|
|
||||||||
1 College of Bioscience and Biotechnology, Chubu University and CREST, Japan Science and Technology Corporation, 1200 Matsumoto-cho, Kasugai, Aichi 487-8501, Japan
2 Division of Biological Science, Graduate School of Science, Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Several of the factors involved in vesicle fusion during cytokinesis in plants have been isolated (Nacry et al. 2000). The KNOLLE protein of Arabidopsis is a syntaxin-related protein that is involved in the fusion of Golgi-derived vesicles that results in formation of the cell plate during cytokinesis and it is concentrated at cell plates (Lukowitz et al. 1996; Waizenegger et al. 2000). Other factors, including KEULE, dynamin-related proteins (ADL1A and ADL1E) and KORRIGAN, appear also to be involved in vesicle fusion and the formation of cell plates (Waizenegger et al. 2000; Zuo et al. 2000; Kang et al. 2003). Homologues of some of these proteins are known to be involved in cytokinesis of animal cells (Bowerman & Severson 1999; Thompson et al. 2002).
The Golgi-derived vesicles are transported via microtubules in the phragmoplast, which is the cytokinetic apparatus of plant cells that expands centrifugally in the region between the two daughter nuclei. Both genetic and physiological evidence suggests that appropriate organization and/or dynamics of microtubules are critical for the progression of cytokinesis (Nishihama & Machida 2001; Mayer & Jürgens 2002). The gametophytic gemini pollen1 (gem1) mutation of Arabidopsis causes defects in cytokinesis during pollen mitosis I to varying extents (Park et al. 1998; Twell et al. 2002). The GEM1 gene, which is identical to the MICROTUBULE ORGANIZATION 1 gene (MOR1; Whittington et al. 2001), encodes a protein that is related to the MAP215 family of microtubule-associated proteins found in all eukaryotes. MOR1/GEM1 appears to associate with the microtubules of the phragmoplast, as well as with other types of microtubules, and to be involved in cytokinesis (Twell et al. 2002). Treatment of plant cells with reagents that affect the organization of microtubules interrupts the expansion of the phragmoplast (Nishihama & Machida 2001).
The gene for NPK1 (nucleus- and phragmoplast-localized protein kinase 1) of tobacco encodes a member of the mitogen-activated protein kinase kinase kinase (MAPKKK) family (Banno et al. 1993; Nishihama et al. 1997; Machida et al. 1998; Nishihama & Machida 2001), which is preferentially expressed in tissues that contain proliferating cells (Nakashima et al. 1998). The NPK1 protein and its homologues appear to regulate the lateral expansion of the phragmoplast and the cell plate during cytokinesis (Nishihama et al. 2001; Jin et al. 2002; Krysan et al. 2002). The kinase activity of NPK1 increases during late M phase and NPK1 is localized at the leading edge of the equatorial zone of the phragmoplast during cytokinesis. Over-expression of a kinase-defective mutant form of NPK1 in tobacco cells results in inhibition of lateral expansion of the phragmoplast and formation of multinucleated cells with incomplete cell walls (Nishihama et al. 2001). Such over-expression of mutant NPK1 and silencing of the NPK1 gene in tobacco plants result in the formation of multinucleated cells with incomplete cell walls (Nishihama et al. 2001; Jin et al. 2002). Arabidopsis has three homologs of NPK1 (ANP1, ANP2 and ANP3; Nishihama et al. 1997). Loss of function of two of these three Arabidopsis homologues of NPK1 (e.g. ANP2 and ANP3) also results in formation of multinucleated cells with incomplete cell walls during vegetative growth (Krysan et al. 2002).
We have identified two M-phase-specific kinesin-like proteins in tobacco, designated NPK1-activating kinesin 1 (NACK1) and NACK2, which interact with NPK1 to increase its kinase activity (Ito et al. 1998; Nishihama et al. 2002). NACK1 is co-localized with NPK1 at the phragmoplast equator (Nishihama et al. 2002). Over-expression in tobacco cells of a mutant NACK1 protein that lacks the putative motor region results in failure of NPK1 to become concentrated at the phragmoplast equator and cytokinetic defects (Nishihama et al. 2002), suggesting that NACK1 might play an important role in both the subcellular localization and the activation of NPK1 MAPKKK for the positive regulation of cytokinesis.
Recently, we identified the NQK1/NtMEK1 and NRK1 proteins of tobacco as a MAPKK and MAPK, respectively, that act downstream of NPK1 (Soyano et al. 2003). NPK1 phosphorylates and activates NQK1/NtMEK1, which in turn activates NRK1 by phosphorylation. Analysis of the effects on cell division of over-expression of a kinase-defective mutant form of NQK1 and mutations in an Arabidopsis homologue of NQK1, ANQ1, showed that the NQK1 gene and related genes are required for the formation of the cell plate (Soyano et al. 2003). The activities of NPK1, NQK1 and NRK1 in tobacco cells increase at the late M phase of the cell cycle and decrease after the M phase (Nishihama et al. 2001; Soyano et al. 2003). These results led us to suggest the presence of a MAPK cascade, designated the NACK-PQR pathway (Soyano et al. 2003), which is activated by the interaction between NACK1 (NACK2) and NPK1 MAPKKK and positively regulates the formation of the cell plate.
The homologues of the NACK1 and NACK2 genes in Arabidopsis are designated AtNACK1 (At1g18370; Nishihama et al. 2002) and AtNACK2 (At3g43210; Nishihama et al. 2002), respectively, and they are identical to HINKEL (HIK) and STUD (STD)/TETRASPORE (TES), respectively (Strompen et al. 2002; Yang et al. 2003). Loss-of-function mutations in the AtNACK1/HIK gene result in malformed embryos and seedlings that contain abnormally large cells with cell wall stubs and multiple nuclei. These seedlings exhibit severe dwarfism and their growth ceases before bolting (Strompen et al. 2002; Nishihama et al. 2002). These results suggest that the AtNACK1/HIK gene might be involved in the progression of cytokinesis during embryogenesis and in the vegetative growth of Arabidopsis plants, even though it might not be essential during these growth stages. Plants with mutations in STD/TES/AtNACK2 exhibit normal features during vegetative and reproductive growth but cytokinetic defects become apparent during meiosis that normally results in the formation of microspores and abnormally large pollen grains are generated (Hülskamp et al. 1997; Spielman et al. 1997; Yang et al. 2003; our unpublished observations), suggesting that, while STD/TES/AtNACK2 might be essential for cytokinesis during the formation of microspores, it might not play a major role during vegetative and reproductive growth. However, since STD/TES/AtNACK2 transcripts can be detected at a relatively low level during these latter growth stages, as well as during meiosis (Yang et al. 2003; our unpublished observations) and since growth of atnack1/hik mutants is retarded, with abnormal morphology, STD/TES/AtNACK2 and AtNACK1/HIK might be functionally redundant during cytokinesis at certain stages of the growth of Arabidopsis plants. Indeed, since tobacco NACK2 and NACK1 activate NPK1 MAPKKK in a similar manner (Nishihama et al. 2002), it seems likely that NACK1-related kinesin-like proteins in both tobacco and Arabidopsis might be functionally redundant.
As described below, we attempted to make atnack1 atnack2 double mutants to examine the possible functional redundancy of these kinesin-like proteins in Arabidopsis. However, we failed to isolate plants that were homozygous for both mutations. Instead, we observed abnormal megagametogenesis in plants that were doubly heterozygous for atnack1 and atnack2 mutations. The atnack1 and atnack2 mutations affected cellularization (cytokinesis) synergistically during megagametogenesis, with the generation of abortive gametes. Considered together with the previously described functions of NACK1 and NACK2 in tobacco, these results indicate that the products of the AtNACK1/HIK and STD/TES/AtNACK2 genes are functionally redundant but are essential for promotion of the progression of cytokinesis in Arabidopsis.
| Results |
|---|
|
|
|---|
In an attempt to clarify the function of AtNACK2 in Arabidopsis, we performed PCR-based screening and a database search of populations of T-DNA insertion lines and isolated two mutant lines with insertions of T-DNA in the AtNACK2 gene. We isolated AtNACK2 cDNA by RT-PCR and determined the nucleotide sequence of the cDNA (Nishihama et al. 2002; GENBANK accession no. AB088121). Comparison of the sequences of the AtNACK2 cDNA and the corresponding genomic DNA revealed that the AtNACK2-coding region consisted of 14 exons (Fig. 1A). T-DNA sequences in the atnack2-1 and atnack2-2 alleles were inserted in the ninth intron and the twelfth exon, respectively (Fig. 1A). The AtNACK2 gene was shown recently by Yang et al. (2003) to be identical to the STUD/TETRASPORE (STD/TES) gene.
|
Unlike the morphology of atnack1/hik mutants, the morphology of atnack2 mutant plants was indistinguishable from that of wild-type plants during vegetative development (data not shown). The atnack2 plants produced flowers with normal morphology (data not shown). However, the siliques of atnack2 plants were shorter than those of wild-type plants (Fig. 1B) and their fertility was greatly reduced (Fig. 1D). Since atnack2-1 and atnack2-2 plants exhibited similar defects in terms of reduced fertility and deformation of pollen grains (see below), we focused our detailed phenotypic characterization on the atnack2-1 allele. Reciprocal crosses between wild-type and atnack2-1 plants revealed that the atnack2-1 plants were male-sterile (data not shown). Therefore, we examined the morphology of the pollen from atnack2-1 homozygous plants. Mature pollen grains from wild-type plants were ovoid (Fig. 1E) and contained two generative nuclei (Fig. 1G, arrowheads) and a vegetative nucleus (Fig. 1G, arrow). The pollen grains produced by atnack2 plants were larger and nearly spherical (Fig. 1H). Enlarged pollen grains from atnack2 plants often contained more than two generative nuclei (Fig. 1J, arrowheads), suggesting that cytokinesis and the subsequent separation of each pollen cell after pollen meiosis II had not been completed. In fact, atnack2-1 parents produced tetraspore pollen (multinucleated microspores; Fig. 1M,N). These defects were not observed in pollen produced by atnack2/+parents. Taken together, the results suggest that the AtNACK2 gene is required sporophytically for cytokinesis during male gametogenesis.
Patterns of expression of AtNACK1/HIK and STD/TES/AtNACK2 genes are similar but distinct
We next examined the patterns of accumulation of transcripts of the AtNACK1/HIK and STD/TES/AtNACK2 genes (Fig. 2). The results of semiquantitative RT-PCR indicated that, while both the AtNACK1/HIK and the STD/TES/AtNACK2 gene were expressed in tissues that contained proliferating cells, transcripts of the AtNACK1/HIK gene were more abundant in young plants than those of the STD/TES/AtNACK2 gene (Fig. 2A). As reported previously (Strompen et al. 2002), AtNACK1/HIK mRNA accumulated in a patchy pattern during embryogenesis (Fig. 2B). A similar patchy distribution of the AtNACK1/HIK transcript was observed in floral organs that contained dividing cells (Fig. 2D). STD/TES/AtNACK2 mRNA was detected in embryos with a similar distribution (Fig. 2C), but the signals were much weaker than those due to AtNACK1/HIK mRNA (Fig. 2B). A patchy pattern of signals is the hallmark of the accumulation of transcripts of genes that are expressed at specific stages of the cell cycle, such as genes for NACK1 and cyclins, in regions of shoot apical meristems (Fobert et al. 1994; Ito et al. 2001; our unpublished data). In flower buds, STD/TES/AtNACK2 transcripts were detected in the inner regions of developing anthers that contained pollen mother cells (Fig. 2E). Thus pattern of specific accumulation of STD/TES/AtNACK2 transcripts was consistent with the appearance of a major defect due to atnack2-1 during male gametogenesis.
|
As described above, we postulated that the products of the AtNACK1/HIK and STD/TES/AtNACK2 genes might function redundantly to promote cytokinesis in certain organs. To investigate this possibility, we generated atnack1-1/+; atnack2-1/+ double heterozygotes and determined the genotypes of 196 self-pollinated progeny by examining the presence or the absence of the T-DNAs that caused the respective mutations. As shown in Table 1, we failed to obtain any atnack1-1 atnack2-1 double mutants or any plants that were homozygous for one mutation and heterozygous for the other. We obtained similar results when we examined the progeny of an atnack1-2/+; atnack2-1/+plant (Table 1). These results suggested that both AtNACK1/HIK and STD/TES/AtNACK2 might be essential for the viability of gametophytes and/or embryos. To determine whether atnack1 atnack2 gametes are viable, we performed reciprocal crosses between an atnack1-1/+; atnack2-1/+ double heterozygote and a wild-type parent (Table 2). When we used mutant pollen from the heterozygous atnack1-1 or atnack2-1 parent for crosses to a wild-type female parent, mutant alleles were transmitted to approximately 50% of the offspring, as expected (Table 2), indicating that male gametophytes with an atnack1-1 or atnack2-1 single mutation were viable. However, when we crossed the doubly heterozygous parents with wild-type plants, male and female gametes with both mutations did not participate in the development of the next generation (Table 2). These results suggested that 25% of ovules and pollen produced by atnack1/+; atnack2/+plants, with gametes that carried both the atnack1 and the atnack2 mutations, were not viable.
|
|
We investigated the number and shape of nuclei in embryo sacs during female gametogenesis in atnack1/+; atnack2/+plants. A mature wild-type ovule contains an embryo sac, which usually contains four cells, namely, one central cell, one egg cell, and two synergid cells (Christensen et al. 1997; Drews et al. 1998). These cells are formed via simultaneous cellularization of a syncytium with eight nuclei. Two polar nuclei fuse to form a large central-cell nucleus and three anti-podal cells degenerate before maturation (Christensen et al. 1997; Drews et al. 1998).
Figure 3 and Table 3 show that approximately 25% of maturing ovules produced by atnack1-1/+; atnack2-1/+ plants contained multinucleated (37 nuclei) embryo sacs that contained no typical egg cells and synergid cells (Fig. 3D,H), although other ovules had those with four normal nuclei (Fig. 3A,E; Table 3). Such unusual embryo sacs often included five, six or seven nuclei in gynoecia that contained normal ovules just before maturation (Fig. 3C,G; Table 3, stage FG5). After wild-type siblings had matured, abnormal embryo sacs with three, four or five nuclei were frequently observed (Table 3, stages FG6 to FG7), indicating that the number of nuclei in the mutant embryo sacs decreased during the maturation of ovules. Unlike those in wild-type embryo sacs, the nuclei in the abnormal embryo sacs were often uniform in terms of size (Fig. 3G,H), which suggested that the nuclei in embryo sacs with both atnack1 and atnack2 mutations failed to follow the correct path to differentiation.
|
|
To gain some insight into the developmental basis for the generation of the unusual embryo sacs, we followed the course of megagametogenesis in both wild-type and the doubly heterozygous plants. In wild-type ovules at stage FG4 (Fig. 3I), two nuclei were localized at the chalazal pole and the other two nuclei were located at the micropylar pole. Subsequently, at the early FG5 stage (Fig. 3J), nuclear division occurred without cytokinesis (cellularization) to generate a syncytium that contained eight nuclei, four of which were located in the chalazal region and four of which were located in the micropylar region. Prior to the mid FG5 stage, one nucleus migrated from the chalazal region to the micropylar region (Fig. 3K). After cellularization, three nuclei in the chalazal region (anti-podal-cell nuclei) degenerated, and a typical four-celled mature embryo sac remained (Fig. 3M). Development of atnack1 atnack2 embryo sacs deviated from that of their wild-type siblings as early as stage FG5 and not only at the mature stage, FG7 (Fig. 3L,N,O). There was a cluster of nuclei at the centre of each mutant embryo sac, suggesting that the positioning of nuclei was affected by the two mutations before (or just after) cellularization occurred in wild-type siblings.
To examine the cross walls in mature embryo sacs, we examined serial sections of mature ovules that were obtained from atnack1/+; atnack2/+ plants. A central cell, an egg cell, and synergid cells were apparent in embryo sacs with a wild-type phenotype (Fig. 4A,D,G). Typical cross walls between these cells were apparent in the wild-type (Fig. 4D, arrows). By contrast, there were no cross walls between the nuclei in mutant embryo sacs (Fig. 4B,C,E,F,H).
|
| Discussion |
|---|
|
|
|---|
The AtNACK1/HIK and STD/TES/AtNACK2 genes function redundantly during production of functional gametophytes
The atnack2 homozygous mutant exhibited defects only in cytokinesis during male gametogenesis (Fig. 1 and our unpublished observation). However, transcripts of the STD/TES/AtNACK2 gene accumulated in developing wild-type embryos and seedlings, as well as in the pollen mother cells (Fig. 2), implying that STD/TES/AtNACK2 functions in tissues other than pollen, a phenomenon that was not revealed by analysis of the single mutant.
The STD/TES/AtNACK2 protein is most closely related to the NACK2 kinesin-like protein of tobacco (Nishihama et al. 2002). AtNACK1/HIK and tobacco NACK1 are also similar, in terms of predicted amino acid sequences, to STD/TES/AtNACK2 and tobacco NACK2, respectively, although the relationship between NACK1-related proteins and NACK2-related proteins is relatively weak (Nishihama et al. 2002). Both NACK2 and NACK1 can activate NPK1 MAPKKK by binding to this latter protein. Mutations in AtNACK1/HIK result in partial defects in cytokinesis in embryos and cotyledons and lead to growth arrest of Arabidopsis plants before bolting (Strompen et al. 2002; Nishihama et al. 2002). These observations suggested that STD/TES/AtNACK2 and AtNACK1/HIK might be redundant in terms of cytokinetic functions during female gametogenesis, embryogenesis and the vegetative growth stage (Nishihama et al. 2002). Our genetic analysis showed that both male and female gametes that lacked the wild-type alleles of both of these genes (e.g. atnack1-1 atnack2-1) did not participate in development of the next generation (Table 2). However, each single-mutant gamete was basically functional (Table 2). Therefore, it seems likely that the AtNACK1/HIK and STD//TES AtNACK2 proteins have redundant functions in a process that is required for the viability of both male and female gametophytes.
AtNACK1/HIK and STD/TES/AtNACK2 are involved in the distribution of nuclei and cellularization during megagametogenesis
We found that, in the embryo sac of 25% of ovules from atnack1/+; atnack2/+ plants, the cells in the micropylar region occasionally lacked nuclei (Fig. 3). In addition, both the size and the positioning of the nuclei were abnormal. Given that cellularization occurs just prior to maturation stage (i.e. stage FG5) to generate the differentiated egg cell, synergid cells, and central cells in the wild-type (Christensen et al. 1997; Drews et al. 1998), we can reasonably speculate that the processes of development of these cells are tightly coupled and, indeed, our genetic analysis demonstrated a clear genetic link between cellularization and cell differentiation. There are at least two possible explanations, with respect to the roles of AtNACK1 and AtNACK2, for the molecular link between cellularization and the differentiation of cells in the embryo sac. One possibility is that the cellularization is a prerequisite for the subsequent differentiation of cells (Fig. 5, model 1). In this case, AtNACKs might act directly to promote cellularization and the nascent cell boundary-related structure (e.g. cell plate-related vesicles) might be generated in an AtNACK1- and AtNACK2-dependent manner during stage FG5, thereby ensuring the appropriate movement of nuclei and the subsequent differentiation of cells. This assumption is in agreement with the hypothesis, proposed by Christensen et al. (1997) that the cellularization begins at stage early FG5. In addition to a role in generating cross walls between cells, AtNACK1 and AtNACK2 (or their downstream factors) might act directly in the differentiation of cells and/or the appropriate positioning of nuclei, independently of the promotion of cytokinesis (Fig. 5, model 2). Supporting this model, a defect in nuclear positioning in atnack1 atnack2 embryo sac was observed as early as stage FG5, at which cellularization might have not been completed in wild-type siblings. Additional evidence also supports this latter explanation. Two gametophytic mutations in Arabidopsis, gfa3 and gfa7, affect cellularization and the fusion of polar nuclei during megagametogenesis (Christensen et al. 1998). Furthermore, the positioning of nuclei is relatively normal in mutant embryo sacs from gfa3/+ and gfa7/+ plants, in spite of the defect in cellularization (Christensen et al. 1998). Further detailed phenotypic analysis of these mutants and isolation of the corresponding genes that are involved in cellularization of the embryo sac might help us to clarify the relationships among the regulation of cellularization, the positioning of nuclei and the fusion of nuclei.
|
Our analysis indicated that AtNACK1/HIK and STD/TES/AtNACK2 function redundantly to promote cytokinesis during megagametogenesis. The results of reciprocal crosses between an atnack1/+; atnack2/+ parent and a wild-type parent suggested that AtNACK proteins might play a redundant roles in male gametogenesis although it remains unclear whether they are essential for cytokinesis during pollen mitosis I and/or pollen mitosis II. Since atnack1/hik mutants exhibit defects in cytokinesis in the diploid generation (Strompen et al. 2002; Nishihama et al. 2002), both gametophytic and sporophytic generations seem to involve a common molecular mechanism for cytokinesis. It remains to be determined whether common factors downstream of NACK-related kinesin-like proteins (NACK1, NACK2, AtNACK1/HIK and STD/TES/AtNACK2) are involved in the two generations. In tobacco, a signalling pathway involving the NACK1 protein (the NACK-PQR pathway), which positively regulates cytokinesis, has been identified (Nishihama et al. 2001, 2002; Soyano et al. 2003). This NACK-PQR pathway involves the localization of NACK1 and NPK1 MAPKKK to the phragmoplast equator, activation of NPK1 MAPKKK via interaction with NACK1 (Nishihama et al. 2002), activation by NPK1 of NQK1/NtMEK1 MAPKK via phosphorylation, and activation by active NQK1 of NRK1/NTF6 MAPK (Soyano et al. 2003). The NACK-PQR pathway appears to be conserved in tobacco and Arabidopsis because loss of function of the Arabidopsis homologues of the NPK1 and NQK1 genes (e.g. anp2 anp3 double mutant and the anq1 mutant), as well as atnack1 mutations, results in defects in cytokinesis in various tissues at the sporophytic generation (Krysan et al. 2002; Nishihama et al. 2002; Soyano et al. 2003).
The triple mutant combination of loss-of-function mutations in three ANP genes (anp1 anp2 anp3) that encode Arabidopsis homologues of NPK1 was not transmitted through either male or female gametes (Krysan et al. 2002). This result also indicates that the three ANP genes of Arabidopsis are functionally redundant and essential for formation of functional gametophytes. It will be of interest to determine whether the embryo sac of the anp1 anp2 anp3 triple mutant has a phenotype identical to that of the atnack1 atnack2 double mutant (e.g. defective cellularization and nuclear positioning during megagametogenesis).
Our data provide novel evidence for involvement of AtNACK1/HIK and STD/TES/AtNACK2 in cytokinesis during the gametophytic generation. They also suggest that these proteins might function mainly in somatic and meiotic cell division, respectively, even though they appear to function somewhat redundantly. Further genetic analysis of components of the NACK-PQR pathway might allows us to elucidate the mechanism that positively regulates cytokinesis in both the gametophytic and sporophytic generations.
| Experimental procedures |
|---|
|
|
|---|
We screened 133 440 T-DNA-tagged Arabidopsis plants, generated at the Arabidopsis Knockout Facility of the University of Wisconsin (Krysan et al. 1999), for atnack2 mutations by PCR according to the instructions at http://www.biotech.wisc.edu/Arabidopsis and we identified an atnack2-1 allele. We used primers specific for the T-DNA left-border (JL-202, 5'-CATTTTATAATAACGCTGCGGACATCTAC-3') and AtNACK2 (AtNA2-2F, 5'-AGAGTAGATTTGTAGCGTTTAGGTCTTAT-3'; and AtNA2-1R, 5'-CAGAGATTAGATGATCATATGGTTAGGAT-3'). The atnack2-2 (SALK_143396) and atnack1-3 (SALK_092154) mutants were identified in a population of T-DNA tagged Arabidopsis plants generated at the Salk Institute (Alonso et al. 2003). Insertion of the T-DNA in the atnack2-2 allele was verified by PCR using primers specific to AtNACK2 (AtNACK2-1249F, CAGTCTGAACTTGATCTAGAAAGA; and AtNACK2-2500R, GCTTCAAAGCTCTTATACTCGA) and a primer specific to the left border of T-DNA (LBb1, GTGGACCGCTTGCTGCAACT). A T-DNA sequence was inserted in the ninth exon in the atnack1-3 allele, as verified by PCR using LBb1 and a primer specific to the AtNACK1 sequence (ANK1-092154F, GCGGCCATATACCTTACAGA). The atnack1-3 mutant had a growth defect that was essentially identical to but slightly weaker than that of atnack1-1 and atnack1-2 plants.
Genetic analysis
Arabidopsis thaliana ecotypes Wassilewskija (Ws) and Columbia (Col-0) were used as the wild-type. Plants were grown as previously described (Tanaka et al. 2001). To determine genotypes of AtNACK1 and AtNACK2 loci, genomic DNA was isolated from individual plants and subjected to analysis by PCR with the following primers: for the atnack1-1 mutation, AtNA1-B34R2, ANK1-B34F2 and JL-270; for the atnack1-2 mutation, AtNA1-B5F2, AtNA1-B5R2 and JL-270; and for the atnack2-1 mutation, AtNA2-6F2, AtNA2-7R2 and JL-270. The JL-270 sequence is complementary to the sequence of the T-DNA left border and was used for detection of T-DNA insertion alleles. Nucleotide sequences of primers were as follows: JL-270, 5'-TTTCTCCATATTGACCATCATACTCATTG-3'; ANK1-B34F2, 5'-CGTGCCCTTAAACTCCTTGA-3'; AtNA1-B34R2, 5'-TTCCAGACCCCTGAAAGAGA-3'; AtNA1-B5F2, 5'-GAAAGACTACGATGCGCCAA-3'; AtNA1-B5R2, 5'-CTCCTCTGCTGCGTTTTGAA-3'; AtNA2-6F2, 5'-CGTAGTTTATTGACACTTACTACAGT-3'; and AtNA2-7R2, 5'-GCTACTTTTTGCTGCAGATGTTTCA-3'
Microscopy
For examinations by scanning electron microscopy (SEM) of the morphology of pollen grains, anthers were dissected from open flowers, frozen in liquid nitrogen and observed as previously described (Tanaka et al. 2001). For visualization of nuclei in pollen grains, pollen was processed essentially as described by Park et al. (1998). Open flowers were collected into a staining solution [0.1 M sodium phosphate (pH 7), 1 mM EDTA, 0.1% Triton X-100, 0.4 µg/mL 4',6-diamidino-2-phenylindole (DAPI)]. After brief vortex mixing and centrifugation, pellets of pollen grains were transferred on to glass slides. Fluorescence from DAPI was observed under excitation by ultraviolet light using a fluorescence microscope (Axioplan 2; Carl Zeiss, Oberkochen, Germany) that was equipped with a cooled CCD camera system (Photometrics, Tucson, AZ, USA). Ovules were cleared essentially as described elsewhere (Aida et al. 1997). Gynoecia containing ovules at appropriate stages were cut from open flowers and carpels were slit to facilitate fixation. The dissected gynoecia were fixed overnight in a mixture of ethanol and acetic acid (9 : 1, v/v) at room temperature. After rehydration in a graded ethanol series (90%, 70%, 50% and 30%) for 20 min in each solution, gynoecia were cleared in the Hoyer's solution (a mixture of 20 g of chloral hydrate, 1 mL of glycerol, 6 mL of water and 1.5 g of gum arabic). Cleared ovules were dissected from gynoecia and observed under a microscope equipped with differential interference contrast (DIC) optics (Carl Zeiss). Photographs were taken with a CCD camera (AxioCam; Carl Zeiss). Nuclei were counted on a series of focal planes within each embryo sac. Ovules for observation under a confocal laser scanning microscope (CLSM) were prepared as described elsewhere (Christensen et al. 1997). Specimens were observed under a CLSM (LSM 510; Carl Zeiss) with excitation from an argon laser (488 nm) and an emission filter (505550 nm). Developmental stages of ovules and gynoecia were determined as described elsewhere (Christensen et al. 1997). Samples for semithin sections were prepared essentially as previously described (Nishimura et al. 1993). Gynoecia were dissected from flowers and carpels were partially slit and vacuum-infiltrated with fixative [4% paraformaldehyde, 1% glutaraldehyde and 0.06 M sucrose in 0.05 M cacodylate buffer (pH 7.4)]. They were fixed for 2 h at room temperature and then postfixed in 1.5% osmium tetroxide in cacodylate buffer (0.15 M) for 4 h at 4 °C. The samples were dehydrated in a graded ethanol series, treated with propylene oxide for 1 h and infiltrated with a mixture of propylene oxide and Epon resin (1 : 1, v/v) for 1 h at room temperature. The samples were then embedded in Epon resin, which was allowed to polymerize at 60 °C for 72 h. Semi-thin sections of 350500 nm thickness were cut with a diamond knife (Sumi knife XAC; Sumitomo Electric Industries, Ltd, Osaka, Japan) on an ultramicrotome (Ultracut UCT, Leica Microsystems, Inc., Tokyo, Japan), transferred to glass slides and stained with a 0.05% aqueous solution of toluidine blue for 1 min. Sections were observed and photographed under a microscope (Axioplan 2; Carl Zeiss) equipped with a CCD camera system (AxioCam; Carl Zeiss).
Analyses of gene expression
Amplification by RT-PCR was performed as described elsewhere (Hamada et al. 2000), using primers specific to AtNACK1 (ANK1-B34F2; and ANK1-092154R, 5'-GCTCTCCGATTTCCATTTCCA-3') and AtNACK2 (ANK2-1249F; and ANK2-800R, 5'-CCTGAAATCTGGAGTCTGTTCA-3'). In situ hybridization was performed as described elsewhere (Tanaka et al. 2001). A 551-bp and a 522-bp products of PCR [nt 1134 to nt 1684 of AtNACK1 cDNA (AB081599 [GenBank] ) and nt 1163 to nt 1684 of AtNACK2 cDNA (AB088121 [GenBank] )] were cloned into pBluescript (SK-) (Stratagene, La Jolla, CA, USA) to generate pNU815 and pNU816, respectively. An anti-sense RNA probe for AtNACK1 was generated by linearizing pNU815 with ClaI, with subsequent synthesis of RNA by T3 RNA polymerase. The anti-sense probe for AtNACK2 mRNA was generated using pNU816, HindIII and T3 RNA polymerase.
| Acknowledgements |
|---|
| Footnotes |
|---|
aPresent address: Laboratory of Plant Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA
| References |
|---|
|
|
|---|
Alonso, J.M., Stepanova, A.N., Leisse, T.J., et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science
301, 653657.
Banno, H., Hirano, K., Nakamura, T., et al. (1993) NPK1, a tobacco gene that encodes a protein with a domain homologous to yeast BCK1, STE11, and Byr2 protein kinases. Mol. Cell. Biol.
13, 47454752.
Bowerman, B. & Severson, A.F. (1999) Cell division: plant-like properties of animal cell cytokinesis. Curr. Biol. 9, R658R660.[CrossRef][Medline]
Christensen, C.A., King, E.J., Jordan, J.R. & Drews, G.N. (1997) Megagametogenesis in Arabidopsis wild type and the Gf mutant. Sex Plant Reprod. 10, 4964.[CrossRef]
Christensen, C.A., Subramanian, S. & Drews, G.N. (1998) Identification of gametophytic mutations affecting female gametophyte development in Arabidopsis. Dev. Biol. 202, 136151.[CrossRef][Medline]
Drews, G.N., Lee, D. & Christensen, C.A. (1998) Genetic analysis of female gametophyte development and function. Plant Cell
10, 517.
Fobert, P.R., Coen, E.S., Murphy, G.J. & Doonan, J.H. (1994) Patterns of cell division revealed by transcriptional regulation of genes during the cell cycle in plants. EMBO J. 13, 616624.[Medline]
Goldberg, R.B., de Paiva, G. & Yadegari, R. (1994) Plant embryogenesis: zygote to seed. Science
266, 605614.
Hamada, S., Onouchi, H., Tanaka, H., et al. (2000) Mutations in the WUSCHEL gene of Arabidopsis thaliana result in the development of shoots without juvenile leaves. Plant J. 24, 91101.[CrossRef][Medline]
Higashiyama, T., Yabe, S., Sasaki, N., et al. (2001) Pollen tube attraction by the synergid cell. Science
293, 14801483.
Hülskamp, M., Parekh, N.S., Grini, P., et al. (1997) The STUD gene is required for male-specific cytokinesis after telophase II of meiosis in Arabidopsis thaliana. Dev. Biol. 187, 114124.[CrossRef][Medline]
Ito, M., Araki, S., Matsunaga, S., et al. (2001) G2/M-phase-specific transcription during the plant cell cycle is mediated by c-Myb-like transcription factors. Plant Cell
13, 18911905.
Ito, M., Iwase, M., Kodama, H., et al. (1998) A novel cis-acting element in promoters of plant B-type cyclin genes activates M phase-specific transcription. Plant Cell
10, 331341.
Jin, H., Axtell, M.J., Dahlbeck, D., et al. (2002) NPK1, an MEKK1-like mitogen-activated protein kinase kinase kinase, regulates innate immunity and development in plants. Dev. Cell 3, 291297.[CrossRef][Medline]
Kang, B.H., Busse, J.S. & Bednarek, S.Y. (2003) Members of the Arabidopsis dynamin-like gene family, ADL1, are essential for plant cytokinesis and polarized cell growth. Plant Cell
15, 899913.
Krysan, P.J., Jester, P.J., Gottwald, J.R. & Sussman, M.R. (2002) An Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell
14, 11091120.
Krysan, P.J., Young, J.C. & Sussman, M.R. (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell
11, 22832290.
Lukowitz, W., Mayer, U. & Jürgens, G. (1996) Cytokinesis in the Arabidopsis embryo involves the syntaxin-related KNOLLE gene product. Cell 84, 6171.[CrossRef][Medline]
Machida, Y., Nakashima, M., Morikiyo, K., Soyano, T. & Nishihama, R. (1998) MAPKKK-related protein kinase NPK1: Involvement in the regulation of the M phase of plant cell cycle. J. Plant Res. 111, 243246.[CrossRef]
Mayer, U. & Jürgens, G. (2002) Microtubule cytoskeleton: a track record. Curr. Opin. Plant Biol. 5, 494501.[CrossRef][Medline]
Nacry, P., Mayer, U. & Jürgens, G. (2000) Genetic dissection of cytokinesis. Plant Mol. Biol. 43, 719733.[CrossRef][Medline]
Nakashima, M., Hirano, K., Nakashima, S., Banno, H., Nishihama, R. & Machida, Y. (1998) The expression pattern of the gene for NPK1 protein kinase related to mitogen-activated protein kinase kinase kinase (MAPKKK) in a tobacco plant: correlation with cell proliferation. Plant Cell Physiol.
39, 690700.
Nishihama, R., Banno, H., Kawahara, E., Irie, K. & Machida, Y. (1997) Possible involvement of differential splicing in regulation of the activity of Arabidopsis ANP1 that is related to mitogen-activated protein kinase kinase kinases (MAPKKKs). Plant J. 12, 3948.[CrossRef][Medline]
Nishihama, R., Ishikawa, M., Araki, S., Soyano, T., Asada, T. & Machida, Y. (2001) The NPK1 mitogen-activated protein kinase kinase kinase is a regulator of cell-plate formation in plant cytokinesis. Genes Dev.
15, 352363.
Nishihama, R. & Machida, Y. (2001) Expansion of the phragmoplast during plant cytokinesis: a MAPK pathway may MAP it out. Curr. Opin. Plant Biol. 4, 507512.[CrossRef][Medline]
Nishihama, R., Soyano, T., Ishikawa, M., et al. (2002) Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex. Cell 109, 8799.[CrossRef][Medline]
Nishimura, M., Takeuchi, Y., De Bellis, L. & Hara-Nishimura, I. (1993) Leaf peroxisomes are directly transformed to glyoxysomes during senescence of pumpkin cotyledons. Protoplasma 175, 131137.[CrossRef]
Park, S.K., Howden, R. & Twell, D. (1998) The Arabidopsis thaliana gametophytic mutation gemini pollen1 disrupts microspore polarity, division asymmetry and pollen cell fate. Development 125, 37893799.[Abstract]
Soyano, T., Nishihama, R., Morikiyo, K., Ishikawa, M. & Machida, Y. (2003) NQK1/NtMEK1 is a MAPKK that acts in the NPK1 MAPKKK-mediated MAPK cascade and is required for plant cytokinesis. Genes Dev.
17, 10551067.
Spielman, M., Preuss, D., Li, F.L., Browne, W.E., Scott, R.J. & Dickinson, H.G. (1997) TETRASPORE is required for male meiotic cytokinesis in Arabidopsis thaliana. Development 124, 26452657.[Abstract]
Strompen, G., El Kasmi, F., Richter, S., et al. (2002) The Arabidopsis HINKEL gene encodes a kinesin-related protein involved in cytokinesis and is expressed in a cell cycle-dependent manner. Curr. Biol. 12, 153158.[CrossRef][Medline]
Tanaka, H., Onouchi, H., Kondo, M., et al. (2001) A subtilisin-like serine protease is required for epidermal surface formation in Arabidopsis embryos and juvenile plants. Development
128, 46814689.
Thompson, H.M., Skop, A.R., Euteneuer, U., Meyer, B.J. & McNiven, M.A. (2002) The large GTPase dynamin associates with the spindle midzone and is required for cytokinesis. Curr. Biol. 12, 21112117.[CrossRef][Medline]
Twell, D., Park, S.K., Hawkins, T.J., et al. (2002) MOR1/GEM1 has an essential role in the plant-specific cytokinetic phragmoplast. Nature Cell Biol. 4, 711714.[CrossRef][Medline]
Waizenegger, I., Lukowitz, W., Assaad, F., Schwarz, H., Jürgens, G. & Mayer, U. (2000) The Arabidopsis KNOLLE and KEULE genes interact to promote vesicle fusion during cytokinesis. Curr. Biol. 10, 13711374.[CrossRef][Medline]
Whittington, A.T., Vugrek, O., Wei, K.J., et al. (2001) MOR1 is essential for organizing cortical microtubules in plants. Nature 411, 610613.[CrossRef][Medline]
Yang, C.Y., Spielman, M., Coles, J.P., et al. (2003) TETRASPORE encodes a kinesin required for male meiotic cytokinesis in Arabidopsis. Plant J. 34, 229240.[CrossRef][Medline]
Zuo, J., Niu, Q.W., Nishizawa, N., Wu, Y., Kost, B. & Chua, N.H. (2000) KORRIGAN, an Arabidopsis endo-1,4-ß-glucanase, localizes to the cell plate by polarized targeting and is essential for cytokinesis. Plant Cell
12, 11371152.
Received: 15 June 2004
Accepted: 1 September 2004
This article has been cited by other articles:
![]() |
H. Buschmann and C. W. Lloyd Arabidopsis Mutants and the Network of Microtubule-Associated Functions Mol Plant, October 3, 2008; (2008) ssn060v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-A. Oh, V. Bourdon, M. Das 'Pal, H. Dickinson, and D. Twell Arabidopsis Kinesins HINKEL and TETRASPORE Act Redundantly to Control Cell Plate Expansion during Cytokinesis in the Male Gametophyte Mol Plant, September 1, 2008; 1(5): 794 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tanaka, M. Watanabe, M. Sasabe, T. Hiroe, T. Tanaka, H. Tsukaya, M. Ikezaki, C. Machida, and Y. Machida Novel receptor-like kinase ALE2 controls shoot development by specifying epidermis in Arabidopsis Development, May 1, 2007; 134(9): 1643 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Drakakaki, O. Zabotina, I. Delgado, S. Robert, K. Keegstra, and N. Raikhel Arabidopsis Reversibly Glycosylated Polypeptides 1 and 2 Are Essential for Pollen Development Plant Physiology, December 1, 2006; 142(4): 1480 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ashby, E. Boutant, M. Seemanpillai, A. Sambade, C. Ritzenthaler, and M. Heinlein Tobacco mosaic virus movement protein functions as a structural microtubule-associated protein. J. Virol., September 1, 2006; 80(17): 8329 - 8344. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sasabe, T. Soyano, Y. Takahashi, S. Sonobe, H. Igarashi, T. J. Itoh, M. Hidaka, and Y. Machida Phosphorylation of NtMAP65-1 by a MAP kinase down-regulates its activity of microtubule bundling and stimulates progression of cytokinesis of tobacco cells Genes & Dev., April 15, 2006; 20(8): 1004 - 1014. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sazuka, I. Aichi, T. Kawai, N. Matsuo, H. Kitano, and M. Matsuoka The Rice Mutant dwarf bamboo shoot 1: A Leaky Mutant of the NACK-type Kinesin-like Gene Can Initiate Organ Primordia but not Organ Development Plant Cell Physiol., December 1, 2005; 46(12): 1934 - 1943. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Abdel-Ghany, I. S. Day, M. P. Simmons, P. Kugrens, and A. S.N. Reddy Origin and Evolution of Kinesin-Like Calmodulin-Binding Protein Plant Physiology, July 1, 2005; 138(3): 1711 - 1722. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||