|
|
||||||||
1 Department of Molecular and Cellular Biology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8397, Japan
2 Department of Biophysics, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan
3 Department of Health and Environmental Sciences, Graduate School of Medicine and Faculty of Medicine, Kyoto University, Kyoto 606-8501, Japan
4 Department of Public health, Hyogo College of Medicine, Hyogo 663-8501, Japan
5 CREST, Japan Science and Technology Agency, Kawaguchi, Japan
6 PREST, Japan Science and Technology Agency, Kawaguchi, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The accumulation of unfolded proteins stimulates pathways leading to the refolding or degradation of unfolded proteins, the attenuation of translation or cell death by apoptosis, depending upon the degree of endoplasmic reticulum (ER) stress that is caused by the presence of aberrant proteins (Kaufman et al. 2002; Mori 2000). In mammalian cells, there are four sensors that respond to ER stress: inositol-requiring 1
(IRE1
), IRE1ß, RNA-dependent protein kinase-like endoplasmic reticulum kinase (PERK) and activating transcription factor 6 (ATF6). PERK plays an important role in the attenuation of translation and apoptosis during ER stress by activating a pathway controlled by ATF4 and the CCAAT/enhancer-binding protein homologous protein (CHOP) (Harding et al. 1999, 2000). IRE1ß is reported to be involved in the ER stress-dependent degradation of rRNA (Iwawaki et al. 2001). IRE1
and ATF6 play essential roles in the induction of ER chaperones. ATF6 is a 90 kD type II ER transmembrane protein containing a DNA-binding domain in the N-terminal cytoplasmic region, and its C-terminal domain resides in the ER lumen (Haze et al. 1999; Yoshida et al. 1998). Upon stimulation by ER stress, ATF6 is cleaved by site-1 and site-2 proteases, the same enzymes that cleave the sterol-response-element binding protein (Ye et al. 2000). The 50 kD N-terminal half of the protein is transported to the nucleus, and recognizes the ER stress response element (ERSE; consensus sequence CCAATN9CCACG) in the promoters of ER chaperone genes, including Grp78, Grp94, calreticulin (Yoshida et al. 1998) and Orp150 (Kaneda et al. 2000). ATF6 binds ERSE only in the presence of nuclear factor Y (NF-Y), which recognizes the CCAAT box (Yoshida et al. 2000, 2001b).
Recently, an mRNA encoding X-box binding factor 1 (XBP1) was shown to be a substrate for IRE1
endoribonuclease activity in mammals and nematodes (Calfon et al. 2002; Lee et al. 2002; Shen et al. 2001; Yoshida et al. 2001a), indicating that XBP1 is a eukaryotic counterpart of yeast Hac1p, which is essential for the unfolded protein response in yeast (Cox & Walter 1996; Mori et al. 1996; Sidrauski & Walter 1997). XBP1 was first identified as a basic leucine zipper (b-ZIP) transcription factor that recognizes a cis-acting element in the promoter of the major histocompatibility complex class 2 gene (Liou et al. 1990), and it is also known as the tax-responsive element binding protein, which recognizes the long-terminal repeat of human T cell leukaemia virus type 1 (Yoshimura et al. 1990). ER stress-activated ATF6 induces the transcription of XBP1 mRNA through the ERSE element of the XBP1 gene (Yoshida et al. 2000), and the XBP1 mRNA is spliced by IRE1
protein under conditions of ER stress (Calfon et al. 2002; Shen et al. 2001; Yoshida et al. 2001a). The XBP1 protein translated from the spliced mRNA is active for transcription, whereas that translated from the unspliced mRNA is inactive and is rapidly degraded. Active XBP1 recognizes the ERSE in the presence of NF-Y and activates the transcription of the XBP1 gene itself and of ER chaperones (Yoshida et al. 2001a). Very recently (Yoshida et al. 2003), the IRE1
/XBP1 pathway was found to be essential for the transcription of the gene encoding the ER degradation-enhancing
-mannosidase-like protein (Oda et al. 2003). Although CHOP has been shown to be important for apoptotic cell death in pancreatic ß cells over-expressing the Ins2 C96Y mutant protein and in ß cells in the Akita mouse (Oyadomari et al. 2002), no information was available concerning the other stress response pathways activated in Ins2+/Akita cells, including those responsible for the induction of ER molecular chaperones.
Here, we established ß cell lines from Ins2+/Akita mice and analysed the transcriptional mechanisms that up-regulate the expression of ER chaperones. The levels of Grp78, Grp94 and the 150 kD oxygen regulated protein (Orp150) were significantly increased in Ins2+/Akitacells, and the activity of a reporter construct driven by the ERSE was up-regulated in Ins2+/Akitacells. Both of the transcription factors that recognize ERSE, ATF6 and XBP1, were strongly activated in Ins2+/Akita cells. We discuss the roles of ATF6 and XBP1 in the stress response to improperly folded insulin.
| Results |
|---|
|
|
|---|
Previously, we reported that the number of pancreatic ß cells of Ins2+/Akita mice is significantly decreased and that insulin secretion is impaired in these mice from 4 weeks of age (Yoshioka et al. 1997). In the Langerhans islets of Ins2+/Akita mice, increased expression of Grp78 and PDI due to the Ins2 C96Y mutation has been reported (Wang et al. 1999). To study in detail the stress response induced by the C96Y mutant form of insulin in ß cells, we established insulinoma cell lines from the progeny of Ins2+/Akita and IT3 insulinoma mice (Miyazaki et al. 1990). Ins2+/+ (IN-2 and IN-3) and Ins2+/Akita (AK-1 and AK-2) ß cell lines exhibited no significant difference in growth rates (approx. 48 h doubling time; data not shown). As determined by ELISA, much less insulin was secreted into the culture medium by Ins2+/Akita cells than by Ins2+/+ cells (Fig. 1A). Little or no difference in the level of intracellular proinsulin was observed in Ins2+/Akita and Ins2+/+ cells (Fig. 1C), although the level of insulin mRNA was significantly lower in Ins2+/Akita cells than in Ins2+/+ cells (Fig. 1D). These results suggest that Ins2 production is inhibited at the mRNA level in Ins2+/Akita cells and that the maturation and/or secretion of insulin is delayed or impaired in these cells. The impaired secretion is most likely to be specific to insulin because secretion rate of alkaline phosphatase, unrelated protein as an example for general secretory proteins, exhibits no significant difference between Ins2+/Akita and Ins2+/+ cells (Fig. 1B).
|
The levels of protein expression in Ins2+/+ and Ins2+/Akita cells were determined by SDS-PAGE analysis of proteins in cell extracts followed by Coomassie staining (Fig. 2A). Proteins of approximately 70, 84 and 138 kD were found to be increased in Ins2+/Akita cells. As these molecular weights are similar to those of Grp78, Grp94 and Orp150, cell extracts were further analysed by Western blotting using specific antibodies (Fig. 2B). Grp78, Grp94 and Orp150 were significantly increased in Ins2+/Akita cells, although the levels of another ER chaperone, calnexin, and of the cytosolic molecular chaperones heat shock cognate protein 70 (Hsc70) and heat shock protein 90 (Hsp90) were not significantly different between Ins2+/+ and Ins2+/Akita cells. Since the promoters of the genes encoding Grp78, Grp94 and Orp150, but not calnexin, contain an ERSE element, these results suggest that the first three chaperones may be up-regulated by an ERSE-associated system.
|
To determine whether the up-regulation of ER chaperones in Ins2+/Akita cells is ERSE-dependent, we assayed the activity of wild-type and ERSE-disrupted Grp78 promoters fused to a reporter gene in Ins2+/Akita (AK-1) and Ins2+/+ (IN-2) cells (Fig. 3A). In Ins2+/+ cells, the wild-type Grp78 promoter was 5-fold more active than the ERSE-disrupted promoter, indicating that the ERSE-dependent transcription system is active even in ß cells expressing wild-type Ins2. This is consistent with the observation that Grp78 and Orp150 are up-regulated in the pancreas and in the ß cell line MIN6 (Kobayashi et al. 2000) and suggests that insulin production is inherently stressful to cells. On the other hand, the transcriptional activity of the wild-type Grp78 promoter was twice as strong in Ins2+/Akita cells as in Ins2+/+ cells, although the activity of the ERSE-disrupted promoter was lower in Ins2+/Akita cells than in Ins2+/+ cells. These observations indicate that ERSE-dependent transcription is elevated in ß cells containing the Ins2 C96Y mutation. To confirm the effect of the Ins2 C96Y mutation on the ERSE-dependent stress response, the mutant protein was over-expressed by transient transfection in Ins2+/+ß cells in the presence of the Grp78 reporters (Fig. 3B). The mutant Ins2 induced significantly higher Grp78 promoter activity than did over-expression of wild-type Ins2. The ERSE-disrupted promoter exhibited similar activity in cells over-expressing either the C96Y mutant protein or the wild-type Ins2. In addition, Grp78 promoter activity was up-regulated by over-expression of the C96Y mutant in a dose-dependent manner (data not shown). These observations support the view that the Ins2 C96Y mutant induces a strong ER stress response that is mediated through the ERSE element.
|
The b-ZIP transcription factor ATF6 plays a crucial role in ERSE-dependent transcriptional regulation under conditions of chemically induced ER stress, including treatment with tunicamycin, thapsigargin or DTT, and the inactive 90 kD form of ATF6 is converted to the active 50 kD form under stress conditions (Haze et al. 1999; Yoshida et al. 1998; Yoshida et al. 2000). To test whether ATF6 is activated in Ins2+/Akita and Ins2+/+ß cells, soluble proteins in cell extracts were subjected to Western analysis using an antibody against ATF6 (Fig. 4). A strong 50 kD band was detected in Ins2+/Akita cell extracts, and the intensity of this band was much weaker in Ins2+/+ cells. The 90 kD form of ATF6 was not detected, probably because it is partitioned to the insoluble fraction under our experimental conditions. The amount of the 50 kD form of ATF6 correlates well with the activity of the Grp78 promoter (Fig. 3A), indicating that ATF6 is more highly activated in Ins2+/Akita cells than in Ins2+/+ cells.
|
In addition to the known role of ATF6, the transcription factor XBP1 was recently shown to be important in the ERSE-dependent stress response pathway (Calfon et al. 2002; Lee et al. 2002; Shen et al. 2001; Yoshida et al. 2001a). The TGACGTG motif (previously called the ATF6 site (Wang et al. 2000)) is strongly bound by XBP1 but only very weakly by ATF6 (Lee et al. 2002; Yoshida et al. 2001a). We therefore analysed potential XBP1 activity by examining the transcriptional activity of a c-fos promoter construct with or without five repeats of the TGACGTG motif in a reporter assay using Ins2+/Akita and Ins2+/+ cells (Fig. 5A). In Ins2+/+ cells, the c-fos promoter with the TGACGTG repeats was 6-fold more active than the c-fos promoter alone, suggesting that XBP1 is activated even in Ins2+/+ cells. The TGACGTG-containing promoter in Ins2+/Akita cells was 12-fold more transcriptionally active than the c-fos promoter alone in Ins2+/+ cells, although there was little or no difference in the activity of the c-fos promoter alone in Ins2+/Akita and Ins2+/+ cells. These observations suggest that the Ins2 C96Y mutation stimulates XBP1 activity in ß cells. To further analyse the effect of the C96Y mutation on TGACGTG-dependent transcriptional activity, the Ins2 C96Y mutant was over-expressed in Ins2+/+ß cells by transient transfection and the activity of these reporters was determined (Fig. 5B). The mutant Ins2 induced a significantly higher level of activity by the TGACGTG-containing promoter, whereas no significant difference was observed for the c-fos promoter alone. These observations suggest that XBP1 contributes to the stress response stimulated by the Ins2 mutant.
|
XBP1 mRNA is spliced by the ER membrane protein IRE1
under stress conditions (Calfon et al. 2002; Shen et al. 2001; Yoshida et al. 2001a). The spliced XBP1 mRNA encodes an active 48 kD form whereas the unspliced mRNA encodes an inactive and unstable 32 kD form. The active form binds ERSE in the presence of NF-Y and activates the transcription of ER chaperones, as well as its own transcription. In HeLa cells, the XBP1 protein is undetectable under normal conditions, and the 48 kD form can be detected under chemical stress conditions, including treatments with thapsigargin or tunicamycin (Yoshida et al. 2001a). We performed RT-PCR analysis of total RNA extracted from Ins2+/Akita and Ins2+/+ cells using primers that flank the splice site (Fig. 6A). Polyacrylamide gel electrophoresis followed by ethidium bromide staining of the PCR product indicated that Ins2+/Akita cells contain significantly higher amounts of the spliced form (303 bp band) compared to the unspliced form (329 bp band). In contrast, Ins2+/+ cells contained much lower amounts of the spliced form relative to the unspliced form. Furthermore, we examined the amount of cellular XBP1 by Western analysis (Fig. 6B). A strong 48 kD band was detected in Ins2+/Akita cell extracts, similar to what is seen in thapsigargin-treated Ins2+/+ cells. However, the signal was much weaker in extracts from untreated Ins2+/+ cells, in agreement with the results of RT-PCR analysis. These observations indicate that the level of expression of active XBP1 is much higher in Ins2+/Akita cells than Ins2+/+ cells, although both express active XBP1.
|
| Discussion |
|---|
|
|
|---|
We found that ERSE-dependent transcriptional activity was significantly greater in Ins2+/Akita cells than in Ins2+/+ß cells. Furthermore, transient over-expression of the Ins2 C96Y mutant stimulated ERSE-dependent transcription. These observations indicate that the C96Y mutant stimulates the ER stress response more strongly than does wild-type Ins2. This seems reasonable because the C96Y mutant is unable to form one of the two disulphide bonds that link the A and B chains, and it therefore tends to fold incorrectly. The induction of ER chaperones likely helps to prevent improperly folded proinsulin from aggregating.
Two transcription factors control ERSE activity in response to ER stress: ATF6 (Haze et al. 1999; Yoshida et al. 1998, 2000, 2001b) and XBP1 (Calfon et al. 2002; Shen et al. 2001; Yoshida et al. 2001a). We have demonstrated that the active forms of both transcription factors are present in Ins2+/Akita and Ins2+/+ß cells, consistent with the observed ERSE-dependent reporter activity. The active ATF6 and XBP1 detected in Ins2+/+ß cells may be necessary for the effective production of ER chaperones that assist in the folding of insulin and other proteins. The expression of active XBP1 in normal (Ins2+/+) cells is consistent with this idea, because XBP1 is known to play an essential role in murine development (Masaki et al. 1999; Reimold et al. 2000) and in plasma cell differentiation (Reimold et al. 2001). More importantly, the levels of active ATF6 and XBP1 were much higher in Ins2+/Akita cells than in Ins2+/+ cells, which is again consistent with ERSE-dependent transcription activity. Thus, these observations indicate that the two transcription factors play important roles in the insulin-induced ER stress response in ß cells and that the C96Y mutant activates these transcription factors more strongly than does wild-type Ins2. The stress caused by the C96Y mutant protein is probably more intense than that caused by normal insulin, because our biochemical analysis of recombinant proinsulin molecules suggests that the C96Y mutant protein is more hydrophobic than the wild-type protein (unpublished observation).
The mechanism that triggers the activation of ATF6 and IRE1
(the XBP1 splicing enzyme) has been argued to involve Grp78 protein (Sommer & Jarosc 2002; Urano et al. 2000). Grp78 constitutively binds the 90 kD form of ATF6 in the ER lumen and is released from ATF6 under stress (Shen et al. 2002). ATF6 then moves to the Golgi, where the ATF6-cleaving enzymes site-1 and site-2 proteases are localized. These enzymes activate ATF6 by cleaving the 90 kD membrane-bound form to a cytosolic 50 kD form. Grp78 also binds the IRE1
monomer under normal conditions and dissociates from IRE1
under stress (Bertolotti et al. 2000). After release from Grp78, IRE1
dimerizes and becomes active. Similar binding and release between a Grp78 homologue and Ire1p were found in yeast (Okamura et al. 2000). As our preliminary experiments suggest that C96Y proinsulin binds Grp78 more strongly than does the wild-type protein in vitro (data not shown), the mutant protein probably occupies the Grp78 substrate binding domain for a long time in the ER of ß cells. Improperly folded insulin may compete with ATF6 or IRE1
for binding to Grp78, triggering the activation of ATF6 and XBP1.
Although ER stress is known to induce translational attenuation through activation of PERK and phosphorylation of eIF2
(Harding et al. 1999, 2000), this system is not stimulated in the presence of C96Y proinsulin as evaluated by phosphorylation of eIF2
by Western blotting using antibody against phospho-eIF2
(data not shown). It is also known that ER stress induce apoptosis (Ron 2002b), and apoptosis was observed in ß cells of Akita mice (Oyadomari et al. 2002). However, no apoptotic cell death was observed in Ins2+/Akita cells as monitored by cell viability, morphology and DNA fragmentation (data not shown). These observations suggest that the ER stress in the Ins2+/Akita cells is enough strong to induce ER chaperones but not to stimulate transcriptional attenuation or apoptosis. As the Ins2+/Akita cell lines used here were established by crossing Akita mouse and IT3 insulinona mouse carrying transgenic SV40 T antigen (Miyazaki et al. 1990), these cultured cells are immortalized and divide much more rapidly with continuous dilution of the concentration of C96Y insulin in the ER than normal pancreatic ß cells in vivo. This might be the reason why apoptosis and translation inhibition was not observed in Ins2+/Akita cell lines.
The expression of active forms of ATF6 and XBP1 during chemical stress, including treatments with tunicamycin and thapsigargin, is transient: active ATF6 is present 18 h after the initiation of treatment (Yoshida et al. 1998) whereas active XBP-1 is present from 4 to 10 h (Yoshida et al. 2001a). After 16 h of treatment, both transcription factors almost completely disappear despite the continuation of stress. These observations suggest the existence of a feedback mechanism. In contrast, the ß cells described here constitutively express both ATF6 and XBP1. This feedback mechanism may be blocked in these cells, thus stimulating the rapid production of ER chaperones. Alternatively, the strong stress caused by the presence of malfolded proinsulin may overcome this mechanism. Nevertheless, the cell lines established here provide a new model for analysing the constitutively active ER stress response. Comparisons between these cells and chemically stressed cells will be useful for studying the feedback system. These cell lines may also be useful to search for XBP1-specific target genes, as transcription of the gene encoding the ER degradation-enhancing
-mannosidase-like protein was recently shown to be mediated by the IRE1
/XBP1 pathway but not by ATF6 (Yoshida et al. 2003).
| Experimental procedures |
|---|
|
|
|---|
The IT3 insulinoma transgenic mouse (Miyazaki et al. 1990) was kindly provided by Prof Jun-ichi Miyazaki, Osaka University. Ins2+/Akita females (Yoshioka et al. 1997) were crossed with IT3 males. Insulinomas that developed in the pancreas of the progeny or parental IT3 mice were removed, finely dissected and cultured in DMEM containing a high level of glucose and 15% FBS (Miyazaki et al. 1990). Pancreatic ß cell lines were established from cells grown as monolayers on culture dishes (designated as AK-1 and AK-2 for Ins2+/Akita cells, and IN-2 and IN-3 for Ins2+/+ cells). To chemically induce ER stress, cells were cultured in the presence of 0.3 µM thapsigargin for 4 h.
Antibodies
Antibodies against Grp94, Hsp70, Hsp90 (StressGen, Victoria, Canada), Grp78 (Affinity Bioreagents, Golden, CO, USA), insulin (Linco Research, St. Charles, MO, USA) and XBP1 (M-186; Santa Cruz Biotechnology, Santa Cruz, CA, USA) were obtained from the specified sources. Anti-ATF6 antibody was previously described (Yoshida et al. 1998). Rabbit anti-Orp150 antibody (Tsukamoto et al. 1998) was kindly provided by Dr Hideki Yanagi at the HSP Research Institute. Alkaline phosphatase (AP)- or horseradish peroxidase (HRP)-conjugated antibodies against rabbit, mouse, rat IgG (Biosource, Nivelles, Belgium), or guinea pig IgG (Bethyl, Montgomery, TX) were purchased from the specified manufacturers.
Western blot analysis
Cells washed twice in PBS were homogenized in lysis buffer containing 150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl pH 7.4, 0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate, and 1 mM phenylmethylsulphonylfluoride at 4 °C. Cell extracts were centrifuged (16 900 x g, 30 min) and supernatant was recovered. Pellet was solubilized in lysis buffer supplemented with 4% SDS. The protein concentration was determined using Bradford protein assay solution (Bio-Rad, Hercules, CA, USA). For detection of XBP1, 5 x 107 cells were cultured in a 10 cm dish for 48 h and directly lysed with 300 µl SDS-PAGE sample buffer. Protein extracts were subjected to SDS-PAGE using 8% polyacrylamide gels, or to tricin electrophoresis using 16.5% polyacrylamide gels for detection of insulin (Schagger & von Jagow 1987). Proteins were transferred from gels on to Immobilon-P (Millipore, Bedford, MA, USA) or Hybond-P (Amersham Biosciences, Piscataway, NJ) membranes. Membranes were blocked in PBS containing 5% skim milk and 0.05% Tween 20 and incubated with primary antibodies. After incubation with AP- or HRP-conjugated secondary antibodies, the specific binding of antibodies was detected by developing with tetrazolium bromochloroindolylphosphate and nitrobluetetrazolium in 50 mM sodium carbonate buffer (pH 9.8) containing 1 mM MgCl2 for AP, or by using the ECL system for HRP (Amersham).
ELISA
Insulin concentration was measured with the ELISA Insulin Kit (Seikagaku Co., Tokyo, Japan) according to the manufacturer's instructions.
Plasmids
Wild-type and C96Y Ins2 cDNAs were amplified from poly(A) RNA extracted from Ins2+/Akita insulinomas using an RT-PCR kit (Qiagen, Hilden, Germany) with the following primers:
Ins2FP, TTATTGTTTCAACATGGCCCTGTGGATGCG;Ins2RP, AAAGGTTTTATTCATTGCAGAGGGGTAGGC.
The PCR products were cloned into pT7Blue (Novagen, Madison, WI, USA) and the nucleotide sequences of the inserts were confirmed. The Ins2 cDNAs were subcloned into the mammalian expression vector pCAGGS (Niwa et al. 1991). The reporter gene construct driven by the human wild-type and ERSE-disrupted GRP78 promoter was previously described (Yoshida et al. 1998). The reporter containing five repeats of TGACGTG (the XBP1 binding sequence (Yoshida et al. 2001a)) in the c-fos promoter (Wang et al. 2000), was kindly provided by Dr Ron Prywes. Supercoiled plasmid DNA was purified by caesium chloride ultracentrifugation.
Reporter gene assay
Pancreatic ß cells (2 x 106) were plated in 3.5 cm dishes and cultured for 48 h. Cells were transfected with a total of 1.2 µg of reporter, effector, and internal control plasmid DNAs using 10 µl LipofectAMINE reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After 5 h of exposure to the DNA/LipofectAMINE complex, cells were cultured in medium containing 15% serum for 19 h. The luciferase activity of transfected cells was determined using a dual luciferase assay system (Promega, Madison, WI, USA) according to the manufacturer's instructions, and the activity of firefly luciferase was normalized against that of sea pansy enzyme.
To analyse general secretion rate of proteins, activity of exogenously expressed human AP secreted into culture medium was determined. Cells in 3.5 cm dish were transfected with 5.5 µg of pSEAP2-control vector (BD Biosciences Clontech, Palo Alto, CA, USA) expressing a secreted form of AP under the control of simian virus 40 (SV40) promoter/enhancer and 5.5 µg of pGL3-control expressing luciferase into the cytosol. As a negative control, pSEAP2-basic (BD Biosciences Clontech) lacking the promoter/enhancer was transfected instead of pSEAP2-control. After 24 h of transfection, AP activity in medium was determined by luminescence of cleaved substrate using Great EscAPe SEAP Reporter Systems 3 (BD Biosciences Clontech) according to the manufacturer's instructions. Secreted AP activity of pSEAP2-control transfected cells minus that of pSEAP2-basic transfected cells was used as exogenously expressed AP activity, and this value was standardized against cyosolic lucuferase activity of pGL3-control.
RT-PCR analysis of XBP-1 mRNA splicing
Total RNA was extracted from ß cell lines with an RNeasy Kit (Qiagen). Aliquots 1 µg were amplified with a pair of primers corresponding to nucleotides 392415 (TGAGAACCAGGAGTTAAGAACACGC) and 720696 (TTCTGGGTAGACCTCTGGGAGTTCC) of mouse XBP1 cDNA using the One Step RNA PCR Kit (Takara Shuzo, Tokyo, Japan). PCR conditions included reverse transcription at 50 °C for 30 min, initial denaturing at 94 °C for 2 min, 25 cycles of PCR at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min, and a final extension at 72 °C for 7 min. PCR products were analysed by 4% polyacrylamide gel electrophoresis followed by ethidium bromide staining.
Northen blot analysis
Total RNA (10 µg) was electrophoresed on 2.2 M formaldehyde-1% agarose gels and transferred on to nylon filters. These filters were hybridized with 32P-labelled mouse Ins2 cDNA in ExpressHyb Hybridization Solution (BD Biosciences Clontech) at 65 °C for 1 h and washed in 0.1 x SSC/0.1% SDS at 68 °C.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: nagata{at}frontier.kyoto-u.ac.jp
| References |
|---|
|
|
|---|
Calfon, M., Zeng, H., Urano, F., et al. (2002) IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415, 9296.[CrossRef][Medline]
Cox, J.S. & Walter, P. (1996) A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 87, 391404.[CrossRef][Medline]
Harding, H.P., Novoa, I., Zhang, Y., et al. (2000) Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell 6, 10991108.[CrossRef][Medline]
Harding, H.P., Zhang, Y. & Ron, D. (1999) Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271274.[CrossRef][Medline]
Haze, K., Yoshida, H., Yanagi, H., Yura, T. & Mori, K. (1999) Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell
10, 37873799.
Iwawaki, T., Hosoda, A., Okuda, T., et al. (2001) Translational control by the ER transmembrane kinase/ribonuclease IRE1 under ER stress. Nature Cell Biol. 3, 158164.[CrossRef][Medline]
Kaneda, S., Yura, T. & Yanagi, H. (2000) Production of three distinct mRNAs of 150 kDa oxygen-regulated protein (ORP150) by alternative promoters: preferential induction of one species under stress conditions. J. Biochem. (Tokyo)
128, 529538.
Kaufman, R.J., Scheuner, D., Schroder, M., et al. (2002) The unfolded protein response in nutrient sensing and differentiation. Nature Rev. Mol. Cell. Biol. 3, 411421.[CrossRef][Medline]
Kobayashi, T., Ogawa, S., Yura, T. & Yanagi, H. (2000) Abundant expression of 150-kDa oxygen-regulated protein in mouse pancreatic beta cells is correlated with insulin secretion. Biochem. Biophys. Res. Commun. 267, 831837.[CrossRef][Medline]
Lee, K., Tirasophon, W., Shen, X., et al. (2002) IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev. 16, 452466.
Leroux, L., Desbois, P., Lamotte, L., et al. (2001) Compensatory responses in mice carrying a null mutation for Ins1 or Ins2. Diabetes 50 (Suppl. 1), S150S153.
Liou, H.C., Boothby, M.R., Finn, P.W., et al. (1990) A new member of the leucine zipper class of proteins that binds to the HLA DR alpha promoter. Science
247, 15811584.
Masaki, T., Yoshida, M. & Noguchi, S. (1999) Targeted disruption of CRE-binding factor TREB5 gene leads to cellular necrosis in cardiac myocytes at the embryonic stage. Biochem. Biophys. Res. Commun. 261, 350356.[CrossRef][Medline]
Miyazaki, J., Araki, K., Yamato, E., et al. (1990) Establishment of a pancreatic beta cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology
127, 126132.
Mori, K. (2000) Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell 101, 451454.[CrossRef][Medline]
Mori, K., Kawahara, T., Yoshida, H., Yanagi, H. & Yura, T. (1996) Signalling from endoplasmic reticulum to nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway. Genes Cells 1, 803817.[Abstract]
Niwa, H., Yamamura, K. & Miyazaki, J. (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193199.[CrossRef][Medline]
Oda, Y., Hosokawa, N., Wada, I. & Nagata, K. (2003) EDEM as an acceptor of terminally misfolded glycoproteins released from calnexin. Science
299, 13941397.
Okamura, K., Kimata, Y., Higashio, H., Tsuru, A. & Kohno, K. (2000) Dissociation of Kar2p/BiP from an ER sensory molecule, Ire1p, triggers the unfolded protein response in yeast. Biochem. Biophys. Res. Commun. 279, 445450.[CrossRef][Medline]
Oyadomari, S., Koizumi, A., Takeda, K., et al. (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes. J. Clin. Invest. 109, 525532.[CrossRef][Medline]
Reimold, A.M., Etkin, A., Clauss, I., et al. (2000) An essential role in liver development for transcription factor XBP-1. Genes Dev.
14, 152157.
Reimold, A.M., Iwakoshi, N.N., Manis, J., et al. (2001) Plasma cell differentiation requires the transcription factor XBP-1. Nature 412, 300307.[CrossRef][Medline]
Ron, D. (2002a) Proteotoxicity in the endoplasmic reticulum: lessons from the Akita diabetic mouse. J. Clin. Invest. 109, 443445.[CrossRef][Medline]
Ron, D. (2002b) Translational control in the endoplasmic reticulum stress response. J. Clin. Invest. 110, 13831388.[CrossRef][Medline]
Schagger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368379.[CrossRef][Medline]
Shen, J., Chen, X., Hendershot, L. & Prywes, R. (2002) ER Stress Regulation of ATF6 Localization by Dissociation of BiP/GRP78 Binding and Unmasking of Golgi Localization Signals. Dev. Cell 3, 99111.
Shen, X., Ellis, R.E., Lee, K., et al. (2001) Complementary signaling pathways regulate the unfolded protein response and are required for C. elegans development. Cell 107, 893903.[CrossRef][Medline]
Sidrauski, C. & Walter, P. (1997) The transmembrane kinase Ire1p is a site-specific endonuclease that initiates mRNA splicing in the unfolded protein response. Cell 90, 10311039.[CrossRef][Medline]
Sommer, T. & Jarosch, E. (2002) BiP binding keeps ATF6 at bay. Dev. Cell 3, 12.[CrossRef][Medline]
Tsukamoto, Y., Kuwabara, K., Hirota, S., et al. (1998) Expression of the 150-kd oxygen-regulated protein in human breast cancer. Lab. Invest. 78, 699706.[Medline]
Urano, F., Bertolotti, A. & Ron, D. (2000) IRE1 and efferent signaling from the endoplasmic reticulum. J. Cell Sci. 113, 36973702.[Abstract]
Wang, Y., Shen, J., Arenzana, N., Tirasophon, W., Kaufman, R.J. & Prywes, R. (2000) Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response. J. Biol. Chem.
275, 2701327020.
Wang, J., Takeuchi, T., Tanaka, S., et al. (1999) A mutation in the insulin 2 gene induces diabetes with severe pancreatic beta-cell dysfunction in the Mody mouse. J. Clin. Invest. 103, 2737.[Medline]
Ye, J., Rawson, R.B., Komuro, R., et al. (2000) ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs. Mol. Cell 6, 13551364.[CrossRef][Medline]
Yoshida, H., Haze, K., Yanagi, H., Yura, T. & Mori, K. (1998) Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J. Biol. Chem. 273, 3374133749.
Yoshida, H., Matsui, T., Hosokawa, N., Kaufman, R.J., Nagata, K. & Mori, K. (2003) A time-dependent phase shift in the mammalian unfolded protein response. Dev. Cell. 4, 265271.[CrossRef][Medline]
Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. & Mori, K. (2001a) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881891.
Yoshida, H., Okada, T., Haze, K., et al. (2001b) Endoplasmic reticulum stress-induced formation of transcription factor complex ERSF including NF-Y (CBF) and activating transcription factors 6alpha and 6beta that activates the mammalian unfolded protein response. Mol. Cell. Biol.
21, 12391248.
Yoshida, H., Okada, T., Haze, K., et al. (2000) ATF6 activated by proteolysis binds in the presence of NF-Y (CBF) directly to the cis-acting element responsible for the mammalian unfolded protein response. Mol. Cell. Biol.
20, 67556767.
Yoshimura, T., Fujisawa, J. & Yoshida, M. (1990) Multiple cDNA clones encoding nuclear proteins that bind to the tax-dependent enhancer of HTLV-1: all contain a leucine zipper structure and basic amino acid domain. EMBO J. 9, 25372542.[Medline]
Yoshioka, M., Kayo, T., Ikeda, T. & Koizumi, A. (1997) A novel locus, Mody4, distal to D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita) mutant mice. Diabetes 46, 887894.[Abstract]
Received: 27 August 2003
Accepted: 23 December 2003
This article has been cited by other articles:
![]() |
M. T. Lindenmeyer, M. P. Rastaldi, M. Ikehata, M. A. Neusser, M. Kretzler, C. D. Cohen, and D. Schlondorff Proteinuria and Hyperglycemia Induce Endoplasmic Reticulum Stress J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2225 - 2236. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lu, Y. Yang, E. M. Allister, N. Wijesekara, and M. B. Wheeler The Identification of Potential Factors Associated with the Development of Type 2 Diabetes: A Quantitative Proteomics Approach Mol. Cell. Proteomics, August 1, 2008; 7(8): 1434 - 1451. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kitamura Endoplasmic reticulum stress and unfolded protein response in renal pathophysiology: Janus faces Am J Physiol Renal Physiol, August 1, 2008; 295(2): F323 - F334. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Edghill, S. E. Flanagan, A.-M. Patch, C. Boustred, A. Parrish, B. Shields, M. H. Shepherd, K. Hussain, R. R. Kapoor, M. Malecki, et al. Insulin Mutation Screening in 1,044 Patients With Diabetes: Mutations in the INS Gene Are a Common Cause of Neonatal Diabetes but a Rare Cause of Diabetes Diagnosed in Childhood or Adulthood Diabetes, April 1, 2008; 57(4): 1034 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Liu, I. Hodish, C. J. Rhodes, and P. Arvan Proinsulin maturation, misfolding, and proteotoxicity PNAS, October 2, 2007; 104(40): 15841 - 15846. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Davenport, H. E. Moore, A. S. Dunlop, S. Y. Sharp, P. Workman, G. J. Morgan, and F. E. Davies Heat shock protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells Blood, October 1, 2007; 110(7): 2641 - 2649. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Casas, R. Gomis, F. M. Gribble, J. Altirriba, S. Knuutila, and A. Novials Impairment of the Ubiquitin-Proteasome Pathway Is a Downstream Endoplasmic Reticulum Stress Response Induced by Extracellular Human Islet Amyloid Polypeptide and Contributes to Pancreatic {beta}-Cell Apoptosis Diabetes, September 1, 2007; 56(9): 2284 - 2294. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hsueh, E. D. Abel, J. L. Breslow, N. Maeda, R. C. Davis, E. A. Fisher, H. Dansky, D. A. McClain, R. McIndoe, M. K. Wassef, et al. Recipes for Creating Animal Models of Diabetic Cardiovascular Disease Circ. Res., May 25, 2007; 100(10): 1415 - 1427. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Orsi, L. Fioriti, R. Chiesa, and R. Sitia Conditions of Endoplasmic Reticulum Stress Favor the Accumulation of Cytosolic Prion Protein J. Biol. Chem., October 13, 2006; 281(41): 30431 - 30438. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ueda, J. Kawano, K. Takeda, T. Yujiri, K. Tanabe, T. Anno, M. Akiyama, J. Nozaki, T. Yoshinaga, A. Koizumi, et al. Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic {beta}-cells via transcriptional activation Eur. J. Endocrinol., July 1, 2005; 153(1): 167 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Marutani, A. Yamamoto, N. Nagai, H. Kubota, and K. Nagata Accumulation of type IV collagen in dilated ER leads to apoptosis in Hsp47-knockout mouse embryos via induction of CHOP J. Cell Sci., November 15, 2004; 117(24): 5913 - 5922. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |