GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2009) 14, 775-788. doi:10.1111/j.1365-2443.2009.01309.x
© 2009 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sang, M.
Right arrow Articles by Ozaki, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sang, M.
Right arrow Articles by Ozaki, T.

Plk3 inhibits pro-apoptotic activity of p73 through physical interaction and phosphorylation

 Meixiang Sang1,2, Kiyohiro Ando1, Rintaro Okoshi1, Nami Koida1, Yuanyuan Li1, Yuyan Zhu1, Osamu Shimozato1, Cuizhi Geng3, Baoen Shan2, Akira Nakagawara1 and Toshinori Ozaki1

1 Division of Biochemistry, Chiba Cancer Center Research Institute, Chiba 260-8717, Japan
2 The Research Center of the Fourth Hospital of Hebei Medical University, Hebei 050017, China
3 The First Surgery, The Fourth Hospital of Hebei Medical University, Hebei 050017, China


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Plk3, one of Polo-like kinase family members, is involved in the regulation of cell cycle progression and DNA damage response. In this study, we found that Plk3 inhibits pro-apoptotic activity of p73 through physical interaction and phosphorylation. During cisplatin (CDDP)-mediated apoptosis, Plk3 was transcriptionally induced, whereas its protein level was kept at basal level, suggesting that Plk3 might rapidly degrade in response to CDDP. Immunoprecipitation and in vitro pull-down experiments demonstrated that Plk3 interacts with p73. Luciferase reporter assays and RT-PCR experiments revealed that Plk3 inhibits p73-mediated transcriptional activity. Consistent with these results, pro-apoptotic activity of p73 was blocked by Plk3. Additionally, Plk3 decreased the stability of p73. Intriguingly, kinase-deficient Plk3 failed to inhibit p73 function, indicating that kinase activity of Plk3 is required for Plk3-mediated inhibition of p73. Indeed, in vitro kinase reaction showed that NH2-terminal portion of p73 is phosphorylated by Plk3. In accordance with these observations, knocking down of Plk3 increased the stability of p73 and promoted CDDP-mediated apoptosis in association with up-regulation of p73. Collectively, our present findings suggest that Plk3 plays an important role in the regulation of cell fate determination in response to DNA damage through the inhibition of p73.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
Plk3 is one of Polo-like kinase (Plk) family including Plk1-4 (Lowery et al. 2005). Like the other Plk family members, Plk3 contains an NH2-terminal catalytic domain and a conserved COOH-terminal substrate-binding domain termed Polo box, which has been considered to have a phosphopeptide recognition function (Elia et al. 2003). Mammalian Plk3 has been originally identified as an immediate early response gene product (Donohue et al. 1995; Li et al. 1996). According to their results, expression levels of Plk3 were rapidly and transiently increased in response to mitogenic stimulation, suggesting that Plk3 is closely involved in the regulation of cell cycle progression. From the clinical point of view, several lines of evidence, however, indicated that expression levels of Plk3 are lower in various human primary tumor tissues than those of their corresponding normal ones (Li et al. 1996; Ando et al. 2004; Takai et al. 2005).

It has been shown that the enforced expression of Plk3 results in cell cycle arrest followed by apoptosis (Conn et al. 2000; Wang et al. 2002; Li et al. 2005; Jiang et al. 2006; Wang et al. 2007). Based on their results, ectopic expression of the Polo box domain of Plk3 caused cell cycle arrest and defects of cytokinesis followed by apoptosis (Jiang et al. 2006). Following UV exposure, Plk3 was induced to accumulate in cell nucleus and co-localizes with c-Jun (Wang et al. 2007). After Plk3-mediated phosphorylation of c-Jun, cells underwent apoptosis. Although loss of function mutations of Plk3 was undetectable in human primary tumors (Wiest et al. 2001), Plk3-deficient mice developed spontaneous tumors in various organs (Yang et al. 2008), suggesting that Plk3 acts as a tumor suppressor. In contrast to Plk3, Plk1 promoted tumor formation in nude mice (Smith et al. 1997).

Plk3 kinase activity is enhanced in response to DNA damage in an ATM (ataxia telangiectasia-mutated)-dependent manner (Xie et al. 2001). Of note, Plk3 is involved in the regulation of DNA damage response through the direct interaction with tumor suppressor p53 accompanied with an induction of its phosphorylation at Ser-20 (Xie et al. 2001; el Bahassi et al. 2002). In contrast, Plk1 inhibits pro-apoptotic activity of p53 through the direct interaction and phosphorylation (Ando et al. 2004), indicating that phosphorylation does not always act as an activation signal for p53.

p73 is one of p53 family members of nuclear transcription factor and induces apoptosis through transcriptional activation of its target genes such as p21WAF1, BAX, p53AIP1 and PUMA (Ozaki & Nakagawara 2005). Like p53, p73 is induced to stabilize in response to DNA damage and exerts its pro-apoptotic function. Upon DNA damage caused by cisplatin (CDDP), p73 is extensively phosphorylated at Tyr-99 mediated by non-receptor nuclear tyrosine kinase c-Abl (Gong et al. 1999). Alternatively, p73 is phosphorylated at Ser-289 and Ser-47 by protein kinase C{delta} and Chk1, respectively (Ren et al. 2002; Gonzalez et al. 2003). Both types of phosphorylation enhance the transcriptional activity of p73. In contrast, CDK-mediated phosphorylation of p73 leads to a significant inhibition of its transcriptional activity (Gaiddon et al. 2003). Recently, we have found that Plk1 inhibits pro-apoptotic activity of p73 through direct interaction and phosphorylation at Thr-27 (Koida et al. 2008). Although Plk3 might have regulatory roles in response to DNA damage, it remains unclear whether there could exist functional relationship between Plk3 and p73.

In the present study, we have found that Plk3 has an ability to inhibit transcriptional and pro-apoptotic functions of p73 through direct interaction and phosphorylation.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
Plk3 protein is kept constant in response to CDDP

To examine expression patterns of Plk3 in response to DNA damage, p53-deficient human lung carcinoma H1299 and p53-proficient human neuroblastoma SH-SY5Y cells were exposed to the indicated concentrations of CDDP. At the indicated time points after CDDP treatment, cells were subjected to TUNEL staining. As shown in Fig. 1A, both cells underwent apoptosis in a time-dependent manner. Under the same experimental conditions, total RNA and cell lysates were prepared and processed for RT-PCR and immunoblotting, respectively. As shown in Fig. 1B, p73{alpha} remained unchanged regardless of CDDP treatment, whereas expression levels of Plk3, p21WAF1 and PUMA significantly increased in cells treated with CDDP. Immunoblotting experiments revealed that CDDP-mediated up-regulation of p21WAF1 and PUMA is detectable in both cells (Fig. 1C). In addition, we have detected proteolytic cleavage of PARP, which has been considered to be one of substrates of caspase-3 (Niizuma et al. 2006), in response to CDDP. Of note, Plk3 remained unchanged regardless of CDDP treatment. p73{alpha} was induced to accumulate in cells exposed to CDDP in a time-dependent manner (Fig. 1D). Similar results were obtained in adriamycin (ADR)-treated H1299 cells (Fig. S1 in Supporting Information/Supplementary Material). These findings prompted us to examine whether Plk3 could rapidly degrade in cells treated with CDDP through proteasome system. To address this issue, cells were treated with MG-132 or left untreated. Six hours after MG-132 treatment, cell lysates were prepared and subjected to immunoblotting. As shown in Fig. 1E, the endogenous Plk3 increased in cells treated with MG-132. In addition, CDDP had an undetectable effect on Plk3 in cells exposed to MG-132. Similar results were also obtained in cells treated with Lactacystin (data not shown), indicating that Plk3 is regulated at least in part in a proteasome-dependent manner. Since Plk3 was transcriptionally induced in response to CDDP, it is likely that CDDP-mediated degradation of Plk3 might contribute to DNA damage-induced apoptosis.


Figure 1
View larger version (52K):
[in this window]
[in a new window]

  		Figure 1  Expression levels of Plk3 increase in response to CDDP but Plk3 rapidly degrades at protein level. (A) CDDP-mediated apoptosis. p53-deficient human lung carcinoma H1299 cells and p53-proficient human neuroblastoma SH-SY5Y cells were exposed to CDDP at the indicated concentrations. At the indicated time points after CDDP treatment, number of TUNEL-positive cells was measured. (B) RT-PCR. H1299 (left panels) and SH-SY5Y cells (right panels) were treated with CDDP as in (A). At the indicated time points after CDDP treatment, total RNA was prepared and processed for RT-PCR. GAPDH was used as an internal control. (C) and (D) Immunoblotting. H1299 (left panels) and SH-SY5Y cells (right panels) were treated with CDDP as in (A). At the indicated time periods after the treatment with CDDP, cell lysates were prepared and subjected to immunoblotting with the indicated antibodies. Actin was used as a loading control (C). For the detection of the endogenous p73 in response to CDDP, nuclear fractions were prepared and processed for immunoblotting with monoclonal anti-p73 antibody. Lamin B was used as a loading control (D). (E) Plk3 degrades in a proteasome-dependent manner. H1299 cells were exposed to MG-132 (10 µM) or left untreated. Six hours after the treatment with MG-132, cell lysates (upper panels) and total RNA (lower panels) were prepared and analyzed for expression levels of the endogenous Plk3 by immunoblotting and RT-PCR, respectively. Right panels: H1299 cells were treated with 60 µM of CDDP for 24 h or left untreated. Cells were then exposed to MG-132 (10 µM) for 6 h or left untreated. Cell lysates (upper panels) and total RNA (lower panels) were prepared and subjected to immunoblotting and RT-PCR, respectively.

 
Interaction between Plk3 and p73

To ask whether Plk3 could be associated with p73, we performed the indirect immunofluorescence staining experiments. To this end, H1299 cells were co-transfected with expression plasmids for FLAG-Plk3 plus HA-p73{alpha}. Twenty-four hours after transfection, cells were treated with CDDP for 24 h or left untreated. As shown in Fig. 2A, FLAG-Plk3 was detectable largely in cytoplasm, whereas HA-p73{alpha} localized exclusively in cell nucleus. Upon CDDP treatment, a certain fraction of FLAG-Plk3 translocated from cytoplasm to cell nucleus, and co-localized with nuclear HA-p73{alpha}, indicating that Plk3 might interact with p73 in cells. Consistent with these results, nuclear FLAG-Plk3 was induced to accumulate in cell nucleus as examined by immunoblotting (Fig. S2). These observations prompted us to examine whether Plk3 could form a complex with p73 in cells. For this purpose, COS7 cells were co-transfected with expression plasmids for FLAG-Plk3 and HA-p73{alpha}. As shown in Fig. 2B, the anti-FLAG immunoprecipitates contained HA-p73{alpha}. Reciprocal experiments also demonstrated that FLAG-Plk3 is detectable in the anti-HA immmunoprecipitates. To further confirm this notion, we have examined whether there could exist the endogenous interaction between them. Cell lysates prepared from HeLa cells exposed to CDDP were immunoprecipitated with normal rabbit serum (NRS) or with polyclonal anti-Plk3 antibody and the immunoprecipitates were analyzed by immunoblotting with the anti-p73 antibody. As shown in Fig. 2C, the anti-Plk3 immunoprecipitates contained the endogenous p73{alpha}. Reciprocal experiments demonstrated that the anti-p73 immunoprecipitates include the endogenous Plk3, suggesting that Plk3 interacts with p73 in cells and might modulate its function.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

  		Figure 2  Interaction between p73 and Plk3. (A) Indirect immunofluorescence staining. H1299 cells were co-transfected with expression plasmids for HA-p73{alpha} and FLAG-Plk3. Twenty-four hours after transfection, cells were treated with 60 µM of CDDP. At the indicated time points after CDDP treatment, cells were simultaneously stained with polyclonal anti-HA (red) and monoclonal anti-FLAG (green) antibodies. Cell nuclei were stained with DAPI (blue). Merged images indicate the nuclear co-localization of p73 with Plk3. (B) Immunoprecipitation. Cell lysates prepared from COS7 cells expressing HA-p73{alpha} and FLAG-Plk3 were immunoprecipitated with normal mouse serum (NMS) or with monoclonal anti-FLAG antibody and the immunoprecipitates were analyzed by immunoblotting with monoclonal anti-p73 antibody (upper panels). Lower panels show the reciprocal experiments. 1/20 of inputs were also shown. (C) Endogenous interaction between them. HeLa cells were exposed to 20 µM of CDDP. Forty-eight hours after the treatment, cell lysates were prepared and subjected to immunoprecipitation with normal rabbit serum (NRS) or with polyclonal anti-Plk3 antibody followed by immunoblotting with monoclonal anti-p73 antibody. Lower panels show the reciprocal experiments. 1/20 of inputs were also shown.

 
NH2-terminal region of p73 is required for the interaction with Plk3

To identify the region(s) of p73{alpha} responsible for the interaction with Plk3, we have performed the in vitro pull-down assays. GST and the indicated GST-p73{alpha} deletion mutants (Fig. 3A and B) were incubated with the radio-labeled FLAG-Plk3. After the addition of glutathione Sepharose beads, reaction mixtures were washed extensively with binding buffer and analyzed by SDS–polyacrylamide gel electrophoresis followed by autoradiography. As shown in Fig. 3C, the radio-labeled FLAG-Plk3 bound to GST-p73{alpha}(1–130) but not to the remaining GST fusion proteins, indicating that the NH2-terminal portion of p73{alpha} (amino acid residues 63–113) is required for the interaction with Plk3.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

  		Figure 3  Identification of the region of p73 required for the interaction with Plk3. (A) Schematic drawing of GST-tagged deletion mutants of p73{alpha}. TA, transactivation domain; DBD, DNA-binding domain; OD, oligomerization domain; SAM, sterile {alpha} motif domain. (B) Coomassie Blue staining of GST-p73{alpha} deletion mutants. GST and GST-p73{alpha} deletion mutants were expressed in E. coli DH5{alpha} and purified by glutathione Sepharose beads as described under "Experimental procedures". (C) Pull-down assay. [35S]methionine-labeled FLAG-Plk3 was generated in the coupled transcription/translation system, and incubated with 1 µg of GST or GST-p73{alpha} deletion mutants for 2 h at 4 °C. Protein complexes were collected on glutathione Sepharose beads, washed extensively with binding buffer and then boiled in SDS sample buffer. Radio-labeled bound proteins were resolved by 10% SDS-polyacrylamide gel electrophoresis and visualized by autoradiography.

 
Kinase activity of Plk3 is required for Plk3-mediated inhibition of transcriptional and pro-apoptotic activities of p73

To address whether Plk3 could affect p73-mediated transcriptional activation, we have performed luciferase reporter assays. H1299 cells were co-transfected with the constant amount of the expression plasmid for HA-p73{alpha} and luciferase reporter construct carrying p53/p73-responsive element derived from p21WAF1, BAX or p53AIP1 in the presence or absence of the increasing amounts of FLAG-Plk3 expression plasmid. As seen in Fig. 4A–C, FLAG-Plk3 significantly reduced luciferase activities driven by p21WAF1, BAX or p53AIP1 promoter, whereas FLAG-Plk3 alone had a marginal effect on luciferase activities. Consistent with these results, enforced expression of FLAG-Plk3 in H1299 cells inhibited p73{alpha}-mediated up-regulation of the endogenous p21WAF1, BAX and p53AIP1 expression (Fig. 4D).


Figure 4
View larger version (25K):
[in this window]
[in a new window]

  		Figure 4  Plk3 represses p73-mediated transcriptional activation. (A–C) Luciferase reporter assay. H1299 cells were co-transfected with constant amount of p73{alpha} expression plasmid, luciferase reporter construct carrying p53/p73-responsive element derived from p21WAF1 (A), BAX (B) or p53AIP1 (C) and Renilla luciferase reporter plasmid together with or without the increasing amounts of the expression plasmid for FLAG-Plk3. Total amount of plasmid DNA per transfection was kept constant (510 ng) with pcDNA3. Forty-eight hours after transfection, cells were lysed and their luciferase activities were measured. The depicted results are the mean ± SD of n = 3 independent experiments. Firefly luciferase activities were normalized for Renilla luciferase activities. (D) RT-PCR. H1299 cells were transfected with the constant amount of the expression plasmid encoding HA-p73{alpha} together with or without the increasing amounts of FLAG-Plk3 expression plasmid. Forty-eight hours after transfection, total RNA was prepared and subjected to RT-PCR. GAPDH was used as an internal control.

 
Since Plk3 is a serine/threonine protein kinase (Lowery et al. 2005), we then asked whether kinase activity of Plk3 could be required for the inhibition of the transcriptional activity of p73. To this end, we used the kinase-deficient Plk3 termed Plk3(K52R) (Xie et al. 2001). H1299 cells were again co-transfected with the constant amount of HA-p73{alpha} expression plasmid and luciferase reporter construct bearing p53/p73-responsive element derived from p21WAF1, BAX or p53AIP1 together with or without the increasing amounts of Plk3(K52R). As shown in Fig. 5A–C, Plk3(K52R) had a marginal effect on p73{alpha}-mediated transcriptional activation toward p21WAF1, BAX or p53AIP1 promoter. In support with these results, enforced expression of Plk3(K52R) in H1299 cells had negligible effects on p73{alpha}-dependent up-regulation of the endogenous p21WAF1, BAX and p53AIP1 expression (Fig. 5D), suggesting that kinase activity of Plk3 plays an important role in the regulation of p73 activity.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

  		Figure 5  Kinase activity of Plk3 is required for the inhibition of p73-mediated transcriptional activation. (A–C) Luciferase reporter assay. H1299 cells were co-transfected with the constant amount of the expression plasmid for HA-p73{alpha}, luciferase reporter construct bearing p53/p73-responsive element derived from p21WAF1 (A), BAX (B) or p53AIP1 (C) and Renilla luciferase reporter plasmid together with or without the increasing amounts of the expression plasmid for kinase-deficient Plk3 [Plk3(K52R)]. Forty-eight hours after transfection, cells were lysed and their luciferase activities were measured as in Fig. 4. (D) RT-PCR. H1299 cells were transfected with the constant amount of the expression plasmid for HA-p73{alpha} together with or without the increasing amounts of Plk3(K52R) expression plasmid. Forty-eight hours after transfection, total RNA was prepared and subjected to RT-PCR. GAPDH was used as an internal control.

 
Next, we addressed whether Plk3 could affect p73-mediated apoptosis. HeLa cells in which the endogenous p53 is inactivated by E6-AP (Scheffner et al. 1993), were transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, floating and attached cells were collected and their cell cycle distributions were analyzed by FACS. As shown in Fig. 6A, number of cells with sub-G1 DNA content remained unchanged in cells expressing FLAG-Plk3 or Plk3(K52R) alone as compared with that of control cells transfected with the empty plasmid. Of note, enforced expression of HA-p73{alpha} increased number of cells with sub-G1 DNA content and co-expression with FLAG-Plk3 but not with Plk3(K52R) resulted in a significant decrease in number of cells with sub-G1 DNA content. In support with these results, p73{alpha}-mediated proteolytic cleavage of PARP was blocked by wild-type Plk3 but not by kinase-deficient Plk3 (Fig. 6B). These observations indicate that kinase activity of Plk3 is indispensable for the inhibition of pro-apoptotic activity of p73.


Figure 6
View larger version (39K):
[in this window]
[in a new window]

  		Figure 6  Kinase activity of Plk3 is essential for the inhibition of p73-mediated apoptosis. (A) FACS analysis. HeLa cells were transfected with the indicated combinations of the expression plasmids. Forty-eight hours after transfection, floating and attached cells were collected and stained with PI. After staining with PI, number of cells with sub-G1 DNA content was measured by FACS. (B) Proteolytic cleavage of PARP. HeLa cells were co-transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, cell lysates were prepared and subjected to immunoblotting with anti-PARP antibody. Expression of exogenous GFP was examined to verify the equal transfection efficiency. Actin was used as a loading control.

 
Plk3 decreases the stability of p73

To examine whether Plk3 could affect the stability of p73, we have measured a decay rate of HA-p73{alpha}. H1299 cells were transfected with the constant amount of the expression plasmid for HA-p73{alpha} alone or with the constant amount of HA-p73{alpha} expression plasmid plus FLAG-Plk3 expression plasmid. Twenty-four hours after transfection, cells were exposed to cycloheximide. At the indicated time periods after the addition of cycloheximide, cell lysates were prepared and subjected to immunoblotting. As shown in Fig. 7A, a half-life of HA-p73{alpha} significantly decreased in the presence of FLAG-Plk3. In contrast, kinase-deficient Plk3 had undetectable effects on the stability of HA-p73{alpha} (Fig. S3).


Figure 7
View larger version (49K):
[in this window]
[in a new window]

  		Figure 7  Plk3 affects the half-life of p73. (A) Cycloheximide (CHX) blockage. H1299 cells were transfected with the expression plasmid for HA-p73{alpha} alone (left panel) or with expression plasmids encoding HA-p73{alpha} plus FLAG-Plk3. Twenty-four hours after transfection, cells were exposed to cycloheximide (100 µg/mL). At the indicated time points after the addition of cycloheximide, cell lysates were prepared and processed for immunoblotting with anti-p73 antibody. Densitometry was used to quantify the amounts of HA-p73{alpha}, which normalized to actin, and band intensity of HA-p73{alpha} was calculated against the amount of HA-p73{alpha} present at time point 0, which was set at 100%. (B and C) Plk3 reduces the stability of p73. H1299 cells were transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, cell lysates and total RNA were prepared and subjected to immunoblotting (B) and RT-PCR (C), respectively. (D and E) Plk3(K52R) has an undetectable effect on the stability of p73. H1299 cells were transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, cell lysates and total RNA were prepared and subjected to immunoblotting (D) and RT-PCR (E), respectively. (F) siRNA-mediated knockdown of the endogenous Plk3. H1299 cells were transfected with control siRNA or with siRNA against Plk3 termed #1, #2 or #3. Forty-eight hours after transfection, cell lysates (upper panels) and total RNA (lower panels) were prepared and processed for immunoblotting and RT-PCR, respectively. Lower panels: H1299 cells were transfected with control siRNA or with siRNA against Plk3 (#3). Forty-eight hours after transfection, cell lysates (upper panels) and total RNA (lower panels) were prepared and examined expression levels of the endogenous p73{alpha} by immunoblotting and RT-PCR, respectively.

 
Next, H1299 cells were transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, cell lysates and total RNA were prepared and processed for immunoblotting and RT-PCR, respectively. As shown in Fig. 7B, enforced expression of FLAG-Plk3 remarkably reduced the amount of HA-p73{alpha}, whereas FLAG-Plk3 had negligible effects on expression levels of HA-p73{alpha} mRNA (Fig. 7C). Similarly, Plk3 promoted the degradation of p73β (Fig. S4). In contrast, Plk3 (K52R) had a negligible effect on the expression level of HA-p73{alpha} as well as HA-p73{alpha} mRNA (Fig. 7D and E).

To further confirm this issue, we have performed the siRNA-mediated knockdown of the endogenous Plk3. To this end, H1299 cells were transfected with the control siRNA or with siRNA against Plk3 termed #1, #2, or #3. As shown in Fig. 7F, #3 siRNA efficiently knocked down the endogenous expression of Plk3. Therefore, we used #3 siRNA for further studies. In accordance with those observations, siRNA-mediated knockdown of the endogenous Plk3 resulted in a remarkable increase in expression levels of the endogenous p73{alpha}. Taken together, these results suggest that Plk3 has an ability to reduce the stability of p73 in a kinase activity-dependent manner.

Plk3 phosphorylates p73 in vitro

To determine whether Plk3 could phosphorylate p73, we performed in vitro kinase reaction. For this purpose, GST or GST-p73{alpha} deletion mutants was incubated with the purified Plk3 in the presence of [{gamma}-32P]ATP. After incubation, reaction mixtures were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography. As seen in Fig. 8A, GST-p73{alpha}(1–130) but not the remaining GST-p73{alpha} deletion mutants was phosphorylated by Plk3, suggesting that amino acid residue(s) between 63 and 113 of p73{alpha} is phosphorylated by Plk3.


Figure 8
View larger version (44K):
[in this window]
[in a new window]

  		Figure 8  Plk3 has an ability to phosphorylate p73 and attenuates the interaction between p73 and p300. (A) In vitro kinase reaction. Equal amounts of the indicated GST-p73{alpha} deletion mutants were incubated with the active form of Plk3 in the presence of [{gamma}-32P]ATP. After incubation for 20 min at 30 °C, reaction mixtures were separated by SDS-polyacrylamide gel electrophresis and subjected to autoradiography. (B) HeLa cells were transfected with the empty plasmid or with the expression plasmid for FLAG-Plk3. Forty-eight hours after transfection, cell lysates were prepared and immunoprecipitated with NRS or with polyclonal anti-p300 antibody followed by immunoblotting with anti-p73 antibody. 1/20 of inputs were shown in left panels.

 
As described previously (Ozaki & Nakagawara 2005), p300 acts as a co-activator for p73. p300 has been shown to be associated with NH2-terminal portion of p73. Intriguingly, our immunoprecipitation experiments indicated that Plk3 has an ability to reduce the amount of p73{alpha}/p300 complex in cells (Fig. 8B).

siRNA-mediated knockdown of the endogenous Plk3 enhances CDDP-dependent apoptosis

To ask whether Plk3 could be involved in the regulation of CDDP-dependent apoptotic response, H1299 cells were transfected with the control siRNA or with siRNA targeting Plk3 and exposed to CDDP. As shown in Fig. 9A, siRNA-mediated knockdown of the endogenous Plk3 resulted in a significant increase in expression levels of the endogenous p73{alpha} as compared with those in cells exposed to CDDP alone. We then isolated genomic DNA from equal number of H1299 cells transfected with the control siRNA or with siRNA against Plk3, which were treated with CDDP. As shown in Fig. 9B, a partial degradation of high molecular weight genomic DNA was detectable in cells exposed to CDDP alone. In contrast, siRNA-mediated knockdown plus CDDP treatment led to a remarkable degradation of genomic DNA, suggesting that Plk3 plays a critical role in the regulation of CDDP-mediated apoptotic response through the inhibition of p73 in cells.


Figure 9
View larger version (32K):
[in this window]
[in a new window]

  		Figure 9  Knockdown of Plk3 induces CDDP-mediated apoptosis. (A) Knocking down of the endogenous Plk3 results in a significant accumulation of p73 in response to CDDP. H1299 cells were transfected with control siRNA or with siRNA against Plk3. Twenty-four hours after transfection, cells were exposed to 60 µM of CDDP. Twenty-four hours after CDDP treatment, cell lysates were immunoprecipitated with NMS or with anti-p73 antibody followed by immunoblotting with anti-p73 antibody. (B) Degradation of genomic DNA in response to CDDP. H1299 cells were transfected as in (A). Twenty-four hours after transfection, cells were exposed to 60 µM of CDDP for 24 h. Genomic DNA was isolated from equal number of each cells and analyzed by 1.5% agarose gel electrophoresis.

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
Although the functional significance of Plk3 in the regulation of cell fate determination has been less well-understood, the deregulated expression of Plk3 led to cell cycle arrest and apoptosis (Conn et al. 2000; Wang et al. 2002). These results were consistent with the previous observations showing that, in contrast to Plk1, expression levels of Plk3 is lower in various human primary tumor tissues as compared with those of their corresponding normal ones (Li et al. 1996; Ando et al. 2004; Takai et al. 2005). It is worth noting that, in response to DNA damage, activated forms of Plk3 phosphorylate p53 at Ser-20, and thereby positively regulating p53 function (Xie et al. 2001; el Bahassi et al. 2002). Wortmannin treatment significantly inhibits stress-induced phosphorylation of p53 at Ser-20 (Liu et al. 2007), indicating that ATM might be involved in DNA damage-induced activation of Plk3. In contrast, Weichert et al. described that moderately higher expression levels of Plk3 protein are detectable in ovarian carcinomas as compared with their corresponding normal tissues (Weichert et al. 2004).

In the present study, we have found that Plk3 phosphorylates p73 at its NH2-terminal portion and then inhibits its transcriptional as well as pro-apoptotic function, suggesting that Plk3 might differentially regulate p53 and p73 in response to DNA damage. According to our present results, Plk3 was induced to translocate from cytoplasm to cell nucleus in response to CDDP. As described (Koida et al. 2008), CDDP treatment also induced the nuclear translocation of Plk1. Since both Plk1 and Plk3 have the predicted nuclear localization signals (Zimmerman & Erikson 2007), it is likely that both proteins might have a capability of nuclear access. Consistent with the previous observations (Conn et al. 2000), exogenously expressed Plk3 displayed a diffuse cytoplasmic localization, whereas Plk3 was detectable in cell nucleus to a lesser degree under normal conditions. Intriguingly, Plk3 is up-regulated at mRNA level in response to CDDP, whereas CDDP-mediated up-regulation of Plk3 was undetectable, indicating that intracellular expression levels of Plk3 might be kept constant regardless of CDDP treatment through a rapid degradation of Plk3. In support with this notion, Alberts and Winkles found that the activated form of Plk3 rapidly degrades in cell nucleus through the nuclear ubiquitin/proteasome pathway (Alberts & Winkles 2004). According to their results, stress-induced nuclear translocation of Plk3 might play an important role in its proteolytic degradation via nuclear ubiquitin–proteasome system. It is likely that CDDP-mediated up-regulation of Plk3 mRNA but not Plk3 protein might be at least in part due to its nuclear translocation in response to CDDP. Thus, keeping Plk3 at basal level even in the presence of CDDP might contribute to the induction of CDDP-mediated apoptosis through the activation of p73. Under our experimental conditions, protein stability of Plk3 significantly increased in cells exposed to MG-132, suggesting that the proteolytic degradation of Plk3 is regulated at least in part in a proteasome-dependent manner. However, the precise molecular mechanisms behind the inhibition of CDDP-mediated accumulation of Plk3 are unclear.

Luciferase reporter assay and RT-PCR analysis demonstrated that Plk3 blocks p73-mediated transcriptional activation in a dose-dependent manner. Similarly, Plk3 strongly inhibited p73-mediated apoptosis. Of note, kinase-deficient Plk3 had a negligible effect on p73 function, indicating that kinase activity of Plk3 is required for the inhibition of p73. Indeed, in vitro kinase reaction revealed that Plk3 phosphorylates GST-p73{alpha}(1–130) but not GST-p73{alpha}(1–62) and GST-p73{alpha}(114–328), suggesting that Ser and/or Thr residue(s) between amino acid residues 63 and 113 of p73{alpha} is phosphorylated by Plk3. To our knowledge, the consensus amino acid sequence targeted by Plk3 has not been established. There exist 11 Ser and 5 Thr residues within this region. Iida et al. found the differential substrate recognition between Plk1 and Plk3 (Iida et al. 2008). Therefore, it was quite difficult to identify Ser/Thr residue(s) targeted by Plk3 in the present study. Based on our immunoprecipitation analysis, enforced expression of FLAG-Plk3 resulted in a loss of the interaction between p73{alpha} and its co-activator p300. Thus, it is likely that Plk3-mediated phosphorylation of p73{alpha} at its NH2-terminal portion and/or Plk3-mediated down-regulation of p73{alpha} contributes to the loss of the complex formation between p73 and p300.

Another finding of our present study was that Plk3 has an ability to decrease the stability of p73{alpha}. Since kinase-deficient Plk3 had an undetectable effect on p73{alpha}, Plk3-mediated proteolytic degradation of p73{alpha} was regulated in a kinase activity-dependent manner. Thus, it is likely that Plk3-mediated destabilization of p73{alpha} might be one of the molecular mechanisms behind the inhibitory effect of Plk3 on p73{alpha}. Like Plk3, Plk1 induced the proteolytic degradation of p73{alpha} to suppress its function (Koida et al. 2008). However, it remains unclear how Plk1 promotes the proteolytic degradation of p73. Feng et al. found that Plk1 is associated with 20S as well as 26S proteasome subunit and enhances the proteolytic activity of proteasome through Plk1-mediated phosphorylation (Feng et al. 2001). It has been described that p73 is regulated in a proteasome-dependent and/or proteasome-independent manner (Ozaki & Nakagawara 2005). As described previously (Gao & Karin 2005), substrate recognition by E3 ubiquitin protein ligases and subsequent proteolytic degradation were regulated in a phosphorylation-dependent manner. Therefore, it is likely that Plk3-mediated phosphorylation of p73{alpha} might contribute to the induction of the proteolytic degradation of p73{alpha}. Based on our present results, Plk3 was able to interact with E3 ubiquitin protein ligase Itch (Fig. S5). Since Itch acts as an E3 ubiquitin protein ligase for p73 (Rossi et al. 2005), it is possible that Plk3 has an ability to recruit Itch onto p73, and thereby promoting its proteolytic degradation. Alternatively, p73 might be regulated by Plk3 in a proteasome-independent manner. As shown in Fig. S6, both HA-p73{alpha} and FLAG-Plk3 were stabilized in the presence of MG-132. Interestingly, Plk3-mediated destabilization of p73{alpha} was not blocked even in the presence of MG-132. Similarly, Plk1-dependent reduction of p73{alpha} was not affected by MG-132 (Koida et al. 2008). According to our present results, it is conceivable that stabilized Plk3 mediated by MG-132 inhibits the effect of MG-132 on p73{alpha}. Further studies should be required to clarify the molecular mechanisms underlying Plk3-dependent proteolytic degradation of p73.

Like c-Jun, which inhibits p53 but activates p73 (Toh et al. 2004), our present findings suggest that Plk3 has a differential effect on p53 and p73. In response to DNA damage, Plk3 activates p53 through the promotion of its phosphorylation at Ser-20. In a sharp contrast to p53, Plk3 inhibits p73 through the induction of its phosphorylation and proteolytic degradation. CDDP-dependent induction of p73 might be at least in part due to the rapid degradation of Plk3, although CDDP treatment led to the transcriptional induction of Plk3. Furthermore, siRNA-mediated knockdown of the endogenous Plk3 in p53-deficient H1299 cells promoted CDDP-dependent apoptosis through the up-regulation of p73. Thus, it is likely that Plk3 might be one of the candidate therapeutic targets of human cancers bearing p53 mutations.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Cell cultures and transfection

Human osteosarcoma U2OS, human neuroblastoma SH-SY5Y, human cervical carcinoma HeLa and COS7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum (FBS; Invitrogen, Carlsbad, CA), 50 units of penicillin and 50 µg/mL streptomycin. Human lung carcinoma H1299 cells were grown in RPMI 1640 medium with the same supplements. Where indicated, cells were treated with cisplatin (CDDP; Sigma, St. Louis, MO). For transfection, cells were transfected with the indicated combinations of expression plasmids using LipofectAMINE 2000 transfection reagent (Invitrogen) according to the manufacturer's instructions.

FACS analysis

H1299 cells were co-transfected with the indicated combinations of expression plasmids. Forty-eight hours after transfection, floating and attached cells were collected, washed in 1 x PBS and fixed in 70% ice-cold ethanol. After fixation, cells were incubated with a solution containing 0.05% RNase A, 0.25% Triton X-100 and 50 µg/mL of propidium iodide (PI) in the dark at 4 °C for 30 min. Cells were then filtered through a 40-µm nylon mesh and analyzed using the FACScan system in conjunction with CellQuest software (Becton Dickinson, Oxford, UK).

TUNEL staining

Apoptotic cells were detected by in situ cell detection kit (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturer's instructions. In brief, cells were grown overnight on glass cover slips at 37 °C. At the indicated time periods after the treatment with CDDP, cells were washed in PBS, fixed in 4% paraformaldehyde for 1 h at room temperature and then permeabilized with 0.1% Triton X-100 for 2 min on ice. Cells were subsequently incubated with TUNEL reaction mixture for 1 h at 37 °C in a humidified atmosphere in the dark. The cover slips were mounted onto microscope slides using the VECTASHIELD containing DAPI (Vector Laboratories, Burlingame, CA) and examined under a Fluoview laser scanning confocal microscope (Olympus, Tokyo, Japan).

Reverse transcription-PCR

Total RNA was prepared using RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. One microgram of total RNA was used to generate the first strand cDNA using random primers and SuperScript II reverse transcriptase (Invtrogen). Reverse transcription was carried out at 42 °C for 1 h. The resultant cDNAs were amplified by PCR-based strategy using rTaq DNA polymerase (Takara, Ohtsu, Japan). The primer sets used for PCR-based amplification were as follows: Plk3, 5'-GCGCGAGAAG ATCCTAAATG-3' (forward) and 5'-GATCTGCCGCAGGTA GTAGC-3' (reverse); p53, 5'-CTGCCCTCAACAAGATGTT TTG-3' (forward) and 5'-CTATCTGAGCAGCGCTCATGG-3' (reverse); p73; 5'-TCTGGAACCAGACAGCACCT-3' (forward) and 5'-GTGCTGGACTGCTGGAAAGT-3' (reverse); p21WAF1, 5'-ATGAAATTCACCCCCTTTCC-3' (forward) and 5'-CCC TAGGCTGTGCTCACTTC-3' (reverse); p53AIP1, 5'-GATCT TCCTCTGAGGCGAGCT-3' (forward) and 5'-TTACCCAG CCAGGTGTGTGT-3' (reverse); PUMA, 5'-TATGGATCCC GCACCATGGACTACAAGGACGACGATGACAAGGCCC GCGCACGCCAG-3' (forward) and 5'-TATGGATCCCTAC ATGGTGCAGAGAAAGTCCCCC-3' (reverse); BAX, 5'-TTT GCTTCAGGGTTTCATCC-3' (forward) and 5'-CAGTTGAA GTTGCCGTCAGA-3' (reverse); GAPDH, 5'-ACCTGACCTG CCGTCTAGAA-3' (forward) and 5'-TCCACCACCCTGTTG CTGTA-3' (reverse). The expression of GAPDH was measured as an internal control.

Immunoblotting

Cell lysis, SDS-polyacrylamide gel electrophoresis and immunoblotting were carried out as described previously (Ando et al. 2004) by using the following primary antibodies: monoclonal anti-p53 (DO-1; Oncogene Research Products, Cambridge, MA), monoclonal anti-p73 (Ab-4; NeoMarkers, Fremont, CA), monoclonal anti-Plk3 (B37-2; BD PharMingen, San Jose, CA), monoclonal anti-FLAG (M2; Sigma), monoclonal anti-Lamin B (Ab-1; Oncogene Research Products), monoclonal anti-GFP (1E4; Medical and Biological Laboratories, Nagoya, Japan), monoclonal anti-Itch (32; BD PharMingen), polyclonal anti-HA (Medical and Biological Laboratories), polyclonal anti-Plk3 (H-140; Santa Cruz Biotechnology, Santa Cruz, CA), polyclonal anti-PUMA (Upstate Biotechnology, Lake Placid, NY), polyclonal anti-p21WAF1 (H-164; Santa Cruz Biotechnology), polyclonal anti-PARP (Cell Signaling Technology, Beverly, MA), polyclonal anti-p300 (H-272; Santa Cruz Biotechnology), or polyclonal anti-actin (20–33; Sigma) antibodies.

Immunostaining and confocal microscopy

H1299 cells were grown on glass cover slips overnight. Cells were then co-transfected with expression plasmids for HA-p73{alpha} plus FLAG-Plk3. Twenty-four hours after transfection, cells were treated with CDDP or left untreated. Twenty-four hours after CDDP treatment, cells were washed in PBS, fixed in 3.7% formaldehyde for 30 min at room temperature, permeabilized with 0.2% Triton X-100 for 5 min at room temperature and blocked with PBS containing 3% bovine serum albumin (BSA). After blocking, cells were simultaneously incubated with polyclonal anti-HA and monoclonal anti-FLAG antibodies for 1 h at room temperature. After washing with PBS, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG and rhodamine-conjugated anti-rabbit IgG for 1 h at room temperature. Cell nuclei were stained with DAPI. Cells were examined by confocal microscope.

Immunoprecipitation

Cell lysates prepared from HeLa cells exposed to 20 µM of CDDP were precleared with 30 µL of protein G-Sepharose beads for 1 h at 4 °C. Equal amounts of cell lysates (1 mg of protein) were incubated with normal mouse serum (NMS) or with monoclonal anti-p73 antibody overnight at 4 °C. After the incubation with the primary antibodies, reaction mixtures were incubated with 30 µL of proteinG-Sepharose beads for 1 h at 4 °C and the immunocomplexes were extensively washed with lysis buffer. The immunoprecipitates were mixed with 30 µL of SDS-sample buffer, boiled for 5 min and analyzed by immunoblotting with monoclonal anti-Plk3 antibody. The immunoprecipitated proteins were visualized using enhanced chemiluminescence system (ECL; Amersham Biosciences, Piscataway, NJ) according to the manufacturer's instructions.

Luciferase reporter assay

H1299 cells were co-transfected with the constant amount of the expression plasmid for HA-p73{alpha} (12.5 ng), luciferase reporter construct bearing p53/p73-responsive element derived from p21WAF1, BAX or p53AIP1 (100 ng) and Renilla luciferase expression plasmid (10 ng) along with or without the increasing amounts of the expression plasmid encoding FLAG-Plk3 (12.5, 25 or 50 ng). Total amount of plasmid DNA was kept constant (510 ng) with pcDNA3 (Invitrogen). Forty-eight hours after transfection, cells were lysed and their luciferase activities were measured by the dual-luciferase reporter assay system (Promega, Madison, WI).

In vitro pull-down assay

GST and GST-p73{alpha} deletion mutants were synthesized and purified as described previously (Koida et al. 2008). FLAG-Plk3 was generated in vitro in the presence of [35S]Methionine using the quick-coupled in vitro transcription and translation system (Promega) according to the manufacturer's instructions. For the in vitro pull-down assay, radio-labeled FLAG-Plk3 (10 µL of a 50 µL of reaction) was mixed with GST or GST fusion proteins (1 µg) in NETN buffer containing 50 mM Tris–Cl, pH 7.5, 150 mM NaCl, 0.1% Nodidet P-40 and 1 mM EDTA. Following incubation in the presence of glutathione Sepharose beads for 2 h at 4 °C with gentle shaking, the beads were washed with the binding buffer. The bound 35S-labeled proteins were then eluted by boiling in the SDS-sample buffer for 5 min and analyzed by SDS-polyacrylamide gel electrophoresis. Following electrophoresis, gel was destained, dried and exposed to an X-ray film with an intensifying screen at –70 °C.

In vitro kinase reaction

GST or GST-p73{alpha} deletion mutants were incubated with the active form of Plk3 (Cell Signaling) in a solution containing 40 mM MOPS-NaOH (pH 7.0), I mM EDTA, 25 mM sodium acetate, and 0.25 mM ATP in the presence of [{gamma}-32P]ATP at 30 °C for 20 min. After incubation, the reaction mixtures were separated by SDS-polyacrylamide gel electrophoresis. The gel was then dried and subjected to autoradiography.

Protein decay rate analysis

H1299 cells were transfected with 1.0 µg of the expression plasmid for HA-p73{alpha} together with or without 1.0 µg of FLAG-Plk3 expression plasmid. Twenty-four hours after transfection, cells were treated with cycloheximide (at a final concentration of 100 µg/mL). At the indicated time points after the addition of cycloheximide, cell lysates were prepared and subjected to immunoblotting with anti-p73 or with anti-actin antibody. Densitometry was used to quantify the amounts of HA-p73{alpha} which normalized to actin.

siRNA-mediated knockdown

To knockdown the endogenous Plk3, H1299 cells were transfected with the chemically synthesized siRNA targeting Plk3 or with the control siRNA (Dharmacon, Chicago, IN) using LipofectamineTM RNAiMAX (Invitrogen) according to the manufacturer's instructions. Total RNA and cell lysates were prepared 48 h after transfection.

Statistical analysis

Each experiment was carried out at least three times with consistent results. The representative gel or blot form each experiment is presented in this study. The statistical significance was analyzed using Student's t test.


   Acknowledgements
 
This work was supported in part by a Grant-in-Aid from the Ministry of Health, Labour and Welfare for Third Term Comprehensive Control Research for Cancer, a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and a Grant-in-Aid for Scientific Research from Japan Society for the Promotion of Science.


   Footnotes
 
Communicated by: Takeo Kishimoto

* Correspondence: akiranak{at}chiba-cc.jp or tozaki{at}chiba-cc.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Alberts, G.F. & Winkles, J.A. (2004) Murine FGF-inducible kinase is rapidly degraded via the nuclear ubiquitin–proteosome system when overexpressed in NIH 3T3 cells. Cell Cycle 3, 678–684.[Medline]

Ando, K., Ozaki, T., Yamamoto, H., Furuya, K., Hosoda, M., Hayashi, S., Fukuzawa, M. & Nakagawara, A. (2004) Polo-like kinase 1 (Plk1) inhibits p53 function by physical interaction and phosphorylation. J. Biol. Chem. 279, 25549–25561.[Abstract/Free Full Text]

Conn, C.W., Hennigan, R.F., Dai, W., Sanchez, Y. & Stambrook, P.J. (2000) Incomplete cytokinesis and induction of apoptosis by overexpression of the mammalian polo-like kinase, Plk3. Cancer Res. 60, 6826–6831.[Abstract/Free Full Text]

Donohue, P.J., Alberts, G.F., Guo, Y. & Winkles, J.A. (1995) Identification by targeted differential display of an immediate early gene encoding a putative serine/threonine kinase. J. Biol. Chem. 270, 10351–10357.[Abstract/Free Full Text]

el Bahassi, M., Conn, C.W., Myer, D.L., Hennigan, R.F., McGowan, C.H., Sanchez, Y. & Stambrook, P.J. (2002) Mammalian Polo-like kinase 3 (Plk3) is a multifunctional protein involved in stress response pathways. Oncogene 21, 6633–6640.[CrossRef][Medline]

Elia, A.E., Cantley, L.C. & Yaffe, M.B. (2003) Proteomic screen finds pSer/pThr-binding domain localizing Plk1 to mitotic substrates. Science 299, 1228–1231.[Abstract/Free Full Text]

Feng, Y., Longo, D.L. & Ferris, D.K. (2001) Polo-like kinase interacts with proteasomes and regulates their activity. Cell Growth Differ. 12, 29–37.[Abstract/Free Full Text]

Gaiddon, C., Lokshin, M., Gross, I., Levasseur, D., Taya, Y., Loeffler, J.-P. & Prives, C. (2003) Cyclin-dependent kinases phosphorylate p73 at threonine 86 in a cell cycle-dependent manner and negatively regulate p73. J. Biol. Chem. 278, 27421–27431.[Abstract/Free Full Text]

Gao, M. & Karin, M. (2005) Regulating the regulators: control of protein ubiquitination and ubiquitin-like modifications by extracellular stimuli. Mol. Cell 19, 581–593.[CrossRef][Medline]

Gong, J., Costanzo, A., Yang, H.-Q., Melino, G., Kaelin, W.G. Jr, Levreno, M. & Wang, J.Y. (1999) The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature 399, 806–809.[CrossRef][Medline]

Gonzalez, S., Prives, C. & Cordon-Cordo, C. (2003) p73{alpha} regulation by Chk1 in response to DNA damage. Mol. Cell. Biol. 23, 8161–8171.[Abstract/Free Full Text]

Jiang, N., Wang, X., Jhanwar-Uniyal, M., Darzynkiewicz, Z. & Dai, W. (2006) Polo box domain of Plk3 functions as a centrosome localization signal, overexpression of which causes mitotic arrest, cytokinesis defects, and apoptosis. J. Biol. Chem. 281, 10577–10582.[Abstract/Free Full Text]

Koida, N., Ozaki, T., Yamamoto, H., Ono, S., Koda, T., Ando, K., Okoshi, R., Kamijo, T., Omura, K. & Nakagawara, A. (2008) Inhibitory role of Plk1 in the regulation of p73-dependent apoptosis through physical interaction and phosphorylation. J. Biol. Chem. 283, 8555–8563.[Abstract/Free Full Text]

Li, B., Ouyang, B, Pan, H., Reissmann, P.T., Slamon, D.J., Arceci, R., Lu, L. & Dai, W. (1996) Prk, a cytokine-inducible human protein serine/threonine kinase whose expression appears to be down-regulated in lung carcinomas. J. Biol. Chem. 271, 19402–19408.[Abstract/Free Full Text]

Li, Z., Niu, J., Uwagawa, T., Peng, B. & Chiao, P.J. (2005) Function of polo-like kinase 3 in NF-{kappa}B-mediated proapoptotic response. J. Biol. Chem. 280, 16843–16850.[Abstract/Free Full Text]

Iida, M., Matsuda, M. & Komatani, H. (2008) Plk3 phosphorylates topoisomerase IIa at Thr(1342), a site that is not recognized by Plk1. Biochem. J. 411, 27–32.[CrossRef][Medline]

Liu, Y., Jiang, N., Wu, J., Dai, W. & Rosenblum, J.S. (2007) Polo-like kinases inhibited by wortmannin. Labeling site and downstream effects. J. Biol. Chem. 282, 2505–2511.[Abstract/Free Full Text]

Lowery, D.M., Lim, D. & Yaffe, M.B. (2005) Structure and function of Polo-like kinases. Oncogene 24, 248–259.[CrossRef][Medline]

Niizuma, H., Nakamura, Y., Ozaki, T., Nakanishi, H., Ohira, M., Isogai, E., Kageyama, H., Imaizumi, M. & Nakagawara, A. (2006) Bcl-2 is a key regulator for the retinoic acid-induced apoptotic cell death in neuroblastoma. Oncogene 25, 5046–5055.[CrossRef][Medline]

Ozaki, T. & Nakagawara, A. (2005) p73, a sophisticated p53 family member in the cancer world. Cancer Sci. 96, 729–737.[CrossRef][Medline]

Ren, J., Datta, R., Shioya, H., Li, Y., Oki, E., Biedermann, V., Bharti, A. & Kufe, D. (2002) p73b is regulated by protein kinase Cd catalytic fragment generated in the apoptotic response to DNA damage. J. Biol. Chem. 277, 33758–33765.[Abstract/Free Full Text]

Rossi, M., De Laurenzi, V., Munarriz, E., Green, D.R., Liu, Y.C., Vousden, K., Cesareni, G. & Melino, G. (2005) The ubiquitin–protein ligase Itch regulates p73 stability. EMBO J. 24, 836–848.[CrossRef][Medline]

Scheffner, M., Huibregtse, J.M., Vierstra, R.D. & Howley, P.M. (1993) The HPV-16 E6 and E6-AP complex functions as a ubiquitin–protein ligase in the ubiquitination of p53. Cell 75, 495–505.[CrossRef][Medline]

Smith, M.R., Wilson, M.L., Hamanaka, R., Chase, D., Kung, H., Longo, D.L. & Ferris, D.K. (1997) Malignant transformation of mammalian cells initiated by constitutive expression of the polo-like kinase. Biochem. Biophys. Res. Commun. 234, 397–405.[CrossRef][Medline]

Takai, N., Hamanaka, R., Yoshimatsu, J. & Miyakawa, I. (2005) Polo-like kinases (Plks) and cancer. Oncogene, 24, 287–291.[CrossRef][Medline]

Toh, W.H., Siddique, M.M., Boominathan, L., Lin, K.W. & Sabapathy, K. (2004) c-Jun regulates the stability and activity of the p53 homologue, p73. J. Biol. Chem. 279, 44713–44722.[Abstract/Free Full Text]

Wang, L., Dai, W. & Lu, L. (2007) Stress-induced c-Jun activation mediated by Polo-like kinase 3 in corneal epithelial cells. J. Biol. Chem. 282, 32121–32127.[Abstract/Free Full Text]

Wang, Q., Suqing, X., Chen, J., Fukasawa, K., Naik, U., Traganos, F., Darzynkiewicz, Z., Jhanwar-Uniyal, M. & Dai, W. (2002) Cell cycle arrest and apoptosis induced by human Polo-like kinase 3 is mediated through perturbation of microtubule integrity. Mol. Cell. Biol. 22, 3450–3459.[Abstract/Free Full Text]

Weichert, W., Denkert, C., Schmidt, M., Gekeler, V., Wolf, G., Kobel, M., Dietel, M. & Hauptmann, S. (2004) Polo-like kinase isoform expression is a prognostic factor in ovarian carcinoma. Br. J. Cancer 90, 815–821.[CrossRef][Medline]

Wiest, J., Clark, A.M. & Dai, W. (2001) Intron/exon organization and polymorphisms of the PLK3/PRK gene in human lung carcinoma cell lines. Genes Chromosomes Cancer 32, 384–389.[CrossRef][Medline]

Xie, S., Wu, H., Wang, Q., Cogswell, J.P., Husain, I., Conn, C., Stambrook, P., Jhanwar-Uniyal, M. & Dai, W. (2001) Plk3 functionally links DNA damage to cell cycle arrest and apoptosis at least in part via the p53 pathway. J. Biol. Chem. 276, 43305–43312.[Abstract/Free Full Text]

Yang, Y., Bai, J., Shen, R., Brown, S., Komissarova, E., Huang, Y., Jiang, N., Alberts, G.F., Costa, M., Lu, L., Winkles, J.A. & Dai, W. (2008) Polo-like kinase 3 functions as a tumor suppressor and is a negative regulator of hypoxia-inducible factor-1 alpha under hypoxic conditions. Cancer Res. 68, 4077–4085.[Abstract/Free Full Text]

Zimmerman, W.C. & Erikson, R.L. (2007) Polo-like kinase 3 is required for entry into S phase. Proc. Natl. Acad. Sci. USA 104, 1847–1852.[Abstract/Free Full Text]

Received: 7 February 2009
Accepted: 30 March 2009





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sang, M.
Right arrow Articles by Ozaki, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sang, M.
Right arrow Articles by Ozaki, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS