| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Centre for Genetic Resource Information, National Institute of Genetics, and Department of Genetics, The Graduate University for Advanced Studies, Mishima, Shizuoka-ken 411-8540, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Caenorhabditis elegans is a well-characterized model organism that has a simple body plan and was the first multicellular organism whose entire genome sequence has been determined (The C. elegans Sequencing Consortium 1998). The C. elegans T-box family consists of 20 genes in total (Harris et al. 2003). Functional analyses of three T-box genes identified from mutants have been reported: mab-9 determines the fate of the male postembryonic blast cells B and F (Woollard & Hodgkin 2000); mls-1 specifies the fate of nonstriated muscle cells derived from the M blast cell at the larval stage (Kostas & Fire 2002); and sdf-13 is required for adaptation to odorants sensed by the AWC olfactory neurons (Miyahara et al. 2003). Functionally, these three T-box genes act postembryonically; therefore, functional analysis of the remaining C. elegans T-box genes is of great interest to elucidate to what extent genes of this family are implicated in embryonic development of this organism. Among the C. elegans T-box genes, a cDNA clone for tbx-9 was first isolated from the C. elegans EST project that was performed in our lab (NEXTDB web site, http://nematode.lab.nig.ac.jp/). The tbx-9 gene has a related T-box gene, tbx-8 (Agulnik et al. 1995). The high sequence similarity between the T-box domains and the tandem location of these genes on the chromosome imply that the tbx-9 and tbx-8 genes are generated by a recent gene duplication and may act in a related developmental pathways.
This study shows that the tbx-9 and tbx-8 genes are expressed in precursor cells of the hypodermis and body-wall muscle. Disruption of these genes caused defects in embryonic morphogenesis. Failure to form hypodermis and body-wall muscle was not only observed in these mutants, but it was remarkably enhanced in embryos in which both the genes were inactivated. These data indicate that T-box genes tbx-9 and tbx-8 play important roles in formation of these tissues in embryogenesis.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
The tbx-9 and tbx-8 are located in tandem on chromosome III in a head-to-head configuration (Fig. 1A). The tbx-9 transcript was determined by full sequence of a tbx-9 cDNA clone, yk97a6, and 5' RACE, revealing that the tbx-9 mRNA was 984 bases long with the SL1 trans-splice leader sequence. The largest open reading frame encoded a 292 amino acid sequence; a T-box domain occupied two-thirds near the N terminus of the sequence. Aside from the T-box domain, a putative nuclear localization signal and a highly acidic region were found next to the T-box domain and adjacent to the C terminus of the sequence, respectively. A full sequence of yk325e8, a tbx-8 cDNA clone, gave a 1103 base sequence including part of the SL1 trans-splice leader sequence at the 5' end. The largest open reading frame of 315 amino acid sequence indicated that locations of a T-box domain, a putative nuclear localization signal and a highly acidic region were comparable with those of tbx-9, and that 64% of amino acids in the two T-box domains were identical (Fig. 1B). Exon-intron boundaries were also conserved between these genes. Northern blot analysis of embryonic RNA for each of the genes detected a band consistent with the cDNA size (data not shown). These mRNA sequences corrected predictions of the tbx-9 and tbx-8 genes from genome sequence and reinforced the structural resemblance between them.
|
We utilized in situ hybridization on whole mount embryos to determine temporal and spatial distribution of the tbx-9 mRNA in embryogenesis. A hybridization signal was first detected in the nucleus of the E cell at the 8-cell stage (data not shown), indicating the onset of zygotic expression of tbx-9 in this cell. The E cell is the exclusive founder cell of the intestine. Expression in the E cell was retained in its daughter cells Ea and Ep until the 24-cell stage (Fig. 2A). It then became undetectable. At this stage, signals were detected in five more cells (Fig. 2D). For exact orientation, embryos were subjected to double staining by fluorescence in situ hybridization for the tbx-9 mRNA along with marker mRNAs. A maternal gene, pos-1, is required for specification of the P-lineage germ-line cells (Tabara et al. 1999); the pos-1 mRNA is detected in the P-lineage cells and their sister cells that occupy the posterior end of embryos (Fig. 2C). Marking the P4 and D cells in the 24-cell stage embryos by staining for the pos-1 mRNA suggested that, judging from their positions, two of the tbx-9 expressing cells were the Ca and Cp cells, which produce hypodermal cells and body-wall muscle cells (Fig. 2B). elt-1 encodes a GATA transcription factor required for hypodermal cell production and is expressed in hypodermal cells and their precursor cells (Page et al. 1997). Double staining by fluorescence in situ hybridization for tbx-9 and elt-1 revealed the remaining three tbx-9 expressing cells also expressed elt-1 (Fig. 2E,F), indicating that these cells were AB descendant cells destined for hypodermal cells. After this stage, signals were observed in a subset of cells at each stage up to the approximately 400-cell stage and became undetectable just before the onset of morphogenesis. Interestingly, the most intensive hybridization signals were found in four cells at the approximately 200-cell stage. These cells were arranged as two pairs of two cells near the center of embryos (Fig. 2G), a location usually occupied by MS descendant cells. The MS descendant cells in this region are characterized by the expression of hlh-1, which is the C. elegans ortholog of vertebrate MyoD and is typically expressed in body-wall muscle cells and their precursors (Krause et al. 1990). Expression of hlh-1 overlapped with that of tbx-9 (Fig. 2H,I), indicating that tbx-9 was expressed in MS descendant cells destined for body-wall muscle cells.
|
Expression of tbx-8 was also examined by in situ hybridization on whole mount embryos. The expression pattern of tbx-8 closely resembled that of tbx-9, but the expression intensity of tbx-8 was weaker than that of tbx-9 (Fig. 2N,O). Whereas tbx-9 signal was observed in the nucleus of the E cell at the 8-cell stage, no signal for tbx-8 was detected in this cell. This may result from low intensity of the tbx-8 signal in the E cell because the expression of tbx-8 was observed in the Ea and Ep cells. Differences in the expression patterns between tbx-8 and tbx-9 could not be found after this stage. Figure 2P shows the summary of expression patterns of tbx-9 and tbx-8 on a lineage chart.
Mutants for tbx-9 and tbx-8 exhibited incompletely penetrant morphogenetic defects in embryogenesis
We inspected mutants for tbx-9 and tbx-8 generated by targeted gene disruption. A tbx-9 deletion mutant was isolated by the transposon Tc1 insertion and excision procedure (Zwaal et al. 1993). First, we obtained three lines that had Tc1 inserted within or near tbx-9 (ms24, ms26 and ms29) by screening worms of a Tc1 high-hopper strain, and then isolated one line that had a deletion in tbx-9 ms31 (Fig. 1A). The ms31 allele was a deletion of 3.0 kb of the genomic region that extended from 2.1 kb upstream to the middle of the third exon of tbx-9, deleting two-thirds of the T-box domain. In situ hybridization on embryos homozygous for this allele revealed that no signal was detected with a probe for tbx-9 and that signals for tbx-8 were not affected. tbx-9(ms31) showed a recessive phenotype characterized by disorganization of body shape, though penetrance of the phenotype was low (Table 1). The observed degree of deformity varied between depression in part of the body (Fig. 3B,C, compared with Fig. 3A), disorganization of the posterior body (Fig. 3D), and severe disorganization of the whole body (Fig. 3E). The deformity was inferred to occur during embryogenesis because some embryos showed severe disorganization in their entire bodies (Fig. 3F). The phenotype was completely rescued by an integrant, msIs1, of a subclone plasmid containing the region from 3.0 kb upstream to 0.5 kb downstream of the tbx-9 gene (Fig. 1A). In addition, worms subjected to RNA interference (RNAi) for tbx-9 showed a phenotype that was indistinguishable from the tbx-9 mutant phenotype. Thus, we concluded that disruption of the tbx-9 gene caused the morphogenetic defects.
|
|
All embryos with both tbx-9 and tbx-8 inactivated showed severe morphogenetic defects over their entire bodies
The tbx-9 mutant and the tbx-8 mutant phenotypes are characterized by incomplete penetrant morphogenetic defects. Because the two genes resembled each other in expression pattern, some functions of these genes may be redundant for morphogenesis. Therefore, it would be interesting to study the phenotype of the double mutant. Because these two genes are located very closely on the chromosome, it is almost impossible to make a double mutant by crossing the two mutant strains. For that reason, we used RNAi to inactivate tbx-8 in mutant tbx-9(ms31), and tbx-9 in mutant tbx-8(ok656). All embryos of tbx-9(ms31) tbx-8(RNAi) showed deformity in their whole bodies (Table 1), resulting in either severely disorganized L1 arrest (Fig. 3K) or embryonic lethality (Fig. 3L). tbx-9(RNAi) tbx-8(ok656) yielded the same results. The severity of the double inactivation was more than the sum of each of the mutant phenotypes, suggesting functional redundancy between tbx-9 and tbx-8 in embryonic morphogenesis. To evaluate the effect of reduction of gene dosage, we scored worms in which one of the genes was inactivated by RNAi and the other was heterozygous (Table 1). Worms with one copy of either of the tbx-9 and tbx-8 genes showed slightly higher frequency of deformity than worms with two copies of the gene. Still, most of the worms grew normally.
Formation of hypodermis and body-wall muscle was affected in the tbx-9 and tbx-8 mutants
We found that tbx-9 and tbx-8 are typically expressed in the precursor cells of intestine, hypodermis and body-wall muscle. To know whether these tissues were affected in the mutants, we investigated their formation using differentiation markers. The AJM-1 protein, recognized by the MH27 antibody, is a member of the apical junction molecules which are present in hypodermal cells (Wood 1988; Mohler et al. 1998). In the lateral view of wildtype embryos of the 1.5-fold stage, an early stage of morphogenesis, fluorescence from the AJM-1::GFP fusion protein shows the outline of 10 lateral hypodermal cells (H0-to-H2, V1-to-V4, QV5, V6 and T) arranged in a row along the anteroposterior axis of their bodies (Fig. 4A). The QV5 cell divides into the lateral hypodermal cell V5 and the neural blast cell Q near the end of embryogenesis. The row of lateral hypodermal cells is maintained in later stages (Fig. 4B). Of 33 tbx-9 mutant embryos of the 1.5-fold stage, 19 showed reduction of GFP fluorescence in some of the hypodermal cells (Table 2): the affected cells were the QV5 cell in 12 embryos (Fig. 4C) and both the V3 and QV5 cells in 7 embryos (Fig. 4D). Faint residual fluorescence, however, revealed the presence of these cells at their normal positions. Observation of larva of this genotype suggested positional coincidence between these affected hypodermal cells and the depression in part of their bodies (Fig. 4E,F). The formation of hypodermal cells was also affected in the tbx-8 mutant. In this case, arrangement of lateral hypodermal cells was disturbed in 26 of 54 mutant embryos of the 1.5-fold stage when no deformity was observed in their bodies (Table 2). The disturbance was mainly categorized into two types. In 11 embryos, cells in the middle part of the row of lateral hypodermal cells were not in line, but constituted a mass of cells (Fig. 4G). In 15 other embryos, the V1 cell no longer touched the H2 cell, so the row of lateral hypodermal cells was discontinuous (Fig. 4H). In the remaining one embryo, discontinuity was between the V1 and V2 cells (data not shown). Observation of larva of this genotype that showed depression in the middle part of the bodies revealed that the part corresponding to the mass of cells rather bulged out and its posteriorly adjacent part was depressed (Fig. 4I,J). On the other hand, anterior depression corresponded to position of the H2 cell (data not shown). In all of 18 embryos of the 1.5-fold stage with both tbx-9 and tbx-8 inactivated, lateral hypodermal cells were heavily affected (Table 2) and clear identification of the remaining cells was hardly possible (Fig. 4K), even though no deformity was seen in the embryos. Heavy disturbance in hypodermal cells was also observed in hatched larva with their bodies severely disorganized (Fig. 4L,M). To examine whether nuclei of lateral hypodermal cells are correctly arranged in worms with both the genes inactivated, we utilized an extrachromosomal array containing the GFP gene induced by the elt-5 promoter. elt-5 encodes a GATA transcription factor required for differentiation of lateral hypodermal cells and is expressed strongly in lateral hypodermal cells and weakly in AB and MS lineage cells (Koh & Rothman 2001) (Fig. 4N,O). In worms subjected to RNAi for both tbx-9 and tbx-8, not all strong GFP signals from the array were in a line (Fig. 4P–R). Although one possibility to explain the result is ectopic GFP expression in other tissues, this is probably unlikely because the total number of strong GFP signals observed in the worms did not exceed 20 which is the normal number of lateral hypodermal cells. Therefore, this result suggested that the arrangement of nuclei of lateral hypodermal cells was also affected in worms with both tbx-9 and tbx-8 inactivated.
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
We also considered the possibility that the observed deformities are related to abnormal lateral hypodermal cells at the 1.5-fold stage in the tbx-9 and tbx-8 mutants. In tbx-9 mutant embryos, the AJM-1::GFP protein was reduced in the V3 and QV5 cells and the corresponding body parts were depressed at the later stage. On the other hand, a mass of lateral hypodermal cells observed in the tbx-8 mutant embryos corresponded to the bulged part of the bodies, and depression in the pharyngeal region seemed to correspond to the position of the H2 cell that showed detachment from the V1 cell. The deformity shown in Fig. 4E,I, however, was observed in the dorsal side of the bodies. Furthermore, some larvae of the tbx-9 and tbx-8 mutants with affected lateral hypodermal cells were morphogenetically normal (data not shown). These results suggest that it is unlikely that the defects in lateral hypodermal cells directly caused the deformity. Instead, this results rather implies correlation between defects in the lateral hypodermis and body-wall muscle: abnormality in one of the tissues affects formation of the other tissue. The TBX-9 protein, and possibly the TBX-8 protein, was present in all lateral hypodermal cells and their precursors, whereas the protein seemed to be in some body-wall muscle cells of MS and C descendants that contribute to anterior, mid-ventral, and posterior parts of the rows of muscle cells (Moerman & Fire 1997). Furthermore, in the course of C. elegans embryogenesis, formation of the hypodermis precedes that of body-wall muscle: muscle cells are first situated underneath the lateral hypodermal cells; subsequently, the muscle cells migrate either dorsally or ventrally to form rows by the 1.5-fold stage (Moerman & Fire 1997). If misarrangement of lateral hypodermal nuclei contributed to the defects in this tissue, it must occur at a fairly early stage of morphogenesis. Therefore, one possibility is that defects in lateral hypodermal cells of mutant embryos prevent muscle cells from migrating to their normal destinations. We expressed tbx-9 and tbx-8 in lateral hypodermal cells to test whether the activity of the genes in this tissue was sufficient to rescue the mutant phenotype. Induction of either tbx-9 or tbx-8 by the elt-5 promoter, however, did not rescue the severe disorganization phenotype of the double mutant embryos (Y. Andachi, unpublished observation). Based on these findings, we can not determine whether the activity of tbx-9 or tbx-8 is required exclusively in the organization of the hypodermal cells or in the organization of both of the hypodermal and muscle cells.
Several lines of evidence indicate a strong relationship between tbx-9 and tbx-8. First, these genes show similarities in the sequence of the T-box domains and in the location of some motifs and exon-intron boundaries. Second, transcription patterns of these genes are remarkably similar, suggesting the presence of a common mechanism regulating their expression, although the sequence flanked by 5' ends of the two genes was separable with regard to rescuing activity for each of their mutants. Third, double inactivation of these genes showed a far stronger phenotype than the sum of the phenotypes of their individual inactivation, suggesting that their functions in the formation of hypodermis and body-wall muscle are redundant. Nevertheless, tbx-9 and tbx-8 appeared to have their own functions, which differ from each other. Morphogenetic defects in tbx-9 mutant embryos and tbx-8 mutant embryos were observed in different parts of their bodies. Furthermore, the essence of the defects in lateral hypodermal cells was reduction of AJM-1::GFP in two of the cells in the tbx-9 mutant and disturbance of the arrangement of cells in the tbx-8 mutant. These observations suggest a fundamental difference in how these genes were involved in formation of lateral hypodermal cells. Because tbx-9 and tbx-8 encode members of the T-box family of transcription factors, these genes are active in transcriptional regulation of their target genes. Indeed, we found the TBX-9 protein to transactivate a reporter gene in a DNA binding sequence dependent manner, suggesting that tbx-9 encodes a sequence-specific transcription activator (Y. Andachi, unpublished observation). It is first necessary to identify target genes responsible for the phenotypes of the tbx-9 mutant, the tbx-8 mutant and their double inactivation. Thereafter, we will be able to clarify the individual functions of tbx-9 and tbx-8 as well as their redundant functions.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Other studies have described a general procedure for handling worms (Brenner 1974; Sulston & Hodgkin 1988). Cultivation temperature was 20 °C. Bristol strain N2 was used as standard wildtype strain. Mutant strains used were: MT3126[mut-2(r459) I; dpy-19(n1347) III] (Collins et al. 1989), MH1384[ajm-1::GFP(kuIs46) X] (Chen & Han 2001), CB164[dpy-17(e164) III] (Brenner 1974) and RB831[tbx-8(ok656) III]. Clones used were: pRF4 (Mello et al. 1991), pPD118.85, pPD121.83, pPD129.36 (A. Fire, J. Ahnn, G. Seydoux, and S. Xu; personal communication), T07C4 (accession no. Z29443), yk97a6 (accession no. D75158 and D72308 for EST sequences), yk325e8 (accession no. C43115 and C32173 for EST sequences), yk61h1 (accession no. D73675 and D71080 for EST sequences), yk61b10 (accession no. D73609 and D71024 for EST sequences), and yk523e12 (accession no. AV188423 and AV177099 for EST sequences).
DNA sequence analyses
Both strands of the cDNA clones yk97a6 and yk325e8 were sequenced on a 373 A DNA sequencer (Perkin Elmer) by the primer walking strategy using the Dye terminator DNA sequencing kit (Perkin Elmer). PolyA RNA was prepared from mixed stage population of wildtype strain as described (Sambrook & Russell 2001) and subjected to reverse transcription by M-MLV reverse transcriptase (RNaseH–). We performed 5' RACE for the tbx-9 mRNA as described (Frohman et al. 1988). DNA database accession numbers for the tbx-9 and tbx-8 sequences are AB019521 and AB121091, respectively.
Production of transformant lines
A 5.3-kb SacI-BglII fragment containing the tbx-9 gene and a 5.4-kb BglII-SalI fragment containing the tbx-8 gene from the cosmid T07C4 were cloned into SacI-BamHI sites and BamHI-SalI sites of pBluescript II KS+ (Stratagene), respectively. A 0.95-kb AseI fragment from pPD118.85 containing the GFP gene without a stop codon was inserted into the sole XhoI site of the above tbx-9 construct to produce a tbx-9::GFP fusion construct. Each of these plasmid DNAs at 5 µg/ml for the tbx-9 and tbx-8 constructs and 50 µg/ml for the tbx-9::GFP construct was mixed with DNA of the transformation marker plasmid pRF4 containing the rol-6Dgene at 100 µg/ml. Each was then injected into adult gonads of the wildtype strain to obtain transformants as described (Mello et al. 1991). The transformants succeeding extrachromosomal tandem arrays of the injected plasmid constructs were subjected to irradiation with 300 J/m2 of UV (Mitani 1995) using UV Stratalinker (Stratagene) to insert the arrays into the chromosome. Lines that generated only progeny of Rol phenotype were chosen as integrant lines, establishing msIs1[tbx-9 + rol-6D], msIs2[tbx-8 + rol-6D] and msIs3[tbx-9::GFP + rol-6D]. A fragment upstream of the elt-5 gene that covers from –3380 to +4 relative to the base A of the elt-5 ATG was amplified from genomic DNA by PCR and cloned into PstI-XbaI sites of pPD121.83 to produce a construct containing the GFP gene with nuclear localization signals induced by the elt-5 promoter. This plasmid DNA at 50 µg/ml was mixed with pRF4 DNA and injected as above to generate a line of an extrachromosomal tandem array.
Expression analyses
For Northern blot analysis, total RNA extracted from embryos was subjected to electrophoresis on a formaldehyde-agarose gel at 5 µg per lane, blotted on Hybond-N+ membrane (Amersham), and hybridized with 32P-labelled tbx-9 and tbx-8 probes as described by Sambrook & Russell (2001).
In situ hybridization was performed according to the method by Tabara et al. (1996). The cDNAs from clones yk97a6 and yk325e8 were amplified by PCR as template DNAs for tbx-9 and tbx-8 probe preparation. In this experiment, tbx-9 and tbx-8 probes were prepared from the entire coding sequences including the T-box domains that have high sequence similarity between them. In situ hybridization with a probe produced from a fragment 3' to the T-box domain of each of the genes was performed to prevent cross-hybridization with a probe of tbx-9 to transcripts of tbx-8, and vice versa. We confirmed the same expression pattern with this probe, but its signal intensity was reduced.
We labelled probes for the tbx-9 gene and marker genes with Digoxigenin-11-dUTP and Fluorescein-11-dUTP, respectively, for double staining by fluorescence in situ hybridization. As template DNA for marker genes, cDNA clones yk61h1, yk61b10, and yk523e12 corresponding to pos-1, elt-1, and hlh-1, respectively, were amplified by PCR. Fluorescence staining of embryos was performed using TSA-Direct (NEN) according to the manufacturer's instructions. After hybridization and washing steps, embryos were incubated with TNT (0.1 M Tris pH 7.5, 0.15 M NaCl and 0.05% Tween 20) three times for 5 min each at room temperature. All the following treatments were done at room temperature. After incubation in TNB (0.1 M Tris pH 7.5, 0.15 M NaCl and 0.5% Blocking Regents) for 30 min, the embryos were incubated in TNB containing the antidigoxigenin antibody conjugated with peroxidase for 2 h, followed by washing with TNT five times for 5 min each. Then, the embryos were subjected to the TSA reaction using Cy3-labelled Tyramide for 10 min. To inactivate the peroxidase, the embryos were treated with 1% H2O2 for 30 min. Marker gene staining was done using the antifluorescein antibody conjugated with peroxidase and Cy5-labelled Tyramide as above. The specimen was observed on a confocal laser-scanning microscope LSM510 (Carl Zeiss). The order of the stainings was reversed and the staining pattern was checked to confirm that the second staining was not caused by carry-over of peroxidase activity for the first staining, especially in the case that both staining patterns overlapped.
The integrant line msIs3[tbx-9::GFP] was back-crossed twice with the wildtype strain. After worms containing GFP constructs were anesthetized with 10 mM sodium azide, GFP fluorescence was observed on an LSM510.
For immunostaining, embryos were attached to slides and fixed by the same procedure as for in situ hybridization. The embryos were treated with acetone for 7 min at 4 °C. All subsequent treatments were done at room temperature. The embryos were incubated for 5 min each in the following mixtures: 50% acetone + 50% PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, and 1.5 mM KH2PO4), PBS, PBT (PBS with 0.1% Tween 20), PBT containing 2 mg/ml glycine, and PBT. After incubation in PBT containing 10% heat-inactivated goat serum for 30 min, the embryos were stained by the following reagents dissolved in PBT containing 0.1% bovine serum albumin: the 5-6 antibody or the ICB4 antibody (Miller & Shakes 1995) for 2 h, Cy3-labelled antimouse IgG antibody (The Jackson Laboratory) for 1 h. Washing with PBT four times for 5 min each time followed each staining. The specimen was observed on an LSM510.
Mutant analyses
A Tc1 insertion allele for tbx-9 was obtained by a procedure using a Tc1 insertion mutant bank, which was a modification of the method described by Zwaal et al. (1993). In brief, 192 pools, each comprising 100 worms of the MT3126 mutator strain, were cultivated to the next generation. Some F1 worms of each pool were stored frozen to construct a mutant bank. The remaining F1 worms of each pool were lysed to prepare genomic DNA. The genomic DNA was subjected to PCR with Tc1 primers and tbx-9 gene specific primers to identify a pool that included a Tc1 insertion mutant for the tbx-9 gene. Frozen worms of the positive pool were thawed and cultivated individually to obtain the Tc1 insertion mutant. In this fashion, we obtained a positive line containing tbx-9(ms24::Tc1). The tbx-9 gene specific primers used for the screening were TTCTCAGCTTTGCCCGTTTC as the first primer and CTTGAATCGACTTTCTCCAAC as the nested primer.
Isolation of the deletion mutant for tbx-9 was performed as described (Zwaal et al. 1993) except that the nested PCR step was omitted. The principle of the method is to measure the size of fragments amplified by PCR with primers flanking the Tc1 insertion site. When the Tc1 is excised precisely, the same size fragment as amplified from a wildtype genome was produced. In contrast, shorter fragments are produced when illegitimate excision accompanying deletion of neighborhood occurs. tbx-9 gene specific primers used for this screening were GTTATTTCGTTTTTATCGCAAC and ATATCAAAAGCGACCAGTTTG, with which a 4.0-kb fragment is amplified from a wildtype genome. One positive line showing a shorter PCR band was obtained by starting with worms that were homozygous for tbx-9(ms24::Tc1). However, it turned out that the line did not have a deletion within the gene, but had another Tc1 insertion tbx-9(ms26::Tc1) in addition to the original one. The positive signal in the PCR assay is probably the result of somatic excision mediated by the two Tc1 elements along with the region between the Tc1 elements. Screening worms of the double Tc1 insertion yielded a positive; surprisingly, it had one more Tc1 insertion tbx-9(ms29::Tc1) within the analyzed area, which apparently caused the pseudo-positive band. The orientation of Tc1 insertion of ms29 was opposite that of the other two insertions. Again starting with worms of the triple Tc1 insertion, a deletion allele tbx-9(ms30) was obtained at last. This deletion allele kept the Tc1 insertion ms29 and had no footprint of Tc1 excision (Plasterk 1991). Thus, this deletion probably occurred by homologous recombination of the two outer Tc1 insertions ms26 and ms29 using inverted repeat sequences located at the ends of Tc1 element. An allele tbx-9(ms31) that lost the Tc1 insertion by spontaneous excision was obtained from this line. PCR products containing the insertion or deletion boundaries were subjected to direct DNA sequencing to characterize the alleles. The line containing the tbx-9(ms31) was back-crossed 10 times with the wildtype strain before phenotype analysis.
The tbx-8 deletion allele, tbx-8(ok656), was generated by the International C. elegans Gene Knockout Consortium using the trimethylpsoralen treatment and UV irradiation procedure (Edgley et al. 2002). The line containing tbx-8(ok656) was also back-crossed 10 times with the wildtype strain before phenotype analysis.
Integrant alleles msIs1[tbx-9] and msIs2[tbx-8] were introduced into tbx-9(ms31) and tbx-8(ok656) mutants by crossing, respectively, to perform rescue experiments of the mutants.
To assess the phenotypes observed in the tbx-9 mutant and the tbx-8 mutant, hermaphrodites were allowed to lay eggs for 24 h at 20 °C; parents were subsequently transferred to new plates daily. All progeny were scored by counting unhatched embryos and larvae 24 h after the parents were removed from a plate. The strain containing dpy-17 was back-crossed twice with the wildtype strain before using for experiments.
RNA interference (RNAi) analyses
RNAi was performed essentially as described (Fire et al. 1998). As template DNA for preparation of double-strand RNA, the whole tbx-9 and tbx-8 cDNAs were amplified by PCR from cDNA clones yk97a6 and yk325e8, respectively. Sense strand RNA and antisense strand RNA are separately synthesized by T3 RNA polymerase and T7 RNA polymerase, respectively. We omitted DNase treatment and purification by electrophoresis on agarose gel. Double strand RNA prepared from both strand RNAs was injected into body cavities of adult worms at 2–3 mg/ml. After a 24 h purge period of already fertilized eggs, F1 progeny laid from the injected worms were analyzed.
In immunostaining experiments, the bacterial-mediated RNAi strategy was adopted to obtain tbx-9(ms31) tbx-8(RNAi) embryos. The tbx-8 cDNA from yk325e8 was cloned into pPD129.36 and used for transformation of Escherichia coli HT115(DE3). tbx-9(ms31) worms were subjected to RNAi for tbx-8 according to the method by Timmons et al. (2001).
|
Acknowledgements |
|---|
|
Footnotes |
|---|
* Correspondence: E-mail: yandachi{at}lab.nig.ac.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Adell, T., Grebenjuk, V.A., Wiens, M. & Muller, W.E. (2003) Isolation and characterization of two T-box genes from sponges, the phylogenetically oldest metazoan taxon. Dev. Genes Evol. 213, 421–434.[CrossRef][Medline]
Agarwal, P., Wylie, J.N., Galceran, J., et al. (2003) Tbx5 is essential for forelimb bud initiation following patterning of the limb field in the mouse embryo. Development
130, 623–633.
Agulnik, S.I., Bollag, R.J. & Silver, L.M. (1995) Conservation of the T-box gene family from Mus musculus to Caenorhabditis elegans. Genomics 25, 214–219.[CrossRef][Medline]
Agulnik, S.I., Garvey, N., Hancock, S., et al. (1996) Evolution of mouse T-box genes by tandem duplication and cluster dispersion. Genetics 144, 249–254.[Abstract]
Amacher, S.L., Draper, B.W., Summers, B.R. & Kimmel, C.B. (2002) The zebrafish T-box genes no tail and spadetail are required for development of trunk and tail mesoderm and medial floor plate. Development 129, 3311–3323.
Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics
77, 71–94.
Chen, Z. & Han, M. (2001) Role of C. elegans lin-40 MTA in vulval fate specification and morphogenesis. Development
128, 4911–4921.
Collins, J., Forbes, E. & Anderson, P. (1989) The Tc3 family of transposable genetic elements in Caenorhabditis elegans. Genetics
121, 47–55.
Dehal, P., Satou, Y., Campbell, R.K., et al. (2002) The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science
298, 2157–2167.
Edgley, M., D’Souza, A., Moulder, G., et al. (2002) Improved detection of small deletions in complex pools of DNA. Nucleic Acids Res.
30, e52.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. & Mello, C.C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806–811.[CrossRef][Medline]
Frohman, M.A., Dush, M.K. & Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA
85, 8998–9002.
Goering, L.M., Hoshijima, K., Hug, B., Bisgrove, B., Kispert, A. & Grunwald, D.J. (2003) An interacting network of T-box genes directs gene expression and fate in the zebrafish mesoderm. Proc. Natl. Acad. Sci. USA
100, 9410–9415.
Harris, T.W., Lee, R., Schwarz, E., et al. (2003) WormBase: a cross-species database for comparative genomics. Nucleic Acids Res.
31, 133–137.
Herrmann, B.G., Labeit, S., Poustka, A., King, T.R. & Lehrach, H. (1990) Cloning of the T gene required in mesoderm formation in the mouse. Nature 343, 617–622.[CrossRef][Medline]
Koh, K. & Rothman, J.H. (2001) ELT-5 and ELT-6 are required continuously to regulate epidermal seam cell differentiation and cell fusion in C. elegans. Development
128, 2867–2880.
Kostas, S.A. & Fire, A. (2002) The T-box factor MLS-1 acts as a molecular switch during specification of nonstriated muscle in C. elegans. Genes Dev.
16, 257–269.
Krause, M., Fire, A., Harrison, S.W., Priess, J. & Weintraub, H. (1990) CeMyoD accumulation defines the body wall muscle cell fate during C. elegans embryogenesis. Cell 63, 907–919.[CrossRef][Medline]
Mello, C.C., Kramer, J.M., Stinchcomb, D. & Ambros, V. (1991) Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10, 3959–3970.
Miller, D.M. & Shakes, D.C. (1995) Immunofluorescence microscopy. In: Caenorhabditis elegans, Modern Biological Analysis of an Organism (eds H.F. Epstein & D.C. Shakes), pp. 365–394. San Diego, CA: Academic Press, Inc.
Mitani, S. (1995) Genetic regulation of mec-3 gene expression implicated in the specification of the mechanosensory neuron cell types in Caenorhabditis elegans. Dev. Growth Diff. 37, 551–557.[CrossRef]
Miyahara, K., Suzuki, N., Ishihara, T., Tsuchiya, E. & Katsura, I. (2003) TBX2/TBX3 transcriptional factor homolog controls olfactory adaptation in Caenorhabditis elegans. J. Neurobiol. 58, 392–402.
Moerman, D.G. & Fire, A. (1997) Muscle: structure, function, and development. In: C. elegans II (eds D.L. Riddle, T. Blumenthal, B.J. Meyer, et al.), pp. 417–470. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Moerman, D.G., Hutter, H., Mullen, G.P. & Schnabel, R. (1996) Cell autonomous expression of perlecan and plasticity of cell shape in embryonic muscle of Caenorhabditis elegans. Dev. Biol. 173, 228–242.[CrossRef][Medline]
Mohler, W.A., Simske, J.S., Williams-Masson, E.M., Hardin, J.D. & White, J.G. (1998) Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis. Curr. Biol. 8, 1087–1090.[CrossRef][Medline]
Naiche, L.A. & Papaioannou, V.E. (2003) Loss of Tbx4 blocks hindlimb development and affects vascularization and fusion of the allantois. Development
130, 2681–2693.
Page, B.D., Zhang, W., Steward, K., Blumenthal, T. & Priess, J.R. (1997) ELT-1, a GATA-like transcription factor, is required for epidermal cell fates in Caenorhabditis elegans embryos. Genes Dev.
11, 1651–1661.
Plasterk, R.H. (1991) The origin of footprints of the Tc1 transposon of Caenorhabditis elegans. EMBO J. 10, 1919–1925.[Medline]
Rallis, C., Bruneau, B.G., Del Buono, J., et al. (2003) Tbx5 is required for forelimb bud formation and continued outgrowth. Development
130, 2741–2751.
Sambrook, J. & Russell, D.W. (2001) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sulston, J. & Hodgkin, J. (1988) Methods. In: The Nematode Caenorhabditis elegans (ed W.B. Wood), pp. 587–606. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Tabara, H., Hill, R.J., Mello, C.C., Priess, J.R. & Kohara, Y. (1999) pos-1 encodes a cytoplasmic zinc-finger protein essential for germline specification in C. elegans. Development 126, 1–11.[Abstract]
Tabara, H., Motohashi, T. & Kohara, Y. (1996) A multi-well version of in situ hybridization on whole mount embryos of Caenorhabditis elegans. Nucleic Acids Res.
24, 2119–2124.
The C. elegans Sequencing Consortium (1998) Genome sequence of the nematode C. elegans: a platform for investigating biology. Science
282, 2012–2018.
Timmons, L., Court, D.L. & Fire, A. (2001) Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103–112.[CrossRef][Medline]
Waterston, R.H., Lindblad-Toh, K., Birney, E., et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520–562.[CrossRef][Medline]
Wilson, V. & Conlon, F.L. (2002) The T-box family. Genome Biol. 3, reviews 3008.1–3008.7.[Medline]
Wood, W.B. (1988) Embryology. In: The Nematode Caenorhabditis elegans (ed W.B. Wood), pp. 215–241. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Woollard, A. & Hodgkin, J. (2000) The Caenorhabditis elegans fate-determining gene mab-9 encodes a T-box protein required to pattern the posterior hindgut. Genes Dev.
14, 596–603.
Zwaal, R.R., Broeks, A., van Meurs, J., Groenen, J.T. & Plasterk, R.H. (1993) Target-selected gene inactivation in Caenorhabditis elegans using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA
90, 7431–7435.
Received: 7 October 2003
Accepted: 22 January 2004
This article has been cited by other articles:
|
|
 |
|
  L. R. Baugh, A. A. Hill, J. M. Claggett, K. Hill-Harfe, J. C. Wen, D. K. Slonim, E. L. Brown, and C. P. Hunter The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo Development, April 15, 2005; 132(8): 1843 - 1854. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
