GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2009) 14, 949-963. doi:10.1111/j.1365-2443.2009.01322.x
© 2009 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, H.
Right arrow Articles by Takisawa, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tanaka, H.
Right arrow Articles by Takisawa, H.

Replisome progression complex links DNA replication to sister chromatid cohesion in Xenopus egg extracts

Hiroshi Tanaka1, Yumiko Kubota1, Tsuyoshi Tsujimura1, Maya Kumano1, Hisao Masai2 and Haruhiko Takisawa1,*

1 Department of Biological Sciences, Graduate School of Science, Osaka University, Toyonaka, Osaka 560-0043, Japan
2 The Genome Dynamics Project, Tokyo Metropolitan Institute of Medical Science, Tokyo 113-8613, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cohesin-mediated sister chromatid cohesion is established during the S-phase, and recent studies demonstrate that a cohesin protein ring concatenates sister DNA molecules. However, little is known about how DNA replication is linked to the establishment of sister chromatid cohesion. Here, we used Xenopus egg extracts to show that AND-1 and Tim1–Tipin, homologues of Saccharomyces cerevisiae Ctf4 and Tof1–Csm3, respectively, are associated with the replisome and are required for proper establishment of the cohesion observed in the M-phase extracts. Immunodepletion of both AND-1 and Tim1–Tipin from the extracts leads to aberrant sister chromatid cohesion, which is similarly induced by the depletion of cohesin. These results demonstrate that AND-1 and Tim1–Tipin are key factors linking DNA replication and establishment of sister chromatid cohesion. On the basis of the physical interactions between AND-1 and DNA polymerases, we discuss a model to describe how replisome progression complex establishes sister chromatid cohesion.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Sister chromatid cohesion is essential for proper transmission of the duplicated genetic information to dividing daughter cells, and it is mediated by cohesin, a multi-protein complex. Electron microscopic analysis reveals that human cohesin is comprised of a large ring-like structure and has an average diameter of about 40 nm (Anderson et al. 2002). Biochemical analysis of genetically manipulated cohesin subunits in yeast cells strongly supports the view that chromosomal cohesin forms a ring in vivo (Gruber et al. 2003). A recent study revealed that the single cohesin molecule concatenates sister DNA molecules in vivo, thus proposing that the cohesion is mediated by embracing the sister DNA molecules with a cohesin ring (Haering et al. 2008). As cohesin is loaded onto chromatin before DNA replication and its presence on chromatin during DNA replication is required for sister chromatid cohesion, the cohesion establishment reaction may involve sliding of the replication fork through the cohesin ring (Lengronne et al. 2006). A number of cohesion establishment factors have been identified by studying budding yeast mutants. Eco1 (Ctf7), an essential S-phase factor in budding yeast, acetylates the cohesin subunit Smc3 to promote the chromatin-bound cohesin to tether sister chromatids (Ben-Shahar et al. 2008; Unal et al. 2008; Zhang et al. 2008). However, most cohesion establishment factors are not essential for growth, and little is known about their function in the establishment reaction.

Accumulating evidence suggests that the eukaryotic replisome forms a complex composed of tens of components. At the onset of the S-phase, the pre-replication complex (pre-RC) at each origin is activated by S-phase-promoting kinases, leading to the formation of the initiation complex of DNA replication (Bell & Dutta 2002; Labib & Gambus 2007). Once replication is initiated, the replication fork is formed as a result of unwinding of DNA followed by replication of unwound DNA by the DNA polymerases. Current studies suggest that Mcm2–7, a central component of the pre-RC, acts as a replicative helicase and that Cdc45 and GINS are co-factors that activate Mcm2–7 by forming a ternary Cdc45/ Mcm2–7/GINS (CMG) complex (Moyer et al. 2006). Upon unwinding of DNA, DNA synthesis is initiated by DNA polymerase {alpha} (Pol {alpha}) and the leading and lagging strands are synthesized separately by DNA polymerase {epsilon} (Pol {epsilon}) and {delta} respectively (Nick McElhinny et al. 2008). In addition to these components essential for replication, studies by Gambus et al. (2006) in budding yeast show that accessory factors are associated with the CMG complex to form a replisome progression complex (RPC). Some of the non-essential components, such as the Tof1–Csm3 complex and Mrc1, appear to be involved in maintaining fork integrity and are recognized as components of the replication checkpoint (Katou et al. 2003). These factors, together with other components including Ctf4, are conserved from yeast to human (Chou & Elledge 2006; Zhu et al. 2007). Considering that three DNA polymerases are located separately in the vicinity of the RPC, the apparent size of the replisome formed on the replication fork may be as large as the maximum diameter of the cohesin ring. It is possible that the large size of the replisome makes it difficult for the replication fork to slide through the cohesin ring.

To establish cohesion, the replisome should interact with the cohesin molecule to catch the ring and finally slide through the ring. These intricate tasks may involve the non-essential components of the RPC. Indeed, Ctf4 is implicated in establishing sister chromatid cohesion in budding yeast (Hanna et al. 2001). Thus, the presence of non-essential components such as Ctf4 at the replication fork would play an important role in establishing cohesion. This notion is supported by the finding that fission yeast Mcl1 and Aspergillus nidulans sepB, homologues of Ctf4, are required for proper segregation of sister chromatids (Harris & Hamer 1995; Williams & McIntosh 2002). By comparison, a recent study of human AND-1, a homologue of Ctf4, showed that AND-1 plays an essential role in DNA replication by recruiting Pol {alpha} to the chromatin, and it is suggested that the defect observed in the Ctf4 mutant of budding yeast is the result of defects in DNA replication (Zhu et al. 2007). Therefore, the function of the Ctf4 homologues in cohesion remains unclear. The Tof1–Csm3 complex and Mrc1 are also implicated in sister chromatid cohesion in budding yeast (Mayer et al. 2004; Xu et al. 2004). However, it is not known whether or not these proteins are actually required during the S-phase for the establishment reaction. The cohesion function of these proteins in higher eukaryotes has not been explored, with the exception of studies in Caenorhabditis elegans suggesting that the homologue of Tof1 plays an important role in establishing sister chromatid cohesion during meiosis (Chan et al. 2003).

During the course of exploring new proteins involved in DNA replication with Xenopus egg extracts, we became interested in the non-essential but conserved proteins of the yeast RPC. Previous studies show that Xenopus Claspin is a homologue of yeast Mrc1 (Nyberg et al. 2002), and recent studies suggest that the Xenopus Tim1–Tipin complex and AND-1 are homologues of the yeast Tof1–Csm3 complex and Ctf4 respectively (Errico et al. 2007; Zhu et al. 2007). Here, we investigated the function of AND-1 and Tim1–Tipin in chromosomal replication and in the establishment of sister chromatid cohesion in Xenopus egg extracts. We demonstrated that AND-1 and Tim1 play a crucial role in establishing sister chromatid cohesion during the S-phase.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cdc45-dependent binding of AND-1 and Tim1 to chromatin

We raised antibodies against Xenopus AND-1, Tim1, Tipin and Claspin to investigate the function of these proteins in Xenopus egg extracts. Western blot analysis of egg extracts using antibodies against each protein specifically recognized a single band corresponding to the calculated molecular mass of each protein (Fig. S1 in Supporting Information). Previous studies on Xenopus Claspin, Tipin and AND-1 show that these proteins bind to chromatin in interphase extracts (Lee et al. 2003; Errico et al. 2007; Zhu et al. 2007). CDK activity and/or pre-RC formation, but not DNA polymerase activity, is required for these proteins to bind chromatin. By examining the binding of these proteins to chromatin during the S- and M-phases, we confirmed that the specific binding of Xenopus AND-1, Claspin, Tim1 and Tipin to chromatin depends on the initiation of DNA replication in the S-phase and does not occur in the M-phase (Fig. S2). The similar behavior of these proteins prompted us to explore the factors involved in their binding to chromatin. We first examined whether the binding of each of these proteins to chromatin depends on the other proteins (Fig. 1a,d). In accordance with the initiation-dependent binding of these proteins to chromatin, depletion of Cdc45 from the egg extract abolished the binding of AND-1, Tim1, Tipin and Claspin to chromatin. Tim1, Tipin and Claspin bound to chromatin in the absence of AND-1, and AND-1 bound to chromatin in the absence of Tim1 or Claspin. It should also be noted that Tipin and Claspin failed to bind to chromatin in the absence of Tim1. These data demonstrate that AND-1 and Tim1 bind independently to chromatin and that the binding of these proteins to chromatin requires Cdc45.


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
Figure 1  Cdc45-dependent chromatin binding of AND-1 and Tim1–Tipin. (a) Independent chromatin binding of AND-1 and Tim1–Tipin. Egg extracts were immunodepleted with pre-immune, anti-Cdc45, anti-AND-1, anti-Tim1 (A1) or anti-Claspin anti-sera. Sperm chromatin was incubated with the depleted extracts for 60 min at 23 °C. Depleted extracts and chromatin fractions were analyzed using SDS-PAGE, and immunostained with antibodies indicated at the right-hand side of the panel. As a negative control, the sample was prepared from the egg extract without sperm chromatin (-sperm). (b) Requirement of Pol {alpha} and {epsilon} for the chromatin binding of AND-1 and Tim1. Egg extracts were immunodepleted with pre-immune serum or anti-Cdc45, anti-AND-1, anti-Pol {alpha} or anti-Pol {epsilon} antibody. Chromatin fractions were prepared as in (a). (c) Requirement of RecQ4 and RPA for the chromatin binding of AND-1 and Tim1–Tipin. Egg extracts were immunodepleted with pre-immune serum or anti-RecQ4 or anti-RPA antibody. Sperm chromatin was incubated in the depleted extracts with or without aphidicolin (aph, final 10 µM) for 45 min at 23 °C. Chromatin fractions were isolated, analyzed using SDS-PAGE, and immunostained with the indicated antibodies. (d) Summary of the requirement of AND-1, Tim1–Tipin, Claspin and various replication proteins for chromatin binding of these proteins. +: bound to chromatin, –: not bound to chromatin, n.d.: not tested in this study. aLee et al. (2003). bMatsuno et al. (2006). cMimura et al. (2000).

 
As AND-1 and Tim1 bound to chromatin in the presence of aphidicolin (Fig. S2b), we examined whether the binding requires the recruitment of DNA polymerases onto the chromatin. AND-1 and Tim1 bound to chromatin in the absence of Pol {epsilon} or Pol {alpha} (Fig. 1b). In addition, the binding of Pol {epsilon} and Pol {alpha} to the chromatin was unaffected by AND-1 depletion. Our finding that the binding of Pol {alpha} to chromatin was unaffected by AND-1 depletion is not consistent with the findings of a previous report (Zhu et al. 2007). To further explore the critical events in the binding of AND-1 and Tim1 to chromatin, we investigated the role of RecQ4 and RPA, both of which are required for replication after the binding of Cdc45 (Sangrithi et al. 2005; Matsuno et al. 2006). RPA is required for stabilizing the single-stranded DNA formed upon DNA unwinding and is required for the loading of Pol {alpha} onto the chromatin. The precise function of RecQ4 is unknown, but it is required for the loading of Pol {alpha} onto the chromatin after the binding of Cdc45. Upon depleting RecQ4 or RPA from the extract, the replication activity was diminished in the depleted extract (data not shown). However, both AND-1 and Tim1 bound to chromatin in the absence of RecQ4 or RPA, irrespective of the presence of aphidicolin in the extracts (Fig. 1c). It should be noted that the binding of RecQ4 to chromatin increased in RPA-depleted extract compared with the mock-depleted extract.

Protein interactions of AND-1, Tim1–Tipin and Claspin

The similar chromatin-binding profiles of AND-1 and Tim1 in various depleted extracts suggested that AND-1 and Tim1 recognize a similar intermediate for the formation of the replisome. To identify targets of AND-1 and Tim1, we first examined whether these proteins interacted with Mcm2–7 or cohesin, two major chromatin-binding proteins in the egg extracts (Fig. 2a and Table S1). Tim1, Tipin and Claspin did not co-precipitate with AND-1, being consistent with our finding that AND-1 and Tim1 bind independently to chromatin. Immunoprecipitation of Tim1 with the Tim1 A2 antibody, but not the Tim1 A1 antibody, resulted in the co-precipitation of AND-1, Mcm2 and Mcm6 from the extracts. Smc3 also co-precipitated with both of Tim1 antibodies. Tim1, AND-1 and Mcm6 co-precipitated with Claspin. We also found that Tim1 and Tipin co-precipitated with each other in a similar manner, i.e. the amount of Tim1 and Tipin in the immunoprecipitates were similar irrespective of the antibody used (Fig. 2a). Consistent with this finding, we demonstrated that depletion of Tim1 resulted in almost complete depletion of Tipin from the extracts (Figs 1a and 5b ).


Figure 2
View larger version (21K):
[in this window]
[in a new window]

 
Figure 2  Interactions between AND-1 and Tim1 and various replisome components. (a) Immunoprecipitation of AND-1, Tim1, Tipin and Claspin from egg extracts. Egg extract was immunoprecipitated with pre-immune serum (control) or the antibodies indicated at the top of the panel. Egg extracts and immunoprecipitates were analyzed using SDS-PAGE and immunostained with antibodies indicated at the right-hand side of the panel. (b) Co-immunoprecipitation of AND-1 and replication proteins from egg extracts. Immunoprecipitation was performed as described in (a). The band above Cdc45 was a non-specific band. (c) Co-immunoprecipitation of AND-1 and replication proteins from replicating chromatin. The replicating chromatin fraction was isolated from egg extracts incubated with sperm chromatin for 35 min at 23 °C. Isolated chromatin was digested by MNase to solubilize the chromatin-binding proteins. Solubilized proteins were then immunoprecipitated and analyzed as in (a). Flow-through fractions collected after the chromatin immunoprecipitation were also analyzed. Asterisk indicates the IgG heavy chain. Double asterisks indicate the IgG light chain.

 

Figure 5
View larger version (32K):
[in this window]
[in a new window]

 
Figure 5  Tim1–Tipin and AND-1 together are required for proper establishment of sister chromatid cohesion. (a) Effect of Tim1 and Claspin depletion on sister chromatid cohesion in the egg extracts. Condensed chromatin in mock-, Tim1- and Claspin-depleted extracts was prepared and visualized as described in the legend to Fig. 4. Bar: 1 µm. Boxed areas indicate enlarged regions shown on the middle panels. Bar: 0.5 µm. Right panel shows the distribution of distances between sister chromatids, measured as described in the legend to Fig. 4b, except that measurements were accumulated at each pixel (=0.065 µm). (b) Chromatin binding of cohesin after DNA replication in the absence of AND-1, Tim1 or Claspin. Sperm chromatin was incubated for 120 min at 23 °C with the mock-, AND-1-, Tim1-, Claspin- or AND-1 and Tim1-depleted extracts (mock, {Delta}AND-1, {Delta}Tim1, {Delta}Claspin and {Delta}AT respectively). Depleted extracts and chromatin fractions isolated from the extracts were analyzed using SDS-PAGE, and immunostained with the antibodies indicated at the right-hand side of the panel. (c) Aberrant sister chromatid cohesion in the absence of both AND-1 and Tim1. Sperm chromatin was incubated for 120 min at 23 °C with the mock and with double-depleted extracts containing 1 µM Cy3-dCTP. Recombinant AND-1 (final concentration, 20 µg/mL) and recombinant human Tim1–Tipin (final 3 and 10 µg/mL respectively) were added to the double-depleted extracts before incubation with sperm chromatin ({Delta}AT + rAND-1 + rTim1–Tipin). Bar: 1 µm.

 
We next examined a possible target of replisome components for the binding of AND-1, because there was no apparent interaction between AND-1 and Mcm2–7 or cohesin in the extracts. To identify candidate proteins that interact with AND-1, we screened replication proteins in the egg extract by immunoprecipitation assays (Fig. 2b). Previous studies with budding yeast suggest that Ctf4 interacts with PolI (Pol {alpha}) and GINS (Miles & Formosa 1992; Gambus et al. 2006). AND-1 co-precipitated with Pol {alpha} but did not co-precipitate with GINS. By comparison, Sld5, a subunit of GINS, co-precipitated with the antibody to Psf2, the other GINS subunit, but not with AND-1. We found that Cdc45 and Pol {epsilon} co-precipitated with AND-1. It should be noted that the depletion of AND-1 scarcely affected the amount of Pol {epsilon} or Cdc45 in the extracts (Fig. 1b).

We next performed immunoprecipitation assays to examine the interaction between AND-1 and a component of the replisome on the chromatin (Fig. 2c). Unlike with the egg extracts, we did not detect any robust interactions between AND-1 and the DNA polymerases using replicating chromatin fractions. One reason may be the lower level of polymerases in the fragmented chromatin fractions. By comparison, AND-1 and Cdc45 efficiently co-precipitated from the chromatin fractions and more than 50% of the AND-1 bound to chromatin was recovered by immunoprecipitation with the anti-Cdc45 antibody (Fig. 2c, flow-through fraction). We also detected the co-precipitation of AND-1 and Cdc45 in the chromatin fractions with Psf2. Again, we found that the amount of AND-1 in the flow-through fraction was markedly reduced by immunoprecipitation with Psf2. In addition, Mcm2 was detected in the immunoprecipitates of Psf2, Cdc45 and AND-1. These results showed that the interactions among GINS, Cdc45, AND-1 and Mcm2–7 were more stable on chromatin than in the egg extracts. In contrast to the findings for AND-1, we did not detect tight association between Tim1–Tipin and Mcm2–7 or Cdc45, but we detected co-precipitation of Tim1–Tipin with Mcm3, 5, 6 and Cdc45 in the chromatin fractions (Fig. S3).

Role of AND-1 and Tim1 in DNA replication and Chk1 activation

Chromatin binding and chromatin immunoprecipitation experiments suggest that AND-1 is assembled into a replisome complex before the start of DNA synthesis and stably associates with the replisome during DNA replication. To understand the function of AND-1, we first examined the replication activity of AND-1-depleted extracts (Fig. 3a). The extracts were subjected to the anti-AND-1 antibody three times to generate AND-1-depleted extracts. Following this process, AND-1 was not detected in samples with an extract volume five times greater than that of the mock-treated extract, and comparison of the depleted extracts with various dilution of the mock-depleted extracts suggest that the amount of AND-1 in the AND-1-depleted extracts was as much as few per cent of the mock-depleted one (Fig. S4). Chromatin binding of AND-1 was abolished in the AND-1-depleted extracts (Fig. 1, and see also Fig. 3b). In an average of seven independent experiments DNA replication activity was not significantly decreased in AND-1-depleted extracts, compared with that in the mock-depleted extract, and recombinant AND-1 did not affect DNA replication activity when added to the AND-1-depleted extracts. We further examined DNA replication activity in extracts exposed to the anti-AND-1 antibody to interfere with AND-1 function; however, although we used up to 60 µg of affinity purified antibody per mL of extract, we did not detect any effect on replication activity (data not shown).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

 
Figure 3  Role of AND-1 in DNA replication and Chk1 phosphorylation. (a) Effect of AND-1 depletion on the replication activity of egg extract. Sperm chromatin was incubated at 23 °C for the indicated time periods with mock- or AND-1-depleted extract with or without recombinant AND-1 (final 20 µg/mL), in the presence of [{alpha}-32P] dCTP. The replication products were analyzed by agarose gel electrophoresis and the amounts of 32P incorporated into the DNA were quantified using autoradiography. The replication activities were normalized against that of the mock-depleted extract after incubation for 90 min. Error bars indicate mean ± SD of seven independent experiments. (b) Effect of AND-1 depletion on the activation of Chk1 induced by aphidicolin. Sperm chromatin was incubated for 120 min at 23 °C in mock- and AND-1-depleted extract with or without recombinant AND-1 (final concentration, 20 µg/mL), in the presence or absence of aphidicolin (final 10 µM). Depleted extracts and nuclear fractions isolated from the extracts were analyzed using SDS-PAGE and immunostained with the antibodies indicated at the right-hand side of the panel. Chk1-P indicates hyperphosphorylated Chk1 detected with the Chk1 antibody. Asterisk indicates non-specific signal.

 
The yeast ctf4 mutant shows sensitivity to DNA-damaging agents and synthetic lethality with deletion of components of the replication fork protection complex, such as Mrc1 (Tong et al. 2004; Ogiwara et al. 2007). Therefore, we examined whether AND-1 affects Chk1 activation upon the inhibition of DNA replication. Activation of Chk1 was detected by examining the phosphorylation status of Chk1 in nuclear fractions (Kumagai et al. 1998). The amounts of Orc2, Pol {alpha} and Claspin in the nuclear fractions were not markedly affected by AND-1 depletion, whereas the level of AND-1 was diminished in the AND-1-depleted extracts (Fig. 3b). Addition of recombinant AND-1 to the AND-1-depleted extracts resulted in the accumulation of AND-1 in the nuclear fractions. In the absence of aphidicolin, Chk1 phosphorylation was not detected in the mock-depleted extracts, and a low level of Chk1 phosphorylation was detected in the AND-1-depleted extracts; this level diminished upon the addition of recombinant AND-1. By comparison, in the presence of aphidicolin, we detected a similar level of Chk1 phosphorylation in mock- and AND-1-depleted extracts. These results suggest that AND-1 is not essential for the activation of Chk1 upon inhibition of replication activity with aphidicolin.

A previous study revealed that Tipin is not essential for replication but is required for the activation of Chk1 in response to aphidicolin (Errico et al. 2007). Tipin forms a complex with Tim1, but it remains to be determined whether the defect observed with Tipin-depleted extracts is due to depletion of the Tim1–Tipin complex or Tipin alone. We therefore examined the role of Tim1 in the phosphorylation of Chk1 induced by aphidicolin. Upon depletion of Tim1, most of the Tipin was removed from the extracts, but the replication activity of Tim1-depleted extracts was similar to the level of replication activity in mock-depleted extracts (Fig. S5a). By contrast, Chk1 phosphorylation was markedly reduced in Tim1-depleted extracts compared with that in mock-depleted extracts (Fig. S5b). This decrease in Chk1 phosphorylation was recovered by adding human recombinant Tim1–Tipin complex to the Tim1-depleted extracts (Fig. S5c). In addition to the recovery of Chk1 phosphorylation, the binding of Claspin to the chromatin was recovered by adding recombinant Tim1–Tipin to the Tim1-depleted extracts (Fig. S5d).

AND-1 is required for proper establishment of sister chromatid cohesion in the M-phase extracts

Previous reports show that Ctf4 is involved in the proper establishment of cohesion (Hanna et al. 2001). Therefore, we investigated whether AND-1 is required for sister chromatid cohesion. To examine the sister chromatid cohesion with egg extracts, we first incubated sperm chromatin in the treated extracts containing Cy3-dCTP, which is incorporated into the replicated region of chromatin. After 120 min of incubation when DNA replication has been completed, {Delta}N106-Cyclin B was then added to the extracts to induce S- to M-phase transition and incubated for a further 120 min to complete the condensation of chromatin. In a mock-depleted extract, a pair of condensed and replicated chromatids was observed by Cy3 fluorescence and was found to be closely aligned with a regular interval of cohesive structures along the entire chromosome length (Fig. 4a). To quantify the cohesive structure of condensed chromatin, we evaluated the distance between paired chromosome molecules by measuring the distance between peaks of fluorescence signals for each chromosome axis visualized by immunostain with anti-XCAP-E antibody (Fig. 4b). In mock-depleted extracts, the distribution of distances showed a peak and the average of mean distance measurements taken from three independent experiments was 0.57 ± 0.030 µm. In AND-1-depleted extracts, pairs of replicated chromosomes displayed irregular and partly separated structures revealed by Cy3 fluorescence. The distances between paired chromosome axes were widely distributed and the line plot of the distribution showed a broad peak with an average of mean distances of 0.72 ± 0.059 µm. This disordered chromosome structure was restored by adding recombinant AND-1 to the AND-1-depleted extracts. Chromosomal structures in the AND-1-depleted extracts with added recombinant AND-1 appeared to be similar to those observed in mock-depleted extracts and had a similar distribution of distances (average of mean distances, 0.61 ± 0.038 µm). Rescue of the disordered structures observed in AND-1-depleted extracts by the addition of recombinant AND-1 suggested that these structural defects were due to the absence of AND-1 from the egg extracts.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
Figure 4  Sister chromatid cohesion in the AND-1-depleted extract. (a) Assay of sister chromatid cohesion in the egg extract. Sperm chromatin was incubated for 120 min at 23 °C with mock-, AND-1- or Smc3-depleted extracts containing 1 µM Cy3-dCTP. Recombinant AND-1 (final 20 µg/mL) was added to the AND-1-depleted extract before incubation of the extract with sperm chromatin ({Delta}AND-1 + rAND-1). After the incubation, {Delta}N106-Cyclin B (final 130 µg/mL) was added to the extracts, which were further incubated for 120 min to induce chromatin condensation. Condensed chromatin was fixed with 3.7% formaldehyde and immunostained with anti-XCAP-E antibody to visualize the chromosome axis. Bar: 1 µm. (b) Measurement of distances between sister chromatids. To measure the distance between sister chromatids, regions of chromatin aligned in parallel were selected and the distances between peaks of fluorescence signals from anti-XCAP-E were measured (upper panel). The results obtained with mock- and AND-1-depleted extracts with or without recombinant AND-1 were plotted (lower panel). (c) Chromatin binding of cohesin, condensin and AND-1 at the M-phase. The M-phase chromatin was prepared as in (a); depleted extracts and condensed chromatin fractions isolated from extracts were analyzed using SDS-PAGE and then immunostained with antibodies indicated at the right-hand side of the panel. (d) Assay of the temporal requirement of AND-1 for sister chromatid cohesion. Sperm chromatin was incubated for 120 min at 23 °C with the mock- and AND-1-depleted extracts containing 1 µM Cy3-dCTP. Recombinant AND-1 (final concentration, 20 µg/mL) was added to the AND-1-depleted extract before incubation with sperm chromatin [+rAND-1 (S)] or after DNA replication [+rAND-1 (M)]. Distances between sister chromatids were measured as in (b).

 
In Smc3-depleted extracts, the paired structures of replicated chromosomes were almost completely abolished and most of the replicated chromatin formed clumps, making it difficult to distinguish paired chromosome structures by microscopy. The chromatin structural defects that we observed are in good agreement with the finding of a previous report that cohesin is essential for sister chromatin cohesion in CSF-arrested extracts (Losada et al. 1998). We hereafter describe the defect in AND-1-depleted extracts as a defect in sister chromatid cohesion. The most likely reason underlying impaired cohesion is dissociation of the cohesin complex from M-phase chromatin in AND-1-depleted extracts. To test this possibility, we compared the M-phase chromatin isolated from mock-depleted extracts with that from AND-1-depleted extracts, in the presence and absence of recombinant AND-1. Western blot analysis of egg extracts showed that AND-1 was absent in the depleted extracts, but Smc3, a subunit of cohesin, remained in both extracts. Both Smc3 and XCAP-E bound to the M-phase chromatin in the absence of AND-1, and the ratio of Smc3 to XCAP-E in the chromatin fractions was similar in mock- and AND-1-depleted extracts (Fig. 4c). As cohesin loaded onto the chromatin in the S-phase extracts, irrespective of the presence of AND-1 (Fig. 1b), our results suggest that the cohesion defect in AND-1-depleted extracts is not due to a defect in the loading of cohesin onto the chromatin in the S-phase extracts or to dissociation of cohesin from the chromatin during the M-phase.

As AND-1 is tightly associated with the replisome components, we investigated the requirement for AND-1 in the establishment step of cohesion during DNA replication. Thus, we examined sister chromatid cohesion following the addition of recombinant AND-1 to the AND-1-depleted extracts before and after replication (Fig. 4d). The average distances between sister chromatids in mock- and AND-1-depleted extracts were 0.57 and 0.73 µm respectively. The cohesion defect observed in AND-1-depleted extracts was almost completely restored by the addition of recombinant AND-1 before the start of DNA replication (average of mean distances, 0.61 µm); this is the same condition as shown in Fig. 4a. By comparison, the cohesion defect was not rescued when AND-1 was added after the completion of DNA replication (120 min after the start of incubation) and incubated for a further 120 min in the M-phase extracts. The average distance between sister chromatids was 0.75 µm, giving a distribution similar to that observed for AND-1-depleted extracts (Fig. 4d). These results suggest that AND-1 is required for the proper establishment of cohesion during DNA replication but not after DNA replication.

Tim1–Tipin is involved in the proper establishment of sister chromatid cohesion

Previous studies with budding yeast suggest a possible role for the fork protection complex (Tof1–Csm3–Mrc1) in establishing sister chromatid cohesion (Mayer et al. 2004; Xu et al. 2004). However, little is known about the exact nature of the cohesion defect. Taking advantage of the egg extracts that allowed us to directly observe sister chromatid cohesion, we investigated whether Tim1–Tipin and Claspin are involved in sister chromatid cohesion. Depletion of Tim1 or Claspin from the extracts did not affect the chromatin binding of AND-1 (Fig. 1a) or Smc3 (Fig. 5b). The establishment of cohesion was monitored in the depleted extracts by using an approach similar to that used for AND-1-depleted extracts. The distribution of distances between the sister chromosome axes was unaltered by depletion of Tim1 or Claspin from the extracts, but some regions of the chromatids showed a constantly open configuration in Tim1-depleted extracts compared with mock-depleted extracts (Fig. 5a). In order to distinguish such subtle structural change in sister chromatid cohesion, the distribution of distances between the chromatids was displayed at the interval of one-pixel length (0.065 µm). Examination of the histogram of the distribution revealed that the peak position shifted to two-pixel lengths wider in the Tim1-depleted extracts than in the mock-depleted extracts, and the average distance increased to 0.59 from 0.53 µm for the mock-depleted extract (Fig. 5a). By comparison, the peak shifted only one-pixel length for Claspin-depleted extracts, and the overall distribution of distances was not markedly altered (average distance, 0.54 µm).

To explore the possible interplay between AND-1 and Tim1, we examined the effect of depleting both AND-1 and Tim1 from the egg extracts on sister chromatid cohesion. Depletion of both AND-1 and Tim1 did not alter the amount of cohesin in the egg extracts or that bound to the chromatin after completion of DNA replication (Fig. 5b). The replication activity of double-depleted extracts was lower than that of the mock-depleted extracts (Fig. S6); this may have been the result of poor nuclear formation in the double-depleted extracts. In order to assess the completion of replication, we examined condensed chromatin uniformly labeled with Cy3-dCTP. In mock-depleted extracts, induction of chromosomal condensation after DNA replication led to the formation of sister chromatid cohesion, which was detected as a close alignment of a pair of replicated chromosomes with a regular interval of cohesive structures (Fig. 5c, mock). Cohesive structure of the replicated chromosomes was difficult to detect in double-depleted extracts, as most of the replicated chromatin detected by Cy3 fluorescence showed regions of clamping and dispersal; in the latter there was an irregular and separated configuration of chromatin fibers, which is similar to the chromatin structure found in Smc3-depleted extracts (Fig. 4a). These cohesion defects were completely rescued by the addition of recombinant Xenopus AND-1 and human Tim1–Tipin to the depleted extracts before the start of replication. Most of the replicated chromatin showed cohesive structures similar to that observed in mock-depleted extracts (Fig. 5c). Therefore, we conclude that the aberrant sister chromatid cohesion in extracts depleted in AND-1 and Tim1 was due to the absence of both AND-1 and Tim1–Tipin.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
We showed that AND-1 and Tim1–Tipin were required for the sister chromatid cohesion observed in Xenopus egg extracts. Factors involved in sister chromatid cohesion have been extensively studied in budding yeast as a model organism. Yeast Ctf4 is one of the factors involved in sister chromatid cohesion (Hanna et al. 2001), but the exact function of Ctf4 remains unknown. Tof1 and Csm3 are implicated in the same pathway as Ctf4 for the establishment of cohesion (Xu et al. 2007). As these proteins are putative components of the RPC (Gambus et al. 2006), it is plausible that the replisome plays an important role in establishing sister chromatid cohesion. However, no evidence has been presented for the requirement of these factors during the S-phase. Recent studies in budding yeast have demonstrated that cohesion is formed by embracing sister chromatids with a single cohesin molecule (Haering et al. 2008). This novel finding formed the basis of our investigations into the molecular mechanisms underlying the cohesion establishment reaction catalyzed by the replisome. We found here that AND-1 and Tim1–Tipin, vertebrate homologues of Ctf4 and Tof1–Csm3, respectively, formed a complex with replisome components in Xenopus egg extracts and were required for establishing cohesion during DNA replication. This is the first report showing the role of replisome components such as AND-1 and Tim1 in establishing the sister chromatid cohesion during the S-phase.

Formation of replisome progression complex in Xenopus egg extracts

Previous studies show that Cdc45, but not RPA, is required for the binding of Claspin to chromatin, and that Mcm10 is required for the binding of AND-1 to chromatin (Lee et al. 2003; Zhu et al. 2007). We confirmed here that AND-1, Tim1–Tipin and Claspin are the S-phase-specific chromatin-binding proteins, and that the binding of these proteins to chromatin depends on Cdc45, but not RPA or the DNA polymerases. In addition, we found that Tim1–Tipin is required for the binding of Claspin to chromatin; this is consistent with the results of a previous report that Tipin is required for the binding of Claspin to chromatin (Errico et al. 2007). Apparent chromatin binding of Tim1–Tipin in the absence of RecQ4 further suggests that the fork protection complex is assembled before the formation of replication fork. The observed independent binding of Tim1–Tipin and AND-1 to chromatin, and the strict dependence of this binding on Cdc45, suggests that Tim1–Tipin and AND-1 are assembled onto chromatin after formation of the CMG complex but before the loading of DNA polymerases.

The chromatin immunoprecipitation assays for AND-1 and Tim1–Tipin showed that these proteins were associated with Cdc45, GINS and Mcm2–7 on digested chromatin fractions. In particular, AND-1 appeared to form a tight complex with Cdc45 and GINS, because the immunoprecipitations of Cdc45 and GINS led to a marked decrease in AND-1 in the flow-through fractions. By comparison, we did not detect a tight association between AND-1 and Pol {alpha} on the chromatin; however, the chromatin binding of AND-1 slightly decreased in the absence of Pol {alpha} (Fig. 1b). These results suggest that Pol {alpha} plays an important role in stabilizing AND-1 in the RPC. In addition, we found that AND-1 and Pol {epsilon} could be reciprocally immunoprecipitated from digested chromatin fractions and egg extracts. Taken together, these data suggest that a complex, like the RPC of budding yeast, is formed during DNA replication, and that AND-1 and Tim1–Tipin are components of this complex.

Functional implications of AND-1 and Tim1–Tipin in DNA replication and Chk1 activation

Previous studies show that Tipin and AND-1 are not essential for DNA replication in Xenopus egg extracts but instead play an important role in maintaining the replication fork. Tipin is required for the stalled replication fork to resume DNA replication after the removal of aphidicolin (Errico et al. 2007), whereas AND-1 is required for stabilizing Pol {alpha} on the chromatin (Zhu et al. 2007). In addition, Tipin is required for the activation of Chk1 following the inhibition of DNA polymerases by aphidicolin (Errico et al. 2007). We found here that the Tim1–Tipin complex is required for the activation of Chk1 and the association of Claspin with chromatin. The ability of Tim1–Tipin in recruiting Claspin to chromatin thus suggests that the activation of Chk1 is mediated by Claspin recruited onto the replicating fork via Tim1–Tipin. By contrast, AND-1 is not essential for the activation of Chk1. A previous report showed that AND-1 is required for efficient DNA replication in Xenopus egg extracts (Zhu et al. 2007). It is unclear why we did not detect an effect of AND-1 depletion on DNA replication. It is possible that the procedures we used did not adequately deplete AND-1. However, we detected a defect in the establishment of cohesion with AND-1 depletion and rescued the defect with recombinant AND-1. Differences in the antibodies used in the experiments in the previous study and ours may also account for our failure to detect an effect on DNA replication with AND-1 depletion. The antibody used in the previous report is a neutralizing antibody, which inhibits replication when added to the egg extracts. However, the antibody we used here did not inhibit replication. Thus, it is possible that immunodepletion with the neutralizing antibody results in release of the antibody from the conjugated beads into the extracts, leading to the apparent inhibition of replication.

AND-1 and Tim1–Tipin are required for the proper establishment of sister chromatid cohesion

Our results showed for the first time that AND-1 was required for proper establishment of sister chromatid cohesion in higher eukaryotes. The depletion of AND-1 from Xenopus egg extracts resulted in pairs of replicated chromatids with a more separated structure than in the controls, and this defect was recovered by adding recombinant AND-1 to the AND-1-depleted extracts before DNA replication. Unreplicated DNA should form a physical link between sister chromatids; thus, incomplete DNA replication may lead to incomplete resolution of the chromatids. On the contrary, we detected separated structures of replicated DNAs instead of a cohesive structure. Therefore, our results suggest that AND-1 is required for proper formation of sister chromatid cohesion, and incomplete DNA replication in the absence of AND-1 is not the underlying cause of the defect.

Morphological defects in cohesion were also observed in Tim1–Tipin-depleted extracts. Again, we confirmed that the depletion had no marked effect on the replication activity of the extracts (Fig. S5). Thus, the defect in Tim1-depleted extracts is the result of the absence of Tim1 and not the inhibition of DNA replication. There were no detectable cohesion defects in Claspin-depleted extracts. As the binding of Tim1–Tipin to chromatin is required for the binding of Claspin to chromatin, but not vice versa, the defects in cohesion in Tim1–Tipin-depleted extracts are not the result of the absence of Claspin on the chromatin and suggest a distinct role for Tim1–Tipin in establishing sister chromatid cohesion.

A severe defect in sister chromatid cohesion was observed by the combination of AND-1 and Tim1 depletion. The irregular morphology of the replicated chromatin in the double-depleted extracts was similar to that observed in the Smc3-depleted extracts. As Smc3 is a component of cohesin, the observed defect in the double-depleted extracts suggests that AND-1 and Tim1–Tipin are essential for the proper establishment of sister chromatid cohesion. The requirement for AND-1 and Tim1 in the establishment of cohesion is consistent with previous work in fission yeast and C. elegans (Williams & McIntosh 2002; Chan et al. 2003). In budding yeast, Ctf4 and Tof1 or Csm3 are reported to have a redundant role in the establishment reaction (Xu et al. 2007) and, conversely, another report shows that the depletion of both genes is synthetic lethal (Tong et al. 2004). The cause of the lethality is unknown, and we could not directly correlate our results with the synthetic lethality observed in budding yeast, but our results showed that both AND-1 and Tim1 are required for the proper establishment reaction.

Models for the cohesion establishment reaction mediated by replisome progression complex

We found novel morphological defects in sister chromatid cohesion along the entire length of the chromosome in the absence of AND-1 and Tim1–Tipin. Although it is difficult to speculate on the molecular function of AND-1 and Tim1–Tipin in the establishment reaction on the basis of morphological defects, we propose models for the molecular mechanism underlying the establishment reaction. There are two possible models to explain the behavior of the cohesin molecule bound to unreplicated DNA during DNA replication. In the first model, the cohesin ring remains intact throughout replication, whereas in the second model the ring embracing the DNA opens during replication to allow the passage of the RPC. In the first model, the cohesin molecule bound to the DNA might be an obstacle for the progression of the replisome. Although we do not know the exact diameter of the replisome, it may be as large as 30 nm, which is close to the maximum diameter of the cohesin ring. When the replisome encounters the ring, if the ring is not pushing away, the replication fork may be stalled by the ring. If the helicase alone could slide through the ring, it would be necessary to stop the helicase from moving forward and leaving the polymerases at the ring. In this scenario, Tim1–Tipin may have a role in stabilizing the stalled fork. In order to slide through the ring, the replisome structure needs to be as compact as possible. As AND-1 interacts with Pol {epsilon} and {alpha}, it is possible that AND-1 tethers both polymerases on the leading and lagging strands of the DNA and also stabilizes the replisome by interacting with the helicase. If the ring is opened transiently during DNA replication, according to the second model, it would be difficult to catch the sister chromatids with a cohesin molecule after replication. The replicated sister chromatids would physically separate soon after replication, such that catching both chromatids with a cohesin ring would be increasingly difficult. In this situation, the replisome may function as a tether of the cohesin molecule to allow re-embracing of the replicated sister chromatids soon after replication. The physical interaction that we found here between Tim1 with Smc3 may contribute to such a tethering process. In either case, our study suggests that components of the RPC play a crucial role in the establishment reaction, and further investigation of the functions of these proteins may help elucidate the molecular mechanism underlying the cohesion establishment reaction.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Cloning and protein expression

Full-length Xenopus AND-1 was constructed as follows: the ORF encoding the N-terminal amino acids 1–571 of AND-1 was PCR amplified from the cDNA clone (I.M.A.G.E. ID 4970671, from ATCC, Manassas VA, USA) by using the 5'-primer CGCGGATCCATGCCAGCTATAAAGAAG and the 3'-primer ACCTCTATGATAGACCAC, and then digested with BamHI and NcoI. The cDNA clone XL021l13 (supplied from NIBB, Okazaki, Japan), which contains the ORF encoding the C-terminal amino acids 321–1127, was digested with BamHI and NcoI, and ligated with the PCR-amplified N-terminal fragment.

The full-length AND-1 was then cloned into pGEX 6P-3 (GE Healthcare, Little Chalfont, UK) for expression of the GST-tagged AND-1 protein. Full-length AND-1 was sub-cloned into the BamHI–XhoI site of pGEX 6P-3. The GST-tagged AND-1 protein was expressed in DH5{alpha} at 23 °C for 4 h after induction with 0.1 mM IPTG. Cells were harvested and then lyses by using French pressure cell. Purification of the GST-tagged AND-1 protein and removal of the GST tag with PreScission Protease (GE Healthcare) were performed in accordance with the manufacturer’s instructions. For His-tagged AND-1 protein expression, we used the Bac-To-Bac Baculovirus expression system (Invitrogen, Carlsbad, CA, USA). His-tagged AND-1 protein was expressed in Sf9 insect cells and purified with Ni-NTA agarose (Qiagen, Hilden, Germany) in native conditions in accordance with the manufacturer’s instructions. The expression vector GST-{Delta}N106-cyclin B was a generous gift from Dr K. Ohsumi (Iwabuchi et al. 2002). GST-{Delta}N106-cyclin B was expressed in E. coli BL21 DE3 and affinity purified with Glutathione Sepharose 4B (GE Healthcare) in accordance with the manufacturer’s instructions.

To prepare anti-Xenopus Tim1 antibodies, the N-terminal fragment of Tim1 (1-1113 bp) was PCR amplified using the 5'-primer ATAGAATTCATGGACTTGTACATGATGAATTG and the 3'-primer CTATCTCGAGTTATAAAGAACAGCGCAACACC and sub-cloned into the EcoRI–XhoI site of pGEX 6P-3. The GST-tagged N-terminal fragment of Tim1 was expressed in E. coli. The recombinant protein was recovered as insoluble pellets and further purified using SDS-PAGE.

To prepare anti-Xenopus Tipin antibodies, full-length Tipin cDNA was PCR amplified using the 5'-primer ATAGAATTCATGATGGATCCTTTGGACAACGG and the 3'-primer TATCTCGAGTTCAATATTCTTCTTTAGTGTTTGCACAAGC and then sub-cloned into the EcoRI–XhoI site of pGEX 6P-1. GST-tagged full-length Tipin expressed in E. coli was purified by standard procedures using PreScission protease (GE Healthcare). The Protein complex of full-length human Tim1–Tipin was a generous gift from Dr H. Masai (Yoshizawa-Sugata & Masai 2007).

Antibodies

Anti-AND-1 antibody was raised against full-length AND-1 expressed in E. coli. Anti–Tim1 and Tipin antibodies were raised against the N-terminal fragment of Xenopus Tim1 and full-length Xenopus Tipin respectively. All of these polyclonal antibodies were raised in the rabbit (Hokudo Inc., Sapporo, Japan). XCAP-E and Xenopus Smc3 antibodies were raised against the C-terminal peptides SKTKERRNRMEDVK (Hirano et al. 1997) and EQAKDFVEDDTTHG (Losada et al. 1998) respectively (OPERON Biotechnologies, Huntsville, AL, USA). Phosphorylation of Xenopus Chk1 at Ser344 was detected with human Phospho-Chk1 (Ser345) monoclonal antibody from Cell Signaling Technologies (Beverly, MA, USA). Other antibodies were prepared as described previously (Hashimoto et al. 2006).

Immunodepletion and DNA replication assays

Xenopus egg extracts and permeabilized sperm nuclei were prepared as described previously (Kubota & Takisawa 1993), with slight modifications. For preparation of egg extract, a second centrifugation was carried out at 40 000 g for 10 min. Egg extract was supplemented with 5% glycerol and 20 µg/mL cycloheximide and then frozen in liquid nitrogen until required. Immunodepletion and DNA replication assays were carried out as described previously (Mimura & Takisawa 1998) with slight modifications. For the immunodepletion assay rProtein A sepharose Fast Flow (GE Healthcare) was used instead of Affi-Prep protein A matrix (Bio-Rad), and 10-µL anti-sera were used instead of antibodies. For double-depletion assay anti-AND-1 and anti-Tim1 anti-sera were mixed and bound to rProtein A sepharose Fast Flow (GE Healthcare), and used for immunodepletion as described above. For the DNA replication assay, the autoradiograms were quantified with Image Gauge software (Fujifilm, Tokyo, Japan) and a BAS2500 image analyzer (Fujifilm).

Preparation of chromatin and nuclear fractions

To isolate the chromatin fraction, sperm nuclei were incubated at 23 °C in 50–100 µL of egg extracts (4000 nuclei per µL) for the indicated periods of time in the figures. The samples were diluted with 10 volumes of extraction buffer (EB; 100 mM KCl, 2.5 mM MgCl2, 50 mM HEPES–KOH; pH 7.5) containing 0.25% NP-40 (Wako, Osaka, Japan), incubated for 2 min on ice, and then centrifuged at 10 000 g for 10 min through the layer of EB containing 10% sucrose. The upper layer containing the diluted extract was removed by aspiration and the remaining extract was washed by adding EB to the lower layer and repeating centrifugation at 10 000 g for 10 min. The pellets were washed once with EB, solubilized with SDS-PAGE sample buffer, and then filtered through a 0.45-µm filter (Ultrafree-MC; Millipore, Billerica, MA, USA) to remove insoluble matrix. To isolate the nuclear fraction, sperm nuclei were incubated at 23 °C in 50 µL of egg extract (4000 nuclei per µL) in the presence or absence of 10 µM aphidicolin for the indicated periods of time. The samples were diluted with 450 µL of EB, incubated for 2 min on ice, and then centrifuged at 10 000 g for 5 min through the layer of EB containing 1 M sucrose. The pellets were washed with EB containing 1 M sucrose, solubilized with SDS-PAGE sample buffer and then filtered through a 0.45-µm filter (Ultrafree-MC; Millipore) to remove insoluble matrix.

Immunoprecipitation and chromatin immunoprecipitation

Immunoprecipitation from egg extracts was carried out as described previously (Mimura & Takisawa 1998), except that 10 µL of anti-sera were used instead of antibodies. Chromatin immunoprecipitation was carried out with the digested chromatin fraction in the absence of aphidicolin, as described previously (Mimura et al. 2000).

Cohesion assay and immunofluorescent staining

Egg extracts containing 1 µM Cy3-dCTP (GE Healthcare) were incubated at 23 °C for 2 h with sperm chromatin (2000 nuclei per µL) to complete DNA replication. GST-{Delta}N106-cyclin B (final 130 µg/mL) was then added to the egg extracts to condense the replicated chromatin. The egg extracts were incubated at 23 °C for a further 2 h. The samples were then diluted and fixed for 10 min on ice with 10 volumes of EB containing 3.7% formaldehyde, and the condensed chromatin was recovered on polylysine-coated coverslips by centrifugation at 1200 g for 5 min through EB containing 1 M sucrose. The coverslips were washed and incubated overnight at 4 °C with anti-XCAP-E antibody as the primary antibody, followed by incubation for 1 h at room temperature with Alexa488-labelled anti-rabbit IgG (Molecular Probes, Eugene, OR, USA) as the secondary antibody. The coverslips were washed and mounted on glass slides with mounting solution [15 mM PIPES (pH 6.9), 15 mM NaCl, 80 mM KCl, 3.7% formaldehyde and 50% glycerol] containing Hoechst33258 (Wako) for DNA staining. Images of the condensed chromatin were collected by OpenLab 3.0.9 software (Improvision, Coventry, UK) from a cooled CCD camera (CoolSNAP HQ; Photometrics, Tucson, AZ, USA) with a microscope (BX50; Olympus, Tokyo, Japan) using an UPlanFl objective lens (100x, 1.30 NA, oil immersion; Olympus). Distances between sister chromatids were measured as the lengths between peaks of fluorescent signals of each sister chromosome axis, by using IMAGEJ software (NIH, Bethesda, MD, USA). The distances were measured at regular intervals at a rate of more than 100 measurements per sample. Average distances between sister chromatids were calculated from mean distances of at least three independent experiments, with standard deviation (±SD).


    Acknowledgements
 
We are very grateful to T. Hirano for providing antibodies against XRad21 and XCAP-E, K. Ohsumi for the expression vector of GST-{Delta}N106-cyclin B and T. S. Takahashi and M. Kanemaki for helpful discussions. We thank the Japanese National Bio-Resource Project (Xenopus) for cDNA clone of Xenopus AND-1. This work was supported in part by a Grant-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    Footnotes
 
Communicated by: Hiroyuki Araki Back

* takisawa{at}bio.sci.osaka-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Anderson, D.E., Losada, A., Erickson, H.P. & Hirano, T. (2002) Condensin and cohesin display different arm conformations with characteristic hinge angles. J. Cell Biol. 156, 419–424.[Abstract/Free Full Text]

Bell, S.P. & Dutta, A. (2002) DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71, 333–374.[CrossRef][Medline]

Ben-Shahar, T.R., Heeger, S., Lehane, C., East, P., Flynn, H., Skehel, M. & Uhlmann, F. (2008) Eco1-dependent cohesin acetylation during establishment of sister chromatid cohesion. Science 321, 563–566.[Abstract/Free Full Text]

Chan, R.C., Chan, A., Jeon, M., Wu, T.F., Pasqualone, D., Rougvie, A.E., Meyer, B.J. (2003) Chromosome cohesion is regulated by a clock gene paralogue TIM-1. Nature 423, 1002–1009.[CrossRef][Medline]

Chou, D.M. & Elledge, S.J. (2006) Tipin and Timeless form a mutually protective complex required for genotoxic stress resistance and checkpoint function. Proc. Natl Acad. Sci. USA 103, 18143–18147.[Abstract/Free Full Text]

Errico, A., Costanzo, V. & Hunt, T. (2007) Tipin is required for stalled replication forks to resume DNA replication after removal of aphidicolin in Xenopus egg extracts. Proc. Natl Acad. Sci. USA 104, 14929–14934.[Abstract/Free Full Text]

Gambus, A., Jones, R.C., Sanchez-Diaz, A., Kanemaki, M., van Deursen, F., Edmondson, R.D. & Labib, K. (2006) GINS maintains association of Cdc45 with MCM in replisome progression complexes at eukaryotic DNA replication forks. Nat. Cell Biol. 8, 358–366.[CrossRef][Medline]

Gruber, S., Haering, C.H. & Nasmyth, K. (2003) Chromosomal cohesin forms a ring. Cell 112, 765–777.[CrossRef][Medline]

Haering, C.H., Farcas, A.M., Arumugam, P., Metson, J. & Nasmyth, K. (2008) The cohesin ring concatenates sister DNA molecules. Nature 454, 297–301.[CrossRef][Medline]

Hanna, J.S., Kroll, E.S., Lundblad, V. & Spencer, F.A. (2001) Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol. Cell. Biol. 21, 3144–3158.[Abstract/Free Full Text]

Harris, S.D. & Hamer, J.E. (1995) sepB: an Aspergillus nidulans gene involved in chromosome segregation and the initiation of cytokinesis. EMBO J. 14, 5244–5257.[Medline]

Hashimoto, Y., Tsujimura, T., Sugino, A. & Takisawa, H. (2006) The phosphorylated C-terminal domain of Xenopus Cut5 directly mediates ATR-dependent activation of Chk1. Genes Cells 11, 993–1007.[Abstract/Free Full Text]

Hirano, T., Kobayashi, R., Hirano, M. (1997) Condensins, chromosome condensation protein complexes containing XCAP-C, XCAP-E and a Xenopus homolog of the Drosophila Barren protein. Cell 89, 511–521.[CrossRef][Medline]

Iwabuchi, M., Ohsumi, K., Yamamoto, T.M. & Kishimoto, T. (2002) Coordinated regulation of M phase exit and S phase entry by the Cdc2 activity level in the early embryonic cell cycle. Dev. Biol. 243, 34–43.[CrossRef][Medline]

Katou, Y., Kanoh, Y., Bando, M., Noguchi, H., Tanaka, H., Ashikari, T., Sugimoto, K. & Shirahige, K. (2003) S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424, 1078–1083.[CrossRef][Medline]

Kubota, Y. & Takisawa, H. (1993) Determination of initiation of DNA replication before and after nuclear formation in Xenopus egg cell free extracts. J. Cell Biol. 123, 1321–1331.[Abstract/Free Full Text]

Kumagai, A., Guo, Z., Emami, K.H., Wang, S.X. & Dunphy, W.G. (1998) The Xenopus Chk1 protein kinase mediates a caffeine-sensitive pathway of checkpoint control in cell-free extracts. J. Cell Biol. 142, 1559–1569.[Abstract/Free Full Text]

Labib, K. & Gambus, A. (2007) A key role for the GINS complex at DNA replication forks. Trends Cell Biol. 17, 271–278.[CrossRef][Medline]

Lee, J., Kumagai, A. & Dunphy, W.G. (2003) Claspin, a Chk1-regulatory protein, monitors DNA replication on chromatin independently of RPA, ATR, and Rad17. Mol. Cell 11, 329–340.[CrossRef][Medline]

Lengronne, A., McIntyre, J., Katou, Y., Kanoh, Y., Hopfner, K.P., Shirahige, K. & Uhlmann, F. (2006) Establishment of sister chromatid cohesion at the S. cerevisiae replication fork. Mol. Cell 23, 787–799.[CrossRef][Medline]

Losada, A., Hirano, M. & Hirano, T. (1998) Identification of Xenopus SMC protein complexes required for sister chromatid cohesion. Genes Dev. 12, 1986–1997.[Abstract/Free Full Text]

Matsuno, K., Kumano, M., Kubota, Y., Hashimoto, Y. & Takisawa, H. (2006) The N-terminal noncatalytic region of Xenopus RecQ4 is required for chromatin binding of DNA polymerase {alpha} in the initiation of DNA replication. Mol. Cell. Biol. 26, 4843–4852.[Abstract/Free Full Text]

Mayer, M.L., Pot, I., Chang, M., Xu, H., Aneliunas, V., Kwok, T., Newitt, R., Aebersold, R., Boone, C., Brown, G.W. & Hieter, P. (2004) Identification of protein complexes required for efficient sister chromatid cohesion. Mol. Biol. Cell 15, 1736–1745.[Abstract/Free Full Text]

Miles, J. & Formosa, T. (1992) Protein affinity chromatography with purified yeast DNA polymerase alpha detects proteins that bind to DNA polymerase. Proc. Natl Acad. Sci. USA 89, 1276–1280.[Abstract/Free Full Text]

Mimura, S., Masuda, T., Matsui, T. & Takisawa, H. (2000) Central role for cdc45 in establishing an initiation complex of DNA replication in Xenopus egg extracts. Genes Cells 5, 439–452.[Abstract]

Mimura, S. & Takisawa, H. (1998) Xenopus Cdc45-dependent loading of DNA polymerase {alpha} onto chromatin under the control of S-phase Cdk. EMBO J. 17, 5699–5707.[CrossRef][Medline]

Moyer, S.E., Lewis, P.W. & Botchan, M.R. (2006) Isolation of the Cdc45/Mcm2–7/GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase. Proc. Natl Acad. Sci. USA 103, 10236–10241.[Abstract/Free Full Text]

Nick McElhinny, S.A., Gordenin, D.A., Stith, C.M., Burgers, P.M. & Kunkel, T.A. (2008) Division of labor at the eukaryotic replication fork. Mol. Cell 30, 137–144.[CrossRef][Medline]

Nyberg, K.A., Michelson, R.J., Putnam, C.W. & Weinert, T.A. (2002) Toward maintaining the genome: DNA damage and replication checkpoints. Annu. Rev. Genet. 36, 617–656.[CrossRef][Medline]

Ogiwara, H., Ui, A., Lai, M.S., Enomoto, T. & Seki, M. (2007) Chl1 and Ctf4 are required for damage-induced recombinations. Biochem. Biophys. Res. Commun. 354, 222–226.[CrossRef][Medline]

Sangrithi, M.N., Bernal, J.A., Madine, M., Philpott, A., Lee, J., Dunphy, W.G. & Venkitaraman, A.R. (2005) Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund–Thomson syndrome. Cell 121, 887–898.[CrossRef][Medline]

Tong, A.H., Lesage, G. & Bader, G.D., et al. (2004) Global mapping of the yeast genetic interaction network. Science 303, 808–813.[Abstract/Free Full Text]

Unal, E., Heidinger-Pauli, J.M., Kim, W., Guacci, V., Onn, I., Gygi, S.P. & Koshland, D.E. (2008) A molecular determinant for the establishment of sister chromatid cohesion. Science 321, 566–569.[Abstract/Free Full Text]

Williams, D.R. & McIntosh, J.R. (2002) mcl1+, the Schizosaccharomyces pombe homologue of CTF4, is important for chromosome replication, cohesion, and segregation. Eukaryot. Cell 1, 758–773.[Abstract/Free Full Text]

Xu, H., Boone, C. & Brown, G.W. (2007) Genetic dissection of parallel sister-chromatid cohesion pathways. Genetics 176, 1417–1429.[Abstract/Free Full Text]

Xu, H., Boone, C. & Klein, H.L. (2004) Mrc1 is required for sister chromatid cohesion to aid in recombination repair of spontaneous damage. Mol. Cell. Biol. 24, 7082–7090.[Abstract/Free Full Text]

Yoshizawa-Sugata, N. & Masai, H. (2007) Human Tim/Timeless-interacting protein, Tipin, is required for efficient progression of S phase and DNA replication checkpoint. J. Biol. Chem. 282, 2729–2740.[Abstract/Free Full Text]

Zhang, J., Shi, X., Li, Y., Kim, B.J., Jia, J., Huang, Z., Yang, T., Fu, X., Jung, S.Y., Wang, Y., Zhang, P., Kim, S.T., Pan, X. & Qin, J. (2008) Acetylation of Smc3 by Eco1 is required for S phase sister chromatid cohesion in both human and yeast. Mol. Cell 31, 143–151.[CrossRef][Medline]

Zhu, W., Ukomadu, C., Jha, S., Senga, T., Dhar, S.K., Wohlschlegel, J.A., Nutt, L.K., Kornbluth, S. & Dutta, A. (2007) Mcm10 and And-1/CTF4 recruit DNA polymerase {alpha} to chromatin for initiation of DNA replication. Genes Dev. 21, 2288–2299.[Abstract/Free Full Text]

Received: 23 March 2009
Accepted: 8 May 2009





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, H.
Right arrow Articles by Takisawa, H.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tanaka, H.
Right arrow Articles by Takisawa, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS