x 10–3 s–1) and EBNA1BP2 (9.18 x 10–3 s–1) were similar. The residence times represented by 1/koff of these proteins were 124 and 109 s, respectively. The mobilities of BXDC1 and EBNA1BP2 in the nucleolus were slower than that of the ribosomal component S5 (Chen & Huang 2001).


Figure 5
View larger version (61K):
[in this window]
[in a new window]

  		Figure 5  Dynamics of BXDC1 and EBNA1BP2. GFP-tagged BXDC1, EBNA1BP2, B23 and histone H3 were transiently expressed in HeLa cells. These proteins were photobleached, and the fluorescence recoveries were imaged and quantified as described under "Experimental procedures". (A) Intra-nucleolar dynamics of EBNA1BP2 and BXDC1. Time series images of pre-bleaching, and 0, 10 and 300 s after photobleaching (left panels), and the fluorescence recovery curves for each protein (right panel) are shown. These images are indicated as ratios. Dotted circles indicate bleached regions. The means of the relative intensities of the bleached areas are indicated with the SD (n = 6). Bars: 10 µm. (B) Kinetic analysis. One of the nucleoli in a cell was photobleached, and then fluorescence recoveries were imaged and quantified. The obtained curves were fitted as described under "Experimental procedures", and the association rate (kon), dissociation rate (koff), and residence time (1/koff) were calculated, respectively. The means of the relative intensities of the bleached areas are indicated with the SD (n = 3). Bars: 10 µm.

 
Knockdown of BXDC1 and EBNA1BP2 with RNAi

Specific siRNAs against BXDC1 and EBNA1BP2 (Fig. 6A,D, lane 2), and control siRNA against luciferase (Fig. 6A,D, lane 1) were introduced into HeLa cells, and the knockdown efficiencies (approximately 90%) were determined by Western blotting with anti-BXDC1 and EBNA1BP2 antibodies (Fig. 6A,D). Approximately 90% of BXDC1 and EBNA1BP2 were knocked down, and none of the siRNAs affected the protein amounts of EBNA1BP2 and BXDC1, respectively. The behavior of nucleolar marker proteins, that is, 2-30C antigen (fibrillar center (FC) marker, our unpublished observation), fibrillarin (dense fibrillar component (DFC) marker), and B23 and nucleolin (granular component (GC) markers), showed that the FC region became to resemble big dots compared with in control cells (Fig. 6B,C for BXDC1, and Fig. 6E,F for EBNA1BP2; arrows). Then, we determined the numbers of FC among the control, BXDC1 and EBNA1BP2-knocked-down cells (Fig. 6G, black, white and gray bars, respectively). The average number of FC in the control cells was 22.6 ± 7.4, whereas those in the BXDC1 and EBNA1BP2-knocked-down cells were 12.8 ± 5.3 and 12.9 ± 5.2, respectively (P < 0.001, Student's t-test), indicating that the number of FC were clearly decreased in both BXDC1 and EBNA1BP2-knocked-down cells. A cap-like structure that is observed in the rDNA transcription-inhibited nucleolus with actinomycin D (Hernandez-Verdun 2006) was also observed at a low frequency (Fig. 6C, arrowhead and 6H).


Figure 6
View larger version (35K):
[in this window]
[in a new window]

  		Figure 6  Knockdown of BXDC1 and EBNA1BP2 with RNAi. (A and D) siRNAs for BXDC1 (A) and EBNA1BP2 (D) were introduced into HeLa cells, respectively, followed by incubation at 37 °C for 48 h. Total cell lysates of 1.0 x 105 luciferase siRNA- (lane 1) and specific siRNA-transfected (lane 2) cells were prepared and analyzed by Western blotting using anti-BXDC1, anti-EBNA1BP2 and anti-β-actin antibodies. (B and E) The siRNAs for BXDC1 (B) and EBNA1BP2 (E) were introduced into HeLa cells stably expressing GFP-B23. The transfected cells were immunostained with anti-nucleolar protein antibodies (2-30C antigen, fibrillarin and nucleolin; red). Merged images of GFP-B23 and 2-30C antigen in B and E are magnified in C and F, respectively. Arrows and arrowheads indicate a FC-associated phenotype and a cap-like structure, respectively. Bars in B and E, and C and F: 20 and 10 µm, respectively. (G) Numbers of FC among BXDC1- and EBNA1BP2-knocked-down cells. BXDC1 and EBNA1BP2 were knocked down as described in (A and D). After immunostaining with 2-30C (FC marker), images were taken by confocal microscopy. The numbers of FC in control (136 cells)-, and BXDC1 (127 cells)- and EBNA1BP2 (111 cells)-knocked-down cells in the images were determined and a histogram was shown. (H) Frequency of a cap-like structure. Control, BXDC1 and EBNA1BP2-knocked down HeLa cells showing the cap-like structure were counted in three independent experiments and the frequencies were determined (P < 0.05).

 
BXDC1 and EBNA1BP2 associate with the nucleolus in an RNA-dependent manner

From the above results, we hypothesized that these proteins associate with RNA in the nucleolus. To test this possibility, we treated GFP-BXDC1 and GFP-EBNA1BP2 expressing HeLa cells with RNase A, and then carried out fluorescence microscopy after staining with antibodies against B23 and nucleolin (Fig. 7A). B23 is known to be a single strand RNP (Dumbar et al. 1989), and nucleolin binds to rRNA and several ribosomal proteins (Bouvet et al. 1998; Allain et al. 2000). As can be seen in Fig. 7A, the fluorescence signals of BXDC1, EBNA1BP2 and B23 disappeared on pre-treatment with RNase. In contrast, the signal of nucleolin was not affected by this treatment (Fig. 7A). When GFP-BXDC1 and GFP-EBNA1BP2 expressing HeLa cells were treated with a low concentration of actinomysin D, which selectively inhibits rRNA synthesis, these proteins moved faster than under the control conditions (Fig. 7B).


Figure 7
View larger version (45K):
[in this window]
[in a new window]

  		Figure 7  BXDC1 and EBNA1BP2 associate with the nucleolus in an RNA-dependent manner. (A) GFP-tagged BXDC1 and EBNA1BP2 expressing HeLa cells were treated with RNase. After fixation, B23 and nucleolin were probed with their specific antibodies. Confocal microscopic images are shown. Bars: 10 µm. (B) GFP-tagged BXDC1 and EBNA1BP2 expressing HeLa cells were treated with a low concentration of actinomycin D (40 ng/µL) at 37 °C for 2 h to suppress RNA polymerase I. GFP-tagged BXDC1 and EBNA1BP2 were photobleached and then their intra-nucleolar mobilities were quantified as in Fig. 5.

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
We directly demonstrated in this study that approximately half of the proteins in the nuclear matrix fraction were RNPs (55%), the remaining half consisting of cytoskeletal proteins (10%), structural proteins such as lamins, keratins, vimentin and actin (7%), and enzymes and others (22%). The proteins other than the structural proteins seem to participate in the formation of speckle and filamentous structures in the nuclear interior in collaboration with RNAs. The core RNA that forms the nuclear matrix should be identified in the future, although mRNA, and rRNA and small nucleolar RNA (snoRNA) are candidate components of the nucleoplasm and nucleolus, respectively.

Nucleolar proteins BXDC1 and EBNA1BP2 function in a dynamic scaffold

BXDC1 contains a Brix domain, which is found in a number of eukaryotic proteins from yeast and human. The Brix domain proteins can be classified into six families, which comprise one archaean and five eukaryotic protein ones (Eisenhaber et al. 2001). The biological functions of some proteins in this superfamily in ribosome biogenesis and rRNA binding have been suggested, this being consistent with our present results for BXDC1-knocked-down HeLa cells, in which the number of FC was decreased compared with in control cells (Fig. 6). It has been reported that the number of FC is related to the rRNA transcription activity in the nucleolus. From the findings that BXDC1 binds to the nucleolus in an RNA-dependent manner (Fig. 7A) and that the mobility of BXDC1 becomes faster on the inhibition of rRNA synthesis (Fig. 7B), we propose that BXDC1 may be recruited onto newly synthesized rRNA, form a stable complex with the rRNA, and then participate in rRNA maturation. Importantly, a BXDC1-containing complex is a functional structure which would behave as a "dynamic scaffold" for some ribosome biogenesis processes. This "dynamic scaffold" protein is functional itself, whereas it forms a core structure that accelerates the association of its binding proteins and provides bases for functions. Previous reports on the Saccharomyces cerevisiae homologue of BXDC1, Rpf2p (Morita et al. 2002; Zhang et al. 2007), support our model. It was reported that (i) Rpf2p binds to Rrs1p, which is an essential protein for the maturation of 25S rRNA and 60S ribosomal subunit assembly, and ribosomal proteins L5 and L11, (ii) Rpf2p is required for the processing of 27SB into 25S rRNA, and (iii) Rpf2p loads L5, L11 and 5S rRNA into 90S pre-ribosomal particles containing 35S pre-rRNA. Then, BXDC1 would tightly bind to and stay with rRNA for a long time to participate in both rRNA processing and ribosomal protein assembly as a dynamic scaffold.

However, EBNA1BP2 was identified as an Epstein–Barr virus Nuclear Antigen 1 (EBNA1) binding protein (Shire et al. 1999). Interestingly, Ebp2p, a S. cerevisiae homologue of EBNA1BP2, also binds to Rrs1p, and is required for pre-rRNA processing and ribosomal subunit assembly (Tsujii et al. 2000). Although EBNA1BP2 moved faster than BXDC1 in the nucleolus, the mobility of EBNA1BP2 was also relatively slower than that of other nucleolar proteins (Fig. 5). In addition, the molar ratio of BXDC1 and EBNA1BP2 in the nuclear matrix fraction was 1.0, as judged on densitometry after SDS-PAGE. Thus, EBNA1BP2 could also function as a dynamic scaffold protein, especially in the same ribosome biogenesis process(es) with BXDC1.

Mechanism underlying nuclear matrix formation

It has been suggested that the nuclear matrix consists of immobile filamentous proteins and its binding partners (Fig. 8A). Recently, several dynamic models of nuclear compartments have been proposed. A self-organization model for nuclear assembly suggested that nuclear bodies are largely the result of the sum of many, likely transient and non-specific, interactions among resident proteins (Misteli 2005). With a regulated-exchange model for nuclear speckles, the speckles are formed through a process of self-assembly, which might not depend on an underlying scaffold structure (Lamond & Spector 2003). In these models, scaffolding proteins are not essential for the formation and maintenance of nuclear bodies and speckles (Fig. 8B).


Figure 8
View larger version (16K):
[in this window]
[in a new window]

  		Figure 8  Models of nuclear matrix formation. (A) Immobile structure-based model. (B) Dynamic model. (C) Dynamic scaffold-based model. A "dynamic scaffold" protein (pink) functions as a core structure, whereas the protein itself is dynamically exchanged.

 
Our current results suggest that the nuclear matrix, at least the nucleolus, contains slow mobility proteins based on RNA. From these results, we propose a model for the nuclear matrix structure, that is, the nuclear matrix is a functional RNA–RNP complex-based structure and some proteins included in this structure are responsible for the dynamic scaffold (Fig. 8C). The key features of our proposed model are (i) the nuclear matrix structure could be formed based on the dynamic scaffold proteins and their binding partners (proteins and nucleic acids), and (ii) the dynamic scaffold proteins themselves functionally assemble/disassemble in a spatio-temporal dependent manner. It is reasonable that the nuclear matrix fraction used in this study contained ribonucleoprotein complexes including some of the nucleolus. The nuclear matrix was originally considered to be a scaffold for expression of the genome function. Therefore, the concept should be applicable to all nuclear regions such as the nucleolus and the nuclear speckles, that is, not only the nucleoplasm. With our data, BXDC1 and EBNA1BP2 may function as a scaffold for ribosome biogenesis in the nucleolus. Although we unfortunately could not identify a candidate for a functional scaffold in other nuclear compartments, previous reports suggested some candidates for the functional scaffold in other nuclear compartments, as follows. Our model is compatible with the gene-regulatory-machinery model in which a nuclear body, the RUNX body, comprises a scaffold protein, RUNX and many associated signaling proteins (Zaidi et al. 2005), and that AML-1, ALL-1, PCNA and BRCA1 also act as scaffold proteins in specific nuclear bodies (Stein et al. 2003). Although the location of gene-regulatory-machineries is limited to DNA in the chromatin territory, our findings suggest that scaffold proteins would also be present and function in inter-chromatin regions.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Preparation of a ribonucleoprotein-containing nuclear matrix fraction

A ribonucleoprotein-containing nuclear matrix fraction was purified from HeLa S3 cells according to the method of Fey et al., briefly as follows (Fey et al. 1986). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma, St. Louis, MO) containing 10% fetal bovine serum (FBS, HyClone) at 37 °C and under 5% CO2. The cells were washed with phosphate-buffered saline (PBS) and collected by centrifugation at 650 g. After washing with PBS at 4 °C, the cells were resuspended in cytoskeleton (CSK) buffer (10 mM PIPES [pH 6.8], 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 2 mM vanadyl adenosine, 0.5% Triton X-100) and incubated at 4 °C for 3 min. After centrifugation at 650 g, the pellet was resuspended in an extraction buffer (10 mM PIPES [pH 6.8], 250 mM ammonium sulfate, 300 mM sucrose, 3 mM MgCl2, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 2 mM vanadyl adenosine, 0.5% Triton X-100) and incubated at 4 °C for 5 min. After centrifugation at 650 g, the precipitate was resuspended in a buffer identical to CSK buffer but containing only 50 mM NaCl and 100 µg/mL DNase I, and then incubated at 20 °C for 20 min. The resulting suspension was centrifuged at 1000 g for 5 min. The resulting precipitate is known to contain ribonucleoprotein-containing nuclear matrix and cytoplasmic filaments (Fey et al. 1986). In this paper, we call this fraction the "nuclear matrix fraction". The specificity of our isolation procedure was demonstrated by Western blotting with different marker proteins (Ishii et al. 2008).

Purification and identification of proteins in the HeLa cell nuclear matrix fraction

Six milligrams of proteins in the HeLa cell nuclear matrix fraction was separated by reversed-phase HPLC in 60% (v/v) formic acid, followed by SDS-PAGE as described previously (Kikuchi et al. 1997). Protein bands stained with CBB were excised from the gel and digested with trypsin, and then the resulting peptides were extracted from the gel as described previously (Castellanos-Serra et al. 1999). An aliquot of the peptides was spotted onto a target plate with an equal volume of a saturated {alpha}-cyano-4-hydroxycinnamic acid solution for MALDI-TOF/MS analysis. After air-drying at room temperature, peptide spots were analyzed by AXIMA-CFR (Shimadzu, Kyoto, Japan). Mass calibration was carried out using angiotensin I (m = 1295.69 Da), adrenocorticotropic hormone 1–17 (m = 2092.09 Da), and adrenocorticotropic hormone 7–38 (m = 3656.93 Da). Sample proteins were identified with the MASCOT algorithm (Matrix Science, London, UK) against the NCBI non-redundant database. The search parameters were a mass error tolerance of ±0.5 Da per peptide, one missed tryptic cleavage, and carbamidomethylation of cysteine as a fixed modification. The identification criteria for proteins were the MASCOT score and statistical significance (P < 0.05).

Plasmid construction

cDNAs encoding BXDC1, EBNA1BP2, shnRNPG, STAR and C19orf21 were generated by PCR amplification from a cDNA library of human testis (Takara, Tokyo, Japan). The PCR products were digested with restriction enzymes, HindIII and BamHI, and then inserted into the HindIII/BamHI sites of pEGFP-C2 (Clontech, Mountain View, CA) for GFP-fused expression in HeLa cells. The nucleotide sequences of the inserts were confirmed by sequencing with a CEQ8000 DNA Analysis System (Beckman Coulter).

Fluorescence microscopy

HeLa S3 cells on glass coverslips were cultured in DMEM containing 10% (v/v) FBS at 37 °C under 5% (v/v) CO2 for 24 h, and then transfected with the cDNA constructs using Effecten Transfection Reagent (Qiagen, Valencia, CA), according to the manufacturer's instructions, and incubated at 37 °C under 5% CO2 for a further 24 h. The cells were fixed with 4% paraformaldehyde for 10 min, treated with PBS containing 0.1% (v/v) Triton X-100 for 5 min, stained with 100 ng/mL DAPI for 5 min, and then observed under a fluorescence microscope (Axiovert, Zeiss, Germany). Anti-BXDC1 and -EBNA1BP2 were purchased from Cosmo Bio Co. and Santa Cruz Biotechnology Inc., respectively. For RNase digestion, cells were fixed in methanol for 2 min at –20 °C, rinsed in PBS and then incubated in RNase A (100 µg/mL in PBS, DNase-free) for 2 h at room temperature (Spector et al. 1991).

Fluorescence recovery after photobleaching (FRAP) analysis

Twenty-four hours after transfection, HeLa cells on a glass-bottomed dish were maintained in DMEM supplemented with 20 mM Hepes, pH 7.4, to stabilize the pH of the medium during the assay. The dish was directly mounted on a LSM510 META confocal laser scanning microscope (Carl Zeiss, Jena, Germany). The cells were kept at 37 °C using a heat incubator throughout the experiments. A 488-nm laser and an oil-immersion 40x plan-Neofluar lens with an N.A. of 1.3 were used in the bleaching and imaging experiments. A laser power of 1.0% was used for image acquisition, and 100% was used for photobleaching. The time for each image acquisition was 0.5-s, which did not significantly influence the fluorescent intensity throughout multiple acquisitions. A spot area of 2 µm in diameter was bleached with eight iterations. In FRAP analyses, images were collected before, immediately after, and at 2-s intervals after bleaching. The fluorescence intensity of a bleached spot was determined using the installed software. For RNA synthesis inhibition, the cells were pre-treated with 40 ng/µL actinomycin D at 37 °C for 2 h before the FRAP assay.

For kinetic analysis, the results of FRAP analysis were fitted with the following equation using ORIGINPRO 7.5J:



Formula 1

(1)

where Ifinal, Formula and koff are the fluorescence intensity of the plateau, the association rate and the dissociation rate, respectively (Sprague et al. 2006). The residence time was calculated as the inverse of koff.

RNA interference

RNA interference siRNAs for BXDC1 and EBNA1BP2 were designed and synthesized by Invitrogen (Stealth RNAi). The nucleotide sequences of the siRNAs were as follows: 5'-(UUUCAGUGCAUACACAUCUUUAAGU)-3' for BXDC1 (BXDC1-HSS149832) and 5'-(UUAUACCGUCUUUAG CACUGGGCC)-3' for EBNA1BP2 (EBNA1BP2-HSS116955). We tried 3-siRNAs each and found that the above siRNAs showed best knockdown efficiency. We also purchased siRNA against luciferase from Invitrogen as a control. The siRNAs were introduced into HeLa cells or HeLa cells stably expressing GFP-B23 using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Two days (48 h) after the transfection, the cells were subjected to immunoblotting and immunofluorescence microscopy with anti-BXDC1, anti-EBNA1BP2, anti-β-actin, monoclonal antibody 2-30C, anti-fibrillarin and anti-nucleolin antibodies, respectively. Monoclonal antibody 2-30C recognizes an FC-localized antigen (Kumeta et al. our unpublished observation).


   Acknowledgements
 
This study was supported by a Grant-in-Aid for Scientific Research on Priority Areas (to K.T. and T.H.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and by a Grant-in-Aid for Scientific Research (A) (to K.T.) and a Grant-in-Aid for Young Scientists (Start-up) (to Y.H.) from the Japan Society for the Promotion of Science (JSPS). Y.H. and M.K. were recipients of JSPS postdoctoral and predoctoral fellowships, respectively. We very grateful to Dr Hiroshi Kimura for his critical comments on the FRAP analyses. We also thank Ms Shizuka Iwasaka for her technical support.


   Footnotes
 
Communicated by: Shunsuke Ishii

* Correspondence: hirano{at}lif.kyoto-u.ac.jp or thori{at}chem.sc.niigata-u.ac.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Allain, F.H., Bouvet, P., Dieckmann, T. & Feigon, J. (2000) Molecular basis of sequence-specific recognition of pre-ribosomal RNA by nucleolin. EMBO J. 19, 6870–6881.[CrossRef][Medline]

Andersen, J.S., Lam, Y.W., Leung, A.K., Ong, S.E., Lyon, C.E., Lamond, A.I. & Mann, M. (2005) Nucleolar proteome dynamics. Nature 433, 77–83.[CrossRef][Medline]

Bouvet, P., Diaz, J.J., Kindbeiter, K., Madjar, J.J. & Amalric, F. (1998) Nucleolin interacts with several ribosomal proteins through its RGG domain. J. Biol. Chem. 273, 19025–19029.[Abstract/Free Full Text]

Cai, S., Han, H.J. & Kohwi-Shigematsu, T. (2003) Tissue-specific nuclear architecture and gene expression regulated by SATB1. Nat. Genet. 34, 42–51.[CrossRef][Medline]

Castellanos-Serra, L., Proenza, W., Huerta, V., Moritz, R.L. & Simpson, R.J. (1999) Proteome analysis of polyacrylamide gel-separated proteins visualized by reversible negative staining using imidazole-zinc salts. Electrophoresis 20, 732–737.[CrossRef][Medline]

Chen, D. & Huang, S. (2001) Nucleolar components involved in ribosome biogenesis cycle between the nucleolus and nucleoplasm in interphase cells. J. Cell Biol. 153, 169–176.[Abstract/Free Full Text]

Christensen, M.O., Larsen, M.K., Barthelmes, H.U., Hock, R., Andersen, C.L., Kjeldsen, E., Knudsen, B.R., Westergaard, O., Boege, F. & Mielke, C. (2002) Dynamics of human DNA topoisomerases II{alpha} and IIβ in living cells. J. Cell Biol. 157, 31–44.[Abstract/Free Full Text]

Cremer, T. & Cremer, C. (2001) Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nat. Rev. Genet. 2, 292–301.[CrossRef][Medline]

Dumbar, T.S., Gentry, G.A. & Olson, M.O. (1989) Interaction of nucleolar phosphoprotein B23 with nucleic acids. Biochemistry 28, 9495–9501.[CrossRef][Medline]

Eisenhaber, F., Wechselberger, C. & Kreil, G. (2001) The Brix domain protein family—a key to the ribosomal biogenesis pathway? Trends Biochem. Sci. 26, 345–347.[CrossRef][Medline]

Fawcett, D.W. (1966) On the occurrence of a fibrous lamina on the inner aspect of the nuclear envelope in certain cells of vertebrates. Am. J. Anat. 119, 129–145.[CrossRef][Medline]

Fey, E.G., Krochmalnic, G. & Penman, S. (1986) The nonchromatin substructures of the nucleus: the ribonucleoprotein (RNP)-containing and RNP-depleted matrices analyzed by sequential fractionation and resinless section electron microscopy. J. Cell Biol. 102, 1654–1665.[Abstract/Free Full Text]

Gall, J.G. (2000) Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol. 16, 273–300.[CrossRef][Medline]

Gerner, C., Holzmann, K., Grimm, R. & Sauermann, G. (1998) Similarity between nuclear matrix proteins of various cells revealed by an improved isolation method. J. Cell. Biochem. 71, 363–374.[CrossRef][Medline]

Glazko, G.V., Koonin, E.V., Rogozin, I.B. & Shabalina, S.A. (2003) A significant fraction of conserved noncoding DNA in human and mouse consists of predicted matrix attachment regions. Trends Genet. 19, 119–124.[CrossRef][Medline]

Gruenbaum, Y., Goldman, R.D., Meyuhas, R., Mills, E., Margalit, A., Fridkin, A., Dayani, Y., Prokocimer, M. & Enosh, A. (2003) The nuclear lamina and its functions in the nucleus. Int. Rev. Cytol. 226, 1–62.[Medline]

Hernandez-Verdun, D. (2006) Nucleolus: from structure to dynamics. Histochem. Cell Biol. 125, 127–137.[CrossRef][Medline]

Hirano, Y., Takahashi, H., Kumeta, M., Hizume, K., Hirai, Y., Otsuka, S., Yoshimura, S.H. & Takeyasu, K. (2008) Nuclear architecture and chromatin dynamics revealed by atomic force microscopy in combination with biochemistry and cell biology. Pflugers Arch. 456, 139–153.[Medline]

Ishii, K., Hirano, Y., Araki, N., Oda, T., Kumeta, M., Takeyasu, K., Furukawa, K. & Horigome, T. (2008) Nuclear matrix contains novel WD-repeat and disordered-region-rich proteins. FEBS Lett. 582, 3515–3519.[Medline]

Kikuchi, N., Yamakawa, Y., Ichimura, T., Omata, S. & Horigome, T. (1997) Reversed-phase high performance liquid chromatography of membrane proteins on perfusion-type polystyrene resin columns in 60% formic acid. Chromatography 18, 175–184.

Lamond, A.I. & Spector, D.L. (2003) Nuclear speckles: a model for nuclear organelles. Nat. Rev. Mol. Cell Biol. 4, 605–612.[CrossRef][Medline]

Maeshima, K. & Laemmli, U.K. (2003) A two-step scaffolding model for mitotic chromosome assembly. Dev. Cell 4, 467–480.[CrossRef][Medline]

Misteli, T. (2005) Concepts in nuclear architecture. Bioessays 27, 477–487.[CrossRef][Medline]

Morita, D., Miyoshi, K., Matsui, Y., Toh, E.A., Shinkawa, H., Miyakawa, T. & Mizuta, K. (2002) Rpf2p, an evolutionarily conserved protein, interacts with ribosomal protein L11 and is essential for the processing of 27 SB Pre-rRNA to 25 S rRNA and the 60 S ribosomal subunit assembly in Saccharomyces cerevisiae. J. Biol. Chem. 277, 28780–28786.[Abstract/Free Full Text]

Pederson, T. (1998) Thinking about a nuclear matrix. J. Mol. Biol. 277, 147–159.[CrossRef][Medline]

Pederson, T. (2000) Half a century of "the nuclear matrix". Mol. Biol. Cell 11, 799–805.[Abstract/Free Full Text]

Pendle, A.F., Clark, G.P., Boon, R., Lewandowska, D., Lam, Y.W., Andersen, J., Mann, M., Lamond, A.I., Brown, J.W. & Shaw, P.J. (2005) Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. Mol. Biol. Cell 16, 260–269.[Abstract/Free Full Text]

Segawa, M., Niino, K., Mineki, R., Kaga, N., Murayama, K., Sugimoto, K., Watanabe, Y., Furukawa, K. & Horigome, T. (2005) Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space. FEBS J. 272, 4327–4338.[Medline]

Shire, K., Ceccarelli, D.F., Avolio-Hunter, T.M. & Frappier, L. (1999) EBP2, a human protein that interacts with sequences of the Epstein–Barr virus nuclear antigen 1 important for plasmid maintenance. J. Virol. 73, 2587–2595.[Abstract/Free Full Text]

Spector, D.L., Fu, X.D. & Maniatis, T. (1991) Associations between distinct pre-mRNA splicing components and the cell nucleus. EMBO J. 10, 3467–3481.[Medline]

Sprague, B.L., Muller, F., Pego, R.L., Bungay, P.M., Stavreva, D.A. & McNally, J.G. (2006) Analysis of binding at a single spatially localized cluster of binding sites by fluorescence recovery after photobleaching. Biophys J. 91, 1169–1191.[CrossRef][Medline]

Stein, G.S., Zaidi, S.K., Braastad, C.D., Montecino, M., van Wijnen, A.J., Choi, J.Y., Stein, J.L., Lian, J.B. & Javed, A. (2003) Functional architecture of the nucleus: organizing the regulatory machinery for gene expression, replication and repair. Trends Cell Biol. 13, 584–592.[CrossRef][Medline]

Tsujii, R., Miyoshi, K., Tsuno, A., Matsui, Y., Toh-e, A., Miyakawa, T. & Mizuta, K. (2000) Ebp2p, yeast homologue of a human protein that interacts with Epstein–Barr virus nuclear antigen 1, is required for pre-rRNA processing and ribosomal subunit assembly. Genes Cells 5, 543–553.[Abstract]

Tsutsui, K.M., Sano, K. & Tsutsui, K. (2005) Dynamic view of the nuclear matrix. Acta Med. Okayama 59, 113–120.[Medline]

Wasser, M. & Chia, W. (2000) The EAST protein of drosophila controls an expandable nuclear endoskeleton. Nat. Cell Biol. 2, 268–275.[CrossRef][Medline]

Yoshimura, S.H., Kim, J. & Takeyasu, K. (2003) On-substrate lysis treatment combined with scanning probe microscopy revealed chromosome structures in eukaryotes and prokaryotes. J. Electron Microsc. (Tokyo) 52, 415–423.[Abstract/Free Full Text]

Zaidi, S.K., Young, D.W., Choi, J.Y., Pratap, J., Javed, A., Montecino, M., Stein, J.L., van Wijnen, A.J., Lian, J.B. & Stein, G.S. (2005) The dynamic organization of gene-regulatory machinery in nuclear microenvironments. EMBO Rep. 6, 128–133.[CrossRef][Medline]

Zhang, J., Harnpicharnchai, P., Jakovljevic, J., Tang, L., Guo, Y., Oeffinger, M., Rout, M.P., Hiley, S.L., Hughes, T. & Woolford, J.L. Jr. (2007) Assembly factors Rpf2 and Rrs1 recruit 5S rRNA and ribosomal proteins rpL5 and rpL11 into nascent ribosomes. Genes Dev. 21, 2580–2592.[Abstract/Free Full Text]

Zhong, S., Salomoni, P. & Pandolfi, P.P. (2000) The transcriptional role of PML and the nuclear body. Nat. Cell Biol. 2, E85–E90.[CrossRef][Medline]

Received: 8 August 2008
Accepted: 3 November 2008





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirano, Y.
Right arrow Articles by Horigome, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Hirano, Y.
Right arrow Articles by Horigome, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS