GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Genes to Cells (2004) 9, 471-477. doi:10.1111/j.1356-9597.2004.00736.x
© 2004 Blackwell Publishing or its licensors
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, K.
Right arrow Articles by Niwa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, K.
Right arrow Articles by Niwa, H.

A novel mechanism for regulating clonal propagation of mouse ES cells

Kazuya Ogawa, Hisanori Matsui, Satoshi Ohtsuka and Hitoshi Niwa*

Laboratory for Pluripotent Cell Studies, RIKEN Center for Developmental Biology, Minatojima-Minamimachi 2-2-3, Chuo-ku, Kobe 650-0047, Japan


   Abstract
Top
 Abstract
Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Self-renewal and differentiation of embryonic stem (ES) cells are controlled by the combinatorial action of extracellular signals and regulation of gene expression. For characterizing the entire molecular mechanism governing these events, we first established a feeder- and serum-free culture system in which mouse ES cells could propagate in clonal density in keeping with proper pluripotency. Supplementation of peptide hormones such as adrenocorticotropic hormone (ACTH) is required to remove serum, and the key event in this phenomenon may be the inhibition of the adenylyl cyclase (AC) activity, as it replaces the effect of these peptides. Because ES cells themselves produce the same activity, the finding suggests a novel mechanism in which activation of AC restricts clonal propagation of pluripotent stem cells.


   Introduction
Top
 Abstract
 Introduction
Results
 Discussion
 Experimental procedures
 References
 
At present, mouse ES cells can propagate in medium containing fetal calf serum (FCS) and cytokine leukaemia inhibitory factor (LIF) on a feeder cell layer (Niwa 2001). In this condition, ES cells autonomously proliferate as self-renewal. The phenomenon of self-renewal of ES cells implies ‘suppression of differentiation’ and ‘proliferation.’ The effect of LIF is mediated through a cell surface complex composed of LIFRß and gp130 and subsequent activation of STAT3 that is essential and sufficient for suppression of differentiation (Smith et al. 1988; Niwa et al. 1998; Matsuda et al. 1999). However, LIF does not seem to affect the proliferation of ES cells (Raz et al. 1999; Viswanathan et al. 2002). Therefore, environmental factors regulating proliferation of ES cells are still unknown as proliferation is dependent on unidentified factors from feeders or serum. Moreover, monkey and human ES cells also cultured on feeder cell layer, but LIF cannot suppress their differentiation (Thomson et al. 1998; Suemori et al. 2001). Thus, the common signal systems conserved in evolution for regulating suppression of differentiation for ES cells still remain unclear. To analyse the molecular mechanism behind self-renewal of ES cells, we attempted to establish a completely defined culture condition without FCS and the feeders for mouse ES cells.


   Results
Top
 Abstract
 Introduction
 Results
Discussion
 Experimental procedures
 References
 
ACTH, PACAP and BNP promote clonal propagation of ES cells in KSR medium

In medium containing a chemically defined supplement called knockout serum replacement (KSR, Invitrogen) instead of FCS, the feeder-free adapted EB3 ES cells still continued to grow in a gelatin-coated dish in high-density culture (> 1000 cells/cm2) in the presence of LIF. Although it has already been confirmed that ES cells can keep their pluripotency for chimera production and germ-line transmission under such conditions (Ward et al. 2002), stem cell colonies never formed from single cells in the low-density culture (< 100 cells/cm2) in KSR medium (Fig. 1D,H,I). Interestingly, when a small amount (0.3%) of the final volume of FCS was added to a low-density culture, clonal propagation of the ES cells started again, indicating a soluble substance that promotes their growth is contained in FCS but not in KSR (Fig. 1B,H,I). Although the activity in FCS may prolong the survival of the ES cells or increase their ability to proliferate, it does not enhance attachment of the cells to the matrix because they became attached to the bottom of the culture dish to the same extent in KSR medium with or without FCS in low-density culture 1 day after seeding (data not shown).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 1  Comparison of the growth performance of ES cells in low-density culture in the KSR medium supplemented with ACTH (1–24) and various culture mediums. EB3 colonies were grown for 7 days in 10% FCS-containing medium (A, E) or in KSR medium containing 0.3% FCS (B, F) or in the KSR medium supplemented with 10 µM ACTH (C, G) or in the KSR medium (D). AP-staining views were shown in E–G. The relative forming colony number of ES cells present on day 7 cultured in FCS-containing medium (F) or in KSR medium containing either 0.3% FCS (KF), 0.1 µM ACTH (1–24) (KA0.1), 1 µM ACTH (1–24) (KA1), 10 µM ACTH (1–24) (KA10), 100 µM ACTH (KA100) or in the KSR medium only (K), compared with that in FCS-containing medium as 100% (H). Error bars represent the mean ± SEM (n = 3). The relative cell number of ES cells present on days 1, 3, 5 and 7 of culture compared with that at day 0, in FCS-containing medium (F), or in KSR medium containing either 0.3% FCS (KF), with 10 µM ACTH (1–24) (KA10), 1 µM ACTH (1–24) (KA1), or in the KSR medium only (K, I). Error bars represent the mean ± SEM (n = 3).

 
To allow the clonal propagation of ES cells in the KSR medium, we screened known peptide growth factors and small peptides for missing activity in KSR medium, and found that adrenocorticotropic hormone (ACTH) (1–24), pituitary adenylate cyclase-activating polypeptide (PACAP) (1–27) and brain natriuretic peptide (BNP) (1–32) possess such activity at the final concentration of 1 µM, while many other small peptides including atrial natriuretic peptide (ANP), galanin and vasoactive intestinal polypeptide (VIP), which are known to stimulate cellular proliferation in pre-implantation embryos, do not (Gressens et al. 1993; Tarasov et al. 2002). Although ES cells do not grow as well in KSR medium supplemented with ACTH (1–24) as they do in medium containing 10% FCS, the addition of 10 µM ACTH resulted in the formation of stem cell colonies comparable in size and number to that grown in KSR medium containing 0.3% FCS (Fig. 1A–D,H,I). OKO160 ES cells also can grow in KSR medium containing ACTH (1–24) (data not shown), and therefore this medium can provide a general feeder- and serum-free culture system for clonal propagation of mouse ES cells.

ACTH-containing medium sustains pluripotency of ES cells

To investigate whether KSR medium containing ACTH, designated as KA medium, can maintain proper cellular pluripotency, ES cells were clonally expanded in it, followed by serial passage for at least 1 month. As shown in Fig. 1(G), the ES cells formed compact colonies without alkaline phosphatase (AP)-negative differentiated cells, as they do when grown in KSR medium supplemented with 0.3% FCS (KF medium; Fig. 1F). In contrast, in the conventional medium containing 10% FCS (F medium), ES cells formed flat colonies containing many AP-negative cells (Fig. 1E). The stem cell marker genes, Oct3/4, Rex1/Zfp42 and Sox2, as well as the two differentiation marker genes, H19 and tissue plasminogen activator (tPA), were assayed by Northern blotting hybridization or RT-PCR (Niwa et al. 2000; Fujikura et al. 2002; Niwa et al. 2002). As expected from their morphology, all stem cell marker genes were strongly expressed, but the level of expression indicated that there were fewer differentiated cells in KA medium than in F medium (Fig. 2A). In contrast, the expression of differentiation marker genes in the ES cells cultured in the KA medium was much weaker than that in F medium (Fig. 2B), confirming the very few differentiation events in KA medium. To confirm the pluripotency of these cells, they were injected into blastocysts from C57BL/6 strain, which have a black coat, to generate chimeric mice. EB3 ES cells were derived from the 129/Ola strain and carry the agouti–chinchilla phenotype for the coat colour. Judging by the coat colour, these cells produced chimeric mice as efficiently as ES cells cultured in KF medium (Fig. 2C,D), and germ-line transmission was observed in most of them (data not shown). These results indicate that ACTH can maintain adequate pluripotency of ES cells. In addition, we could deviate ES cells from the C57BL/6 blastocysts efficiently using this culture condition (S. Ohtsuka & H. Niwa, unpublished data).



View larger version (46K):
[in this window]
[in a new window]
  		Figure 2  Maintenance of the undifferentiated state of ES cells cultured in the KSR medium with ACTH. (A) Northern-blot analysis of EB3 ES cells clonally expanded and maintained for at least 1 month in FCS-containing medium (F), and in KSR medium containing 0.3% FCS (KF), or 1 µM ACTH (KA). (B) Expression of differentiated cell marker genes in ES cells analysed by RT-PCR. Gapdh was used as loading control. (C) Chimeric mice derived from EB3 cells cultured with ACTH. (D) The efficiency of chimeric mice production with ES cells maintained in KSR medium supplemented with ACTH and supplemented with 0.3% FCS.

 
Activity of ACTH for ES cell propagation is separable from its conventional activity

RT-PCR analysis revealed that the feeder-free ES cells expressed Melanocortin 5 receptor (MC5R) but not other types of Melanocortin receptors (MCRs) at a detectable level (data not shown). MC5R encodes the low-affinity receptor for ACTH (Schiöth et al. 1997; Hoogduijn et al. 2002). Affinity for various ACTH fragments is as follows: {alpha}-melanocortin stimulating hormone (MSH) > ACTH (1–24) > ACTH (4–10) > ACTH (1–39). Binding of nanomolar levels of any of these ligands with MC5R stimulates cAMP and Ca2+ responses. However, ACTH (1–24) promoted proliferation of ES cells in a dose-dependent manner, with a threshold concentration of 0.1 µM and a saturating concentration of 10 µM (Fig. 3A). In addition, the effects of PACAP and BNP also showed dose dependency, although the saturating concentration reached about 50 µM (data not shown). To determine the stretch of amino acids in ACTH that is responsible for the activity on ES cells, we examined various ACTH derivatives at a concentration of 10 µM (Fig. 3B). Interestingly, ACTH (1–24) was the most potent, and ACTH (1–39) and (11–24) possessed moderate activity. In contrast, ACTH (4–10) and (18–39) showed only faint activity, and the ACTH-derived peptide {alpha}-MSH, whose amino acid sequence corresponds to that of ACTH (1–16) and has the highest affinity for MC5R, had no detectable activity. These data suggest that the activity of ACTH for ES cell propagation can be distinguished from its previously characterized hormonal activity.



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3  Quantitative and qualitative analyses of ACTH on ES cell proliferation. (A) The relative cell number of ES cells cultured in KSR medium supplemented with ACTH (1–24) at various concentrations for 7 days, compared with that at day 0. Error bars represent the mean ± SEM (n = 3). *P < 0.05, **P < 0.01 (vs. absence of ACTH). (B) The relative cell number of ES cells cultured in KSR medium supplemented with various fragment types of ACTH at 10 µM for 7 days, compared with that at day 0. Error bars represent the mean ± SEM (n = 3). *P < 0.05 [vs. ACTH (1–24)].

 
Inhibition of adenylyl cyclase activation promotes clonal propagation of ES cells

To clarify whether ACTH promotes the propagation of ES cells via the classical signalling pathway involved in mediating the ACTH activity, we examined the effect of modulators on this cascade. The conventional ACTH activity is integrated into cells via MCRs by the stimulatory G-protein pathway activating the classical adenylyl cyclase (AC)-cAMP-cAMP dependent protein kinase (PKA) signalling cascade (Dhanasekaran et al. 1998; Adan & Gispen 2000; Neves et al. 2002). However, when we tested the role of the AC activity in our culture system, the AC inhibitors SQ 22 536 and 2',5'-dideoxyadenosine (DDA) enhanced the proliferative effect of ACTH, but the AC activator forskolin (FSK), the PKA activator Sp-cAMPs, the PKA inhibitors Rp-cAMPs and H-89 did not (Fig. 4A). Moreover, DDA or SQ 22 536 alone showed the ACTH-like activity in KSR medium (Fig. 4B). We confirmed that the KSR medium supplemented with DDA can maintain pluripotency of ES cells, the same as KSR medium supplemented with ACTH, by stem cell marker genes expression and chimeric mice analyses (data not shown). To understand the relationship between ES cell propagation and cAMP production, we next measured intracellular cAMP in ES cells cultured in KSR medium containing ACTH or modulators. Although we could not detect any change of cAMP level in ES cells cultured in the KA medium, FSK caused accumulation of cAMP at a 2.5-fold increase but could not promote ES cell propagation (Fig. 4C). In addition, FSK-induced cAMP accumulation was slightly inhibited by DDA, but FSK could not significantly affect DDA-induced ES cell propagation (Fig. 4B,C). Therefore, cAMP–PKA pathway or PKA might not be involved in the signal transduction system stimulated by ACTH for regulating ES cell propagation. These results indicate that ACTH promote propagation of ES cells via a different cascade from the classical ACTH signalling pathway.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 4  Dissection of ACTH signalling in the regulation of ES cell proliferation. (A) Effect of the modulators of general ACTH signalling on ES cell proliferation. ES cells were clonally expanded and maintained for 7 days in KSR medium supplemented with 10 µM ACTH and either 100 µM FSK, 100 µM SQ22 536 (SQ), 500 µM DDA, 50 µM Sp-cAMPs, 100 µM Rp-cAMPs or 10 µM H89. The relative cell number of ES cells present on day 7 cultured in medium containing each modulator, compared with that in medium containing no modulators as 100%. Error bars represent the mean ± SEM (n = 3). *P < 0.05, **P < 0.01 (vs. ACTH only). (B) Effect of the AC inhibitor on ES cell proliferation. The relative cell number of ES cells on day 7 in KSR medium supplemented with either 100 µM FSK, 100 µM SQ or 500 µM DDA, compared with that on day 0. *P < 0.05, **P < 0.01 (vs. control). (C) Effect of 10 µM ACTH, 100 µM FSK and 500 µM DDA on cAMP accumulation in ES cells. The relative 10 µM ACTH-, 100 µM FSK- and 500 µM DDA induced cAMP accumulation in ES cells, compared with that induced by KSR medium as 100% (150 fmol/well). Error bars represent the mean ± SEM (n = 3). **P < 0.01 (vs. control).

 

   Discussion
Top
 Abstract
 Introduction
 Results
 Discussion
Experimental procedures
 References
 
Since establishment of mouse ES cell lines in 1981 (Evans & Kaufman 1981), they have been maintained in the conventional culture condition with FCS and feeder cells. Although discovery of the cytokine LIF allowed removal of the feeder cells from the culture (Smith et al. 1988), and the synthetic cocktail KSR can replace FCS in the presence of feeder cells (Goldsborough et al. 1998), a simple combination of these methods is not sufficient to maintain clonal propagation of ES cells in the culture condition without FCS and feeder cells that are chemically defined. Now we find a novel requirement of ES cells to the signal integrated by a particular kind of peptide hormones such as ACTH for self-renewal in the medium containing LIF and KSR.

We observed that ACTH, PACAP and BNP possess the ability to replace FCS in combination with KSR. However, the mode of action of these hormones to ES cells is in striking contrast to previous findings concerning the function of ACTH, PACAP and BNP as growth stimulators for a variety of cell types. For example, ACTH induces proliferation of not only adrenocortical cells in vivo and in vitro but also human oral keratinocytes, and {alpha}-MSH stimulates B-cell proliferation with an ED50 of 0.6–40 nM (Girolomoni et al. 1993; Buggy 1998; Lotfi et al. 2000). PACAP is known as a mitogen for mouse primordial germ cells, but ED50 for this effect is 15–17 nM, and this activity can be substituted by the AC stimulator FSK, indicating that the mitogenic signals are mediated by the canonical AC–cAMP–PKA pathway (Pesce et al. 1996). As (i) only extremely high concentrations of ACTH and PACAP act as growth stimulators of ES cells, (ii) BNP possesses the same activity although it normally activates the guanylyl cyclase–cGMP pathway (Silberbach & Roberts 2001) and (iii) the activity for ES cells might be mediated by inhibition of AC, we suppose that the activity of these peptides might be integrated via a weak cross interaction with an unknown, non-physiological receptor (Fig. 5). Indeed, enzyme-linked immunosorbent assay revealed that the level of the immunoactive ACTH peptide in the FCS that we used in our experiments is below the detectable level (less than 4.54 nM), indicating that ACTH is not a responsive factor to support clonal growth of ES cells in FCS. Although we cannot clearly explain the association between the strong effects of the AC inhibitors and the negligible effects of the AC and the PKA modulators, and we also failed to confirm whether ACTH and AC are included in the same signalling system or not, our data may suggest the presence of an unusual, novel signalling cascade in ES cells. To clarify whether ACTH, PAKAP and BNP really promote ES clonal propagation via inhibitory G-protein coupled receptor, and to understand the entire extracellular signalling for ES self-renewal, we will need to identify physiological components of this hypothetical signal cascade, including a peptide ligand and a G-protein coupled receptor.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 5  The hypothesized ACTH signalling for ES cell propagation involved in regulating the ES cells survival and/or proliferation. ACTH may be integrated via a weak cross interaction with an unknown, non-physiological inhibitory G-protein coupled receptor (SAFR). The signal system other than cAMP-PKA pathway or PKA may play an important role in ES cells propagation.

 
Our system revealed that mouse ES cells require very few extrinsic factors for their self-renewal as found previously for neural stem cells. The only soluble growth factors that they require are insulin and transferrin, which are the components of KSR, LIF and ACTH. We have not confirmed whether insulin or transferrin is essential, but LIF and ACTH are necessary for ES self-renewal. Co-operative, non-redundant function of ACTH with LIF distinguishes its activity from ES self-renewal factor (ESRF), the previously reported activity that can replace LIF for a short period in the presence of serum (Dani et al. 1998). What's the physiological role of the activity of these peptides to ES cells? Interestingly, a small amount (10%) of the final volume of the conditioned KSR medium in which ES cells were cultured at high density showed the same activity as found in 0.3% FCS or 1 µM ACTH for clonal propagation of ES cells (data not shown). Therefore, we hypothesized that a factor possessing the ACTH-like activity is secreted by ES cell themselves, which we designated ‘stem-cell autocrine factor’ (SAF) (Fig. 5). SAF may be physiologically involved in communication among pluripotent stem cells, helping them to avoid ectopic, clonal propagation in vivo, and allowing formation of teratoma. Indeed, the SAF-like activity could be detected in KSR medium conditioned by mouse EC cells, but not in medium conditioned by any differentiated cell we tested (data not shown). In 1981, Martin reported the establishment of a mouse ES cell line using EC cell-conditioned medium (Martin 1981). We now suppose that the SAF-like activity involves this succession, which promotes clonal propagation of pluripotent cells. Identification of peptides that mimic SAF may help to solve the mystery of cellular pluripotency. Moreover, it will provide a safe condition for human ES cell cultures used for cell therapy because it does not involve xenoproteins and xenosupports and so carries relatively little risk of pathogenic contamination.


   Experimental procedures
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
References
 
Cell culture

ES cells were maintained on feeder-free gelatin-coated plates in FCS-containing medium: Glasgow minimal essential medium (GMEM, Sigma) supplemented with 10% FCS (selected batches, Equitech-bio), 100 µM 2-mercaptoethanol (Nacalai tesuque), 1 x non-essential amino acids (Invitrogen), 1 mM of sodium pyruvate (Invitrogen), and 1000 units/mL LIF (ESGRO, Invitrogen). EB3 ES cells were generated by introducing Oct3/4 knockout vector carrying IRESBSDpA into E14TG2a ES cells via homologous recombination (Hooper et al. 1987; Niwa et al. 2002). OKO160 ES cells were generated by introduction of Oct3/4 knockout vector carrying IRESßgeo cassette into CGR8 ES cells (Mountford et al. 1994; Nichols et al. 1998). EB3 and OKO160 ES cells were cultured in the presence of either 5 µg/mL blasticidin S (Kaken Pharmaceutical) and 150 µg/mL G418 (Geneticin, Invitrogen) for stem cell selection, respectively. For all clonal proliferation assays, single-cell suspensions were prepared using trypsin–EDTA solutions and gently suspended and seeded at 200 cells/well in 12-well plates, and cultured in KSR medium supplemented with each peptide or each modulator or both, but no blasticidin S or G418. KSR medium was obtained by substituting the FCS in the FCS-containing medium by knockout serum replacement (KSR, Invitrogen). The number of colonies and cells in the colonies was counted 7 days after seeding. Peptide was screened using BAP96S (Assayscript). ACTH (1–24), (4–10), (18–39) and (1–39), PACAP (1–27) and BNP (1–32) were purchased from American Peptide Company, ACTH (11–24) was purchased from Biogenesis. Forskolin, SQ 22,536, 2',5'-dideoxyadenosine, Sp-cAMPs, Rp-cAMPs and H-89 were purchased from Sigma.

Stem cell assay and generation of chimeric mice

Alkaline phosphatase staining was carried out using BCIP/NBT solution (Sigma). For Northern blots, we analysed aliquots (4 µg) of total RNA by non-radioactive filter hybridization (Gene Image, Amersham Biosciences). For RT-PCR analyses, we carried out oligo-dT primed reverse transcription on aliquots (1 µg) of total RNA and used 1/20th of the single-strand cDNA products for each PCR amplifications. The gene-specific primers were: sense primer for H19 CAAGGTGAAGCTGAAAGAACAGATGG, anti-sense primer for H19 TCCAAACCAGTGCAATCGACTTAG, sense primer for tPA GCCCTCTGGTGTGCATGATCAAT and anti-sense primer for tPA TTCCAAAGCCAGACCTTCATCCTT, which correspond to the accession numbers: tPA J03250, H19, X58196. Microinjection of ES cells into C57BL/6J blastocysts was performed according to standard procedures (Nichols et al. 1990).

Measurement of intracellular cAMP contents

EB3 ES cells were seeded into 6-well plates at 3 x 105 cells per well and allowed to attach and grow for 20 h. At the start of the experiment, the cells were incubated for 30 min in 0.5 mM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma) in KSR medium at 37 °C, after which were added 10 µM ACTH or modulator and incubated for another 3 h. The media was then removed, the cells washed in HEPES/Tyrode’s/BSA buffer and the cAMP measured using cAMP Biotrak EIA kit (Amersham Biosciences).


   Acknowledgements
 
We thank Kazuki Nakao for technical support of chimeric mice analyses and Austin Smith and Ian Chambers for critical reading of the manuscripts. This work was supported in part by grant-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan award to HN.


   Footnotes
 
Communicated by: Shinichi Aizawa

* Correspondence: Email: niwa{at}cdb.riken.jp


   References
Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Adan, R.A.H. & Gispen, W.H. (2000) Melanocortins and the brain: from effects via receptors to drug targets. Eur. J. Pharmacol. 405, 13–24.[CrossRef][Medline]

Buggy, J.J. (1998) Binding of {alpha}-melanocyte-stimulating hormone to its G-protein-coupled receptor on B-lymphocytes activates the Jak/STAT pathway. Biochem. J. 331, 211–216.

Dani, C., Chambers, I., Johnstone, S., et al. (1998) Paracrine induction of stem cell renewal by LIF-deficient cells: a new ES cell regulatory pathway. Dev. Biol. 203, 149–162.[CrossRef][Medline]

Dhanasekaran, N., Tsim, S.T., Dermott, J.M. & Onesime, D. (1998) Regulation of cell proliferation by G proteins. Oncogene 17, 1383–1394.[CrossRef][Medline]

Evans, M.J. & Kaufman, M.H. (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154–156.[CrossRef][Medline]

Fujikura, J., Yamato, E., Yonemura, S., et al. (2002) Differentiation of embryonic stem cells is induced by GATA factors. Genes Dev. 16, 784–789.[Abstract/Free Full Text]

Girolomoni, G., Phillips, J.T. & Bergstresser, P.R. (1993) Prolactin stimulates proliferation of cultured human keratinocytes. J. Invest. Dermatol. 101, 275–279.[CrossRef][Medline]

Goldsborough, M.D., Tilkins, M.L., Price, P.J., et al. (1998) Serum-free culture of murine embryonic stem (ES) cells. Focus 20, 8–12.

Gressens, P., Hill, J.M., Gozes, I., Fridkin, M. & Brenneman, D.E. (1993) Growth factor function of vasoactive intestinal peptide in whole cultured mouse embryos. Nature 362, 155–158.[CrossRef][Medline]

Hoogduijn, M.J., McGurk, S., Smit, N.P.M., et al. (2002) Ligand-dependent activation of the melanocortin 5 receptor: cAMP production and ryanodine receptor-dependent elevations of [Ca2+](i). Biochem. Biophys. Res. Commun. 290, 844–850.[CrossRef][Medline]

Hooper, M., Hardy, K., Handyside, A., Hunter, S. & Monk, M. (1987) HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326, 292–295.[CrossRef][Medline]

Lotfi, C.F., Lepique, A.P., Forti, F.L., et al. (2000) Proliferative signaling initiated in ACTH receptors. Braz. J. Med. Biol. Res. 33, 1133–1140.[Medline]

Martin, G.R. (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl Acad. Sci. USA 78, 7634–7638.[Abstract/Free Full Text]

Matsuda, T., Nakamura, T., Nakao, K., et al. (1999) STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J. 18, 4261–4269.[CrossRef][Medline]

Mountford, P., Zevnik, B., Duwel, A., et al. (1994) Dicistronic targeting constructs: reporters and modifiers of mammalian gene expression. Proc. Natl Acad. Sci. USA 91, 4303–4307.[Abstract/Free Full Text]

Neves, S.R., Ram, P.T. & Iyengar, R. (2002) G protein pathways. Science 296, 1636–1639.[Abstract/Free Full Text]

Nichols, J., Evans, E.P. & Smith, A.G. (1990) Establishment of germ-line-competent embryonic stem (ES) cells using differentiation inhibiting activity. Development 110, 1341–1348.[Abstract/Free Full Text]

Nichols, J., Zevnik, B., Anastassiadis, K., et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379–391.[CrossRef][Medline]

Niwa, H. (2001) Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct. Funct. 26, 137–148.[CrossRef][Medline]

Niwa, H., Burdon, T., Chambers, I. & Smith, A.G. (1998) Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 12, 2048–2060.[Abstract/Free Full Text]

Niwa, H., Miyazaki, J. & Smith, A.G. (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372–376.[CrossRef][Medline]

Niwa, H., Masui, S., Chambers, I., Smith, A.G. & Miyazaki, J. (2002) Phenotypic complementation establishes requirements for specific POU domain and generic transactivation function of Oct-3/4 in embryonic stem cells. Mol. Cell. Biol. 22, 1526–1536.[Abstract/Free Full Text]

Pesce, M., Canipari, R., Ferri, G.L., Siracusa, G. & DeFelici, M. (1996) Pituitary adenylate cyclase-activating polypeptide (PACAP) stimulates adenylate cyclase and promotes proliferation of mouse primordial germ cells. Development 122, 215–221.[Abstract]

Raz, R., Lee, C.K., Cannizzaro, L.A., d’Eustachio, P. & Levy, D.E. (1999) Essential role of STAT3 for embryonic stem cell pluripotency. Proc. Natl Acad. Sci. USA 96, 2846–2851.[Abstract/Free Full Text]

Schiöth, H.B., Muceniece, R., Larsson, M. & Wikberg, J.E.S. (1997) The melanocortin 1, 3, 4 or 5 receptors do not have a binding epitope for ACTH beyond the sequence of {alpha}-MSH. J. Endocrinol. 155, 73–78.[Abstract/Free Full Text]

Silberbach, M. & Roberts, C.T. Jr (2001) Natriuretic peptide signalling: molecular and cellular pathways to growth regulation. Cell Signal. 13, 221–231.[CrossRef][Medline]

Smith, A.G., Heath, J.K., Donaldson, D.D., et al. (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688–690.[CrossRef][Medline]

Suemori, H., Tada, T., Torii, R., et al. (2001) Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn. 222, 273–279.[CrossRef][Medline]

Tarasov, K.V., Tarasova, Y.S., Crider, D.G., Anisimov, S.V., Wobus, A.M. & Boheler, K.R. (2002) Galanin and galanin receptors in embryonic stem cells: accidental or essential? Neuropeptides 36, 239–245.[CrossRef][Medline]

Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., et al. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282, 1145–1147.[Abstract/Free Full Text]

Viswanathan, S., Benatar, T., Rose-John, S., Lauffenburger, D.A. & Zandstra, P.W. (2002) Ligand/receptor signaling threshold (LIST) model accounts for gp130-mediated embryonic stem cell self-renewal responses to LIF and HIL-6. Stem Cells 20, 119–138.[CrossRef][Medline]

Ward, C.M., Stern, P., Willington, M.A. & Flenniken, A.M. (2002) Efficient germline transmission of mouse embryonic stem cells grown in synthetic serum in the absence of a fibroblast feeder layer. Lab. Invest. 82, 1765–1767.[Medline]

Received: 5 December 2003
Accepted: 9 February 2004




This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Nagaoka, Y. Hagiwara, K. Takemura, Y. Murakami, J. Li, S. A. Duncan, and T. Akaike
Design of the Artificial Acellular Feeder Layer for the Efficient Propagation of Mouse Embryonic Stem Cells
J. Biol. Chem., September 26, 2008; 283(39): 26468 - 26476.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
Y. Toyooka, D. Shimosato, K. Murakami, K. Takahashi, and H. Niwa
Identification and characterization of subpopulations in undifferentiated ES cell culture
Development, March 1, 2008; 135(5): 909 - 918.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
K. Ogawa, A. Saito, H. Matsui, H. Suzuki, S. Ohtsuka, D. Shimosato, Y. Morishita, T. Watabe, H. Niwa, and K. Miyazono
Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells
J. Cell Sci., January 1, 2007; 120(1): 55 - 65.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
S. Wakayama, H. Ohta, S. Kishigami, N. Van Thuan, T. Hikichi, E. Mizutani, M. Miyake, and T. Wakayama
Establishment of Male and Female Nuclear Transfer Embryonic Stem Cell Lines from Different Mouse Strains and Tissues
Biol Reprod, April 1, 2005; 72(4): 932 - 936.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. Wakayama, S. Kishigami, N. Van Thuan, H. Ohta, T. Hikichi, E. Mizutani, R. Yanagimachi, and T. Wakayama
From The Cover: Propagation of an infertile hermaphrodite mouse lacking germ cells by using nuclear transfer and embryonic stem cell technology
PNAS, January 4, 2005; 102(1): 29 - 33.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, K.
Right arrow Articles by Niwa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, K.
Right arrow Articles by Niwa, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS