|
|
||||||||


1 Bioinformatics Centre, Institute for Chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011, Japan
2 Radiation Biology Centre, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8501, Japan
3 Division of Chemistry, Graduate School of Engineering Science, Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CPD photolyase is an enzyme that repairs DNA damaged by UV light (Sancar 1990, 1994). The enzyme absorbs a blue light photon, and an electron on the cofactor flavin adenine dinucleotide (FAD) is excited by the energy of the photon. The excited electron is transferred to the CPD bound to the enzyme, and then the damaged DNA is repaired by cleaving the CPD. Therefore the mechanism is called photorepair. CPD photolyases are classified into two subfamilies, from the evolutionary point of view (Yasui et al. 1994; Kanai et al. 1997). The class I CPD photolyase subfamily has been mainly isolated from eubacteria and fungi (Sancar 1990, 1994; Yasui et al. 1994). The class II CPD photolyase subfamily, on the other hand, is widely distributed throughout all organisms (Todo et al. 1994; Kato et al. 1994; Yasui et al. 1994). The tertiary structures of the class I CPD photolyases have been determined by X-ray crystallographic studies (Miki et al. 1993; Park et al. 1995; Komori et al. 2001). The structure consists of two domains connected by a loop. The N-terminal domain is classified in the
/ß class, while
helices are abundant in the C-terminal domain, according to the structure classification database, SCOP (Murzin et al. 1995). The FAD cofactor is present at the bottom of the cavity in the C-terminal domain. The CPD is thought to be located in the cavity, to receive the excited electron from FAD.
Cryptochrome does not exhibit photorepair activity. The CRYs are roughly classified into two subfamilies, the animal CRYs and the plant CRYs. The two subfamilies are clearly distinguished in the phylogenetic tree, and the divergence of the two subfamilies is considered to be ancient (Kobayashi et al. 2000; Hitomi et al. 2000; Brudler et al. 2003). The plant CRY proteins were originally identified as blue light photoreceptors, which contribute to seedling growth and flowering season regulation (Ahmad & Cashmore 1993). They are widely distributed throughout plant species. The members of the animal CRY subfamily are distributed from insects to vertebrates, and involved in circadian rhythm (Griffin et al. 1999; Kume et al. 1999; Rosato et al. 2001). However, the mechanism of CRY on the regulation of circadian system differs between Drosophila and mice (Froy et al. 2002), these CRYs belong to the same animal CRY subfamily. The molecular mechanisms of CRY functions have remained elusive. CRY proteins show sequence similarity to the class I CPD photolyases, despite the absence of photorepair activity. The (64) photolyases, which selectively repair (64) photoproducts and have been isolated from higher eukaryotes (Todo 1999), are derived from the animal CRY subfamily (Todo et al. 1996).
We recently identified a novel subfamily within the photolyase/cryptochrome family (Hitomi et al. 2000; Brudler et al. 2003). This novel subfamily is relatively closer to the animal CRY subfamily, rather than the plant CRY subfamily and the CPD photolyase subfamilies. Due to this evolutionary relationship, the members of the new group were considered to be novel cryptochromes (Hitomi et al. 2000; Brudler et al. 2003). The subfamily consists of proteins derived from Synechocystis sp. PCC 6803, Vibrio cholerae, and Arabidopsis thaliana (A. thaliana), and is called the cryptochrome DASH subfamily (Brudler et al. 2003). In this study, we call the member of the new subfamily as CRY-DASH to distinguish from the other members of cryptochrome subfamilies. Another interesting point is that the subfamily includes two bacterial proteins. Thus, the proteins are considered to be the first bacterial cryptochromes. According to this hypothesis, the biochemical functions of the Synechocystis CRY-DASH were investigated (Hitomi et al. 2000; Brudler et al. 2003). The Synechocystis protein showed no photorepair activity in vitro, although a weak CPD photorepair activity was detected in vivo (Hitomi et al. 2000). Instead, it showed nonspecific DNA binding activity, suggesting its function as transcriptional regulator (Brudler et al. 2003). In fact, microarray analyses revealed that the disruption of the Synechocystis CRY-DASH gene affects the expression of several genes (Brudler et al. 2003). Brudler et al. (2003) solved the crystal structure of the Synechocystis CRY-DASH, which shows high similarity to the structures of class I CPD photolyases. The presence of the FAD in the Synechocystis protein was also revealed by the X-ray crystallographic study. A recent study revealed that the A. thaliana CRY-DASH lacks photorepair activity, but has a nonspecific DNA binding activity (Kleine et al. 2003). In addition, Kleine et al. (2003) reported that the A. thaliana protein was able to bind FAD. Thus, the A. thaliana CRY-DASH has similar features to the Synechocystis CRY-DASH. However, the physiological processes in which the CRY-DASHs actually function are not known.
In our previous study (Brudler et al. 2003), only three proteins were included in the CRY-DASH subfamily, as described above. As compared to the other subfamilies of the photolyase/cryptochrome family, the size of this subfamily is small, and the distribution seems to be restricted. Therefore, this subfamily may have been generated by rare evolutionary events, such as horizontal gene transfer. After the submission of the previous work, large amounts of sequence data, including complete genome sequences, have become available. To examine how widely the members of the CRY-DASH subfamily are actually distributed within living organisms, we tried database searching. Our searches yielded five new CRY-DASH candidates with sources from marine bacteria and Neurospora crassa. We also searched through several EST databases, and obtained many CRY-DASH candidates. Unexpectedly, the EST candidates included sequences derived from several fish and Xenopus laevis. To confirm this observation, we cloned and sequenced the cDNAs corresponding to the EST sequences from zebrafish and Xenopus. A phylogenetic analysis revealed that all of the candidates obtained in this study belong to the CRY-DASH subfamily. Subsequent characterization of the purified proteins showed that the two vertebrate CRY-DASHs share the spectroscopic properties with the bacterial CRY-DASH and have a weak CPD photolyase activity.
| Results |
|---|
|
|
|---|
Several candidates of new CRY-DASH subfamily members were obtained by searching through the nr protein database of NCBI and some genome databases. The candidates included several bacterial ORF products. In addition to the previously reported bacterial CRY-DASHs (Brudler et al. 2003), four ORF products derived from marine bacteria, such as algicidal bacteria (Vibrio parahaemolyticus, Cytophaga hutchinsonii), a cyanobacterium (Trichodesmium erythraeum) and a planctomycete (Pirellula sp.) were obtained. These ORF products either had no annotations or were regarded as photolyases according to the sequence similarities in the databases. Two amino acid sequences were obtained from A. thaliana. One of them was the CRY-DASH protein itself (NCB accession No. gi: 28971609) (Brudler et al. 2003), whereas the other was an ORF product (gi: 3319288), which was annotated as a photolyase/blue light photoreceptor protein. The sequence identity between two proteins is 40.0%. A deletion of about 100 amino acid residues was observed at the C-terminal region of the protein. An ORF product derived from Neurospora crassa (gi: 28927535) was also detected as a new CRY-DASH. The ORF product was found within the complete genome of N. crassa, which was recently determined (Galagan et al. 2003). The protein is simply described as a hypothetical protein in the database, whereas Lee et al. (2003) referred to it as a cryptochrome orthologue, based on the sequence similarity. However, there was no description of a cryptochrome subfamily for the ORF product (Lee et al. 2003). The ORF product from N. crassa has a C-terminal extension of about 200 amino acid residues, with an abundance of Gly residues. The region did not show significant sequence similarity to any other proteins. No CRY-DASH candidate was detected from the other fungi, Saccharomyces cerevisiae, Schizosaccharomyces pombe or Encephalitozoon cuniculi, with complete genome data. In addition, no animal or plant CRY counterpart was detected in these fungal genomes. During this analysis, we noticed that some organisms have no genes encoding members of the photolyase/cryptochrome family in their genomes. We examined the complete genomes of 118 eubacteria, 16 archaea and 7 eukaryotes in this analysis. Most of them encoded several photolyase and cryptochrome homologues. However, no homologue of the protein family was detected within the Plasmodium falciparum (Gardner et al. 2002) and Caenorhabditis elegans (Rachael et al. 1998) or within the whole genome shotgun data of Ciona intestinalis (Dehal et al. 2002).
The same database search procedure was applied to several EST databases, which yielded many novel CRY-DASH candidates. The EST sequences thus obtained did not cover the entire coding regions. Instead, these sequences showed high sequence similarities to the N- or the C-terminal regions of the known CRY-DASHs. We obtained many CRY-DASH candidates from the EST databases of a wide range of plants, including mosses, gymnosperms, monocots and dicots. An EST sequence from a rhodophata, Porphyra yezoensis (gi: 8586831), was also obtained as a novel CRY-DASH candidate. Unexpectedly, we found several vertebrate EST sequences as CRY-DASH candidates. The vertebrate sources of the EST sequences were Danio rerio, Fugu rubripes, Oryzias latipes, and Xenopus laevis. We made a multiple alignment of the N-terminal regions of the photolyase/cryptochrome family, together with the CRY-DASH candidates obtained from the nr protein database, the genome databases and the EST databases. Based on an alignment of about 110 amino acid residues, a preliminary phylogenetic tree was constructed by the neighbour-joining (NJ) method (data are not shown here, but the alignment and the tree are available at the web site, http://timpani.genome.ad.jp/~dash/). In the preliminary tree, all of the sequences of the CRY-DASH candidates formed a large cluster, together with the known members of the CRY-DASH subfamily (Brudler et al. 2003), and the cluster is distinguishable from the animal CRYs and the plant CRYs.
Isolation of the vertebrate CRY-DASH candidates
The database search results and the topology of the preliminary tree supported the idea that the candidates obtained in this study are new CRY-DASH subfamily members. Especially, the presence of CRY-DASH members in vertebrates would be an interesting and important finding, if the detected sequences actually belong to the CRY-DASH subfamily. To confirm this point, the cDNAs of the CRY-DASH candidates from Danio rerio and Xenopus laevis were cloned, based on the EST sequence information. To obtain the full-length CRY-DASH cDNAs, we designed primers based on the nucleotide sequences of the ESTs for nested 5' and 3' RACE reactions. Both the 5' and 3' RACE reactions resulted in multiple clones, which were sequenced. An alignment of the nucleotide sequences with the ESTs produced a contiguous sequence. This zebrafish 5' RACE product sequence appeared to include the full 5' end of the translated coding region, as indicated by the presence of an in-frame stop codon on the 5' side of the initiating methionine. It also encompassed the 3' end of the coding region, as revealed by the presence of the poly(A) tail. The DDBJ accession numbers of the cDNAs from Xenopus and zebrafish are AB120760 and AB120759, respectively. Then amino acid residues were deduced from the determined cDNA sequences. The Xenopus protein consisted of 524 amino acid residues, while the zebrafish protein was of 521 amino acid residues in length.
Phylogenetic relationships
We obtained the full amino acid sequences of seven novel CRY-DASH candidates. Five of them were detected by database searching, and included the ORF products from V. parahaemolyticus, C. hutchinsonii, T. erythraeum, Pirellula sp., and N. crassa. The rest of them were derived from Xenopus and zebrafish, which were cloned and sequenced as described above. The evolutionary relationship of the seven candidates to the members of the photolyase/cryptochrome family was investigated. First, we constructed a multiple alignment, which consisted of the members from all of the subfamilies. Seven CRY-DASH sequence candidates were included in the alignment. However, no EST sequence was used in this study. The PHR2 protein from A. thaliana was excluded from this phylogenetic analysis, because of the deletion in the C-terminal region, as described above. Due to its ancient divergence from the other subfamily (Kanai et al. 1997), the class II photolyase subfamily was not included in this study. The alignment is available at the web site http://timpani.genome.ad.jp/~dash/. Then, an unrooted NJ tree of the photolyase/cryptochrome family was constructed (see Fig. 1). According to the tree topology, the aligned sequences were classified into four groups, which correspond to the animal CRY/(64) photolyase subfamily, the CRY-DASH subfamily, the plant CRY subfamily, and the class I CPD photolyase subfamily, respectively. The classification was basically the same as that in the previous study (Hitomi et al. 2000; Brudler et al. 2003). The first three groups were rooted at the nodes A, B and C with 100% bootstrap probabilities, while the root of the class I CPD photolyase subfamily was obscure in this tree. This tree suggests that the CRY-DASH subfamily can be distinguished from the other subfamilies with statistical significance. As reported previously (Hitomi et al. 2000; Brudler et al. 2003), the CRY-DASH subfamily was more closely related to the animal CRY subfamily, rather than the plant CRY subfamily and the class I CPD photolyase subfamily. We also examined the evolutionary relationship of the four subfamilies by the maximum likelihood (ML) method. The results of the ML analysis supported the relationship in the NJ tree (data not shown, but available at http://timpani.genome.ad.jp/~dash/).
|
Characterization of the vertebrate CRY-DASH members
To determine the spectroscopic and biochemical properties of the vertebrate CRY-DASHs, we cloned the zebrafish and Xenopus cry-dash genes. Both proteins were expressed at high level and readily purified. Figure 2A shows the purified proteins as revealed by SDS-PAGE. The proteins were > 80% pure and therefore appropriate for spectroscopic and enzymatic analyses.
|
To get further evidence that zCRY-DASH contains both MTHF and FAD, fluorescence spectrum of zCRY-DASH was determined (Fig. 2C,D). Typically, enzyme-bound MTHF has a fluorescence emission maximum at 460480 nm with an excitation maximum at 360390 nm. Flavin has an emission maximum at 502520 nm with excitation maxima at 370 nm and 440 nm. Figure 2C shows the fluorescence spectra of zCRY-DASH. When excitation spectrum was recorded for emission at 460 nm, a peak with
max = 385 nm was obtained (Fig. 2C). Excitation at 380 nm gave a fluorescence spectrum with a peak at 475 nm (Fig. 2C), consistent with MTHF being the predominant chromophore in near-UV in zCRY-DASH. Excitation of zCRY-DASH with 470 nm yielded a typical flavin emission spectrum (
max = 520) (Fig. 2D), consistent with the presence of FAD. However, when the excitation spectrum was determined for 520 nm emission, a major peak at 385 nm and a minor one around 460 nm (Fig. 2D) instead of the 370 nm and 440 nm peaks typical of flavin absorbance. To confirm further the presence of FAD in zCRY-DASH, the proteins were heat-denatured at neutral pH, and, following removal of the denatured protein by centrifugation, the absorption spectrum was recorded (Fig. 2E). The absorption spectrum of the released chromophore showed a typical flavin absorbance with maxima at 350 nm and 450 nm. The fluorescence emission spectra of the released chromophore were taken at different pH values. Excitation at 450 nm resulted in fluorescence emission with a maximum at 530 nm. The fluorescence emission was pH dependent with fivefold-higher fluorescence at pH 3.0 than at pH 8.0 (Fig. 2F). This pH dependency of fluorescence emission is typical for FAD, confirming the presence of FAD in zCRY-DASH. Therefore, the low emission peak at 440 nm of the holoenzyme (Fig. 2D) suggests that, in zCRY-DASH, MTHF is the main chromophore responsible for excitation of FAD, which then decays by fluorescence at 520 nm.
The stoichiometries of the two cofactors relative to the apoenzyme were roughly calculated. The stoichiometry of FAD to apoenzyme is estimated from the ratio of the 440 nm absorption of the denatured enzyme to the absorption of the holoenzyme at 280 nm. The concentration of MTHF is estimated from the absorption at 380 nm of the holoenzyme. The stoichiometries of the cofactors were found to depend on the growth conditions of the cultures. The following values were obtained as the average of two different purification experiments; FAD:MTHF:apoenzyme = 0.7 : 0.8 : 1.0.
Two different activities were known for the photolyase/cryptochrome family; the repressor activity of CLOCK:BMAL mediated transcription and the light-dependent repair activity of UV-induced DNA damage. We examined whether zebrafish and Xenopus CRY-DASH have these activity.
The CLOCK:BMAL heterodimer drives gene expression when the gene is under control of the E-box bearing promoter. Animal CRY inhibits the CLOCK:BMAL-mediated transcription. We tested whether CRY-DASH also can inhibit the CLOCK:BMAL-mediated transcription in zebrafish BRF41 cell (Fig. 3). Although zCRY1a, a member of zebrafish animal-type CRY, inhibits it completely, zebrafish CRY-DASH showed no inhibition. Xenopus CRY-DASH also showed no inhibition (data not shown), demonstrating that vertebrate CRY-DASH and animal-type CRY are functionally different.
|
|
|
The increased member of CRY-DASH subfamily members made it possible to examine the residue conservation within the subfamily. The sequence alignment of the CRY-DASH subfamily is shown in Fig. 6. We identified the invariant residues from the alignment. About one-third of the invariant sites of the CRY-DASH subfamily were conserved over the photolyase/cryptochrome family. The residues corresponding to the invariant sites were mapped on the tertiary structure of Synechocystis CRY-DASH (Brudler et al. 2003) (Fig. 7). The CRY-DASH structure shares a common folding pattern with those of the photolyases (Miki et al. 1993; Park et al. 1995; Komori et al. 2001), in spite of their functional differences. The mapped residues on the structure were classified into five groups, according to the spatial proximity.
|
|
The invariant residues of the second group were found at the interface region between the N- and the C-terminal domains, and on the loop connecting the two domains. The conservation of residues may be involved in maintaining the proper arrangement of the two domains for the function.
As described above, in the Synechocystis CRY-DASH protein, a FAD is present at the bottom of the cavity, where the cofactor is non-covalently bound to the C-terminal domain. The conserved residues of the third group were present in the C-terminal domain, and most of them occupied the positions that directly interact with FAD. Most of the sites were conserved not only within the CRY-DASH subfamily, but also throughout the photolyase/cryptochrome family. These data are consistent with the spectroscopic results shown in Fig. 2. Brudler et al. (2003) reported that an Asn residue, at the alignment site 523 in Fig. 6, is also involved in FAD binding in the Synechocystis CRY-DASH. As shown in the figure, this Asn was invariant within the CRY-DASH subfamily. Brudler et al. (2003) also reported that two Trp residues involved in FAD binding in the E. coli photolyase are replaced with other residues in the Synechocystis CRY-DASH (alignment sites 389 and 480). As shown in Fig. 6, the Trp residues were also replaced with other residues in all of the members of the CRY-DASH subfamily. The residue conservation pattern suggests that the members of the CRY-DASH subfamily bound FAD in the same manner as the Synechocystis CRY-DASH.
The conserved residues of the fourth group were clustered on the surface of the tertiary structure, and surrounded the cavity including the FAD. The Synechocystis CRY-DASH (Brudler et al. 2003) and the A. thaliana CRY-DASH (Kleine et al. 2003) have a nonspecific DNA binding activity. As described above, zebrafish CRY-DASH can especially bind the CPD-contained DNA (Fig. 5B). For the CPD photolyase and the Synechocystis CRY-DASH, the positively charged Arg residues corresponding to the alignment sites 331, 396, 484, 486 and 539 could be involved in DNA recognition (Brudler et al. 2003). These five residues were completely conserved within the CRY-DASH subfamily. In addition, the invariant positively charged residues at the alignment sites 328, 535 and 545, which belonged to the fourth group, were also located near the entrance of the cavity in the Synechocystis CRY-DASH structure. Therefore, these eight positively charged residues are considered to play a role in DNA recognition.
Three Trp residues may constitute an electron transfer chain from the protein surface to the FAD cofactor in the photolyase structure (Li & Sancar 1990; Aubert et al. 2000). All of them were conserved in the Synechocystis CRY-DASH (Brudler et al. 2003), which corresponded to the alignment sites 488, 501 and 504 in Fig. 6. The Trp residues at sites 501 and 504 were invariant within the CRY-DASH subfamily, but the Trp at site 448 was present only in six members of the CRY-DASH subfamily. This observation suggests that at least six members of the CRY-DASH subfamily may have redox ability, as indicated for the Synechocystis CRY-DASH by Brudler et al. (2003). The conserved residues of the fifth group were arranged to surround the electron transfer chain.
| Discussion |
|---|
|
|
|---|
Synechocystis and Arabidopsis CRY-DASH have a nonspecific DNA binding activity, which was predicted to be indispensable for their function (Brudler et al. 2003; Kleine et al. 2003). However, in the present study we cannot detect such activity in zebrafish and Xenopus CRY-DASH (Fig. 5B, lanes 4 and 5). On the other hand, CPD-binding activity of Xenopus CRY-DASH was also undetectable (Fig. 5B, lane 10), while it showed a CPD-photorepair activity (Fig. 5C, lane 6). These results suggest that in the present gel retardation assay only a stable binding was detected and an unstable binding was undetectable by unknown reason (Fig. 5B). Further alteration of the experimental condition might clarify this point.
As described above, we searched for new CRY-DASH subfamily members within of the several complete genomes available today. However, no CRY-DASH candidate was detected from other animals, such as humans, mice, Drosophila melanogaster, and C. elegans. Thus, CRY-DASH protein distribution in animals seems to be restricted to some aquatic organisms, such as fish and amphibians. The EST data analysis suggested that the CRY-DASH subfamily members are widely distributed within the fish. The evolutionary origin of the restricted distribution, for example, lineage specific gene loss or horizontal gene transfer, will await the further accumulation of animal genome data.
As shown in Fig. 1, the A. thaliana CRY-DASH was close to the Synechocystis CRY-DASH and the T. erythraeum ORF product. This suggests that the plant CRY-DASHs may have originated from chloroplasts or photosynthetic bacteria. As for A. thaliana, the CRY-DASH gene is encoded in the nuclear genome. Therefore, it is thought that an ancestral CRY-DASH gene was transferred from the genome of a chloroplast or photosynthetic symbiont to the nuclear genome of an ancestral plant, as suggested by Kleine et al. (2003). Many cases of gene transfer from plant organelles, such as chloroplasts and mitochondria, to host nuclei have been reported (Martin et al. 2002). As mentioned above, the biological function of the CRY-DASH proteins is not known. However, if the gene for the CRY-DASH protein was transferred from the chloroplast to the nucleus in plants, then the product may be involved in a function related to chloroplast regulation. Actually, Kleine et al. (2003) reported that the N-terminal region of the A. thaliana CRY-DASH (about 40 amino acid residues) acts as a signal sequence to mediate the plant CRY-DASH import into chloroplasts and mitochondria. However, the signal sequence did not show significant sequence similarity to the N-terminal regions of PHR2 and the amino acid sequences deduced from the EST sequences of putative plant CRY-DASHs. We found many CRY-DASH candidates in the plant EST data. The preliminary phylogenetic analysis supported the possibility that the candidates actually belong to the CRY-DASH subfamily. We cannot make any definite statement about the assignment of the candidates at this stage. However, the possibility that plants have CRY-DASHs as a second cryptochrome should be considered, when the CRY functions in plants are examined.
In this study, some ORF products from marine bacteria were identified as CRY-DASH proteins. The sources were marine algicidal microorganisms, algae, and planctomyces. Algicidal microorganisms and planctomyces may have acquired the CRY-DASH gene by horizontal gene transfer, after ingesting algae by endocytosis.
We also detected a new CRY-DASH subfamily member derived from N. crassa. This fungus exhibits the circadian rhythm, and many of the proteins that functions in its oscillatory system have been studied (Loros & Dunlap 2001). However, the cryptochrome homologue of N. crassa was not identified until the genome project was completed (Galagan et al. 2003). Both animals and N. crassa generate circadian rhythm with a common basic regulatory system, an auto-regulatory negative feedback loop. Although the core proteins constituting the feedback loop differ between animals and N. crassa (Van Gelder et al. 2003), some of the N. crassa proteins involved in the circadian regulatory systems, such as wc-1 and wc-2, have the sequence homologous domain (PAS domain) that is commonly observed in the clock proteins from many organisms (Dunlap 1999). Some PAS domain-including proteins interact with the animal CRYs in mice and zebrafish (Griffin et al. 1999; Kume et al. 1999; Ishikawa et al. 2002; Hirayama et al. 2003). At this stage, neither the function of the Neurospora CRY-DASH nor the involve-ment of the protein in circadian rhythm is known. However, the possibility that this novel CRY-DASH may regulate the fungal circadian rhythm should be considered, when the function is examined.
Another interesting question is what is the function of vertebrate CRY-DASH. Animal CRYs act as transcriptional repressor, which is an essential step in the circadian system. On the analogy of animal CRYs it is likely that vertebrate CRY-DASHs also function as the regulator of circadian rhythm. However, even if vertebrate CRY-DASHs are participated in the regulation of circadian rhythm, their role must be different from that of animal CRYs, because the vertebrate CRY-DASHs do not show any transcriptional repressor activity. The presence of the second chromophore (MTHF) and efficient energy transfer from MTHF to FAD in CRY-DASH (Worthington et al. 2003) suggest the function as a photoreceptor. Analyses of CRY-DASH members have just begun. However, they will reveal novel functional aspects of the photolyase/cryptochrome family, and may shed new light on the regulation of circadian rhythm.
| Experimental procedures |
|---|
|
|
|---|
The BLAST program (Altschul et al. 1997) was used to search for novel CRY-DASH protein candidates in the nr databases at NCBI (http://www.ncbi.nlm.nih.gov/) and GenomeNet (http://www.genome.ad.jp/dbget/dbget.links.html). The amino acid sequences of Synechocystis sp. PCC 6803 CRY-DASH (gi: 28374085) and A. thaliana CRY-DASH (gi: 28971609) were used as the queries. For the sequence selections, we used the list of the sequences, which were sorted with their scores to the query. The sequences were selected from the top of the list, one after another, until a sequence belonging to a subfamily other than the CRY-DASH subfamily was found. Then, each selected sequence was used as a query for database searching through the nr databases. When the top positions in the search output were occupied by the known CRY-DASHs, the selected sequence was regarded as a novel CRY-DASH candidate. Several genome databases at GOLD (http://wit.integratedgenomics.com/GOLD/) were also searched with BLAST for novel CRY-DASH candidates. The CRY-DASHs from Synechocystis and Arabidopsis were again used as the queries. The second database search was performed at the NCBI. The EST databases at NCBI and GenomeNet were also searched, with the same procedure as described above. BLAST was used for the first database search. Whole genome shotgun data, available at DOE (http://www.jgi.doe.gov/), were also used in our quest CRY-DASH candidates.
The NCB accession GI numbers for the sequence data used in this study are shown in Fig. 1. In addition to the amino acid sequence data, the coordinates for a CRY-DASH derived from Synechocystis (pdb code: 1NP7 [PDB] ) and three photolyases (1QNF [PDB] from Synechococcus sp. PCC 6301, 1DNP [PDB] from E. coli, and 1IQR [PDB] from Thermus thermophilus) were used for the structural alignment and the mapping of the conserved residues.
Sequence and structural alignments
The photolyase/cryptochrome family is classified into five subfamilies (Hitomi et al. 2000; Brudler et al. 2003): animal CRY/(64) photolyase, CRY-DASH, plant CRY, class I CPD photolyase, and class II CPD photolyase. The class II CPD photolyases were not included in this study, because of their ancient divergence (Kanai et al. 1997). Only some of the detected members from the class I CPD photolyase subfamily and the plant CRY subfamily were used for the analysis, because of the large number of members. Therefore, several representative sequences were selected from each subfamily. The sequences were divided into four groups, corresponding to the subfamilies. Then, a multiple alignment of each group was constructed with the alignment software, CLUSTAL W 1.81 (Thompson et al. 1994). Finally, the four multiple alignments were piled up using the profile alignment function in CLUSTAL W. The alignment thus obtained was slightly modified by visual inspection, to keep the gaps from interrupting the secondary structure elements as much as possible. A structural alignment among the CRY-DASH and three photolyases was used for the modification. The structural alignment was constructed with a program developed by the authors (Toh 1997; Daiyasu & Toh 2000), based on the double dynamic programming algorithm (Taylor & Orengo 1989).
Cloning of zebrafish and Xenopus CRY-DASH homologues
By conducting BLAST searches of the available EST database, we found two over-lapping ESTs in Xenopus and zebrafish. The GeneBank accession numbers of these ESTs were: Xenopus, CA971785 and BU916216; and zebrafish, AW153390 and CA472873. Since both the Xenopus and zebrafish ESTs were partial, we amplified their 5' and 3' ends by the rapid amplification of cDNA ends (RACE) technique (Frohman et al. 1988). The RACE reactions were carried out by using cDNAs extended from the total RNAs of Xenopus oocytes or zebrafish eyes. The primer sequences were as follows: 3' RACE primer for Xenopus, XlCRYDash907R, GTGGCTTTGAAATACGGCAG and XlCRYDash971R GGAAGAGGGACCCAAAGC; and for zebrafish zCRYDash902R TTGTGGCTTTGAAATACGG and zCRYDash934R TATATGAACGGTCTGCAAG; 5' RACE primer for Xenopus, XlCRYDash99L, CTGGTCTGCGTTCCTGTG, XlCRYDash64L, TCGTTATCGTGCAGCCGC and XlCRYDash48L, CAAGTCGTTCCTCAGCAG; and for zebrafish, zfCRYDash105L, GCCCAGTGAAACACCTCG and zfCRYDash52L, GCAGCCGCAGATCGTTCC. The cDNA sequences uncovered by the 5' and 3' RACE products were amplified by PCR using the cDNA with a set of the following gene-specific primers: for Xenopus, XlCRYDash-RI-ATG, CCAGAATTCATGTGTGTCCCTAGCCG, XlCRYDash1065L, TCCAGTCATTGCCAGTTCC; for zebrafish, zCRYDash-RI-ATG, GCCGAATTCATGTCCGCTTCCCGTAC and zCRYDash1012L, TTCTTCCCTCTTTCCATGC. All PCR products were subcloned into the TA plasmid vector. The sequences of five independent plasmid clones were determined.
Detection of transcriptional repressor activity
Luciferase reporter gene assays of BRF41 cells were done as described elsewhere (Kobayashi et al. 2000; Ishikawa et al. 2002). The full-length coding regions of zebrafish cry-dash and Xenopus cry-dash were ligated into the pcDNA3.1 expression vector (Invitrogen). The resulting plasmids were designated pcDNA-zCRY-Dash and pcDNA-XlCRY-Dash. The expression constructs of zebrafish clock, bmal3 and cry1a were described elsewhere (Kobayashi et al. 2000; Ishikawa et al. 2002). Reporter constructs were made as follows (Kobayashi et al. 2000). A 3700 bp segment of the 5' flanking region of zcry3 gene was isolated from the genomic library and subcloned in the pGL3-Basic vector (Promega), generating pzcry3-luc. Cells (1.5 x 105) were seeded in 12-well plates and transfected the next day with Lipofectamine-Plus (Invitrogen). Each transfection had 200 ng each of pcDNA-zCLOCK1, pcDNA-zBMAL3 and pcDNA-zCRY1a or pcDNA-CRY-Dash, and the reporter plasmid pzcry3-luc (10 ng) and the pRL vector (Promega) 25 ng. The total DNA per well was adjusted to 1 µg by adding pcDNA 3.1 vector as the carrier. Forty-eight hours after transfection cells were harvested, and their firefly and Renilla luciferase activities determined by luminometry. The reporter luciferase activity was normalized for each sample by determining the firefly:Renilla luciferase activity ratios. All experiments were done three times.
Detection of DNA photolyase activity in E. coli
The full-length coding regions of zebrafish CRY-Dash and Xenopus CRY-Dash were ligated into the pGEX4T expression vector (Pharmacia). The resulting plasmids were designated pGEX-zCRY-Dash and pGEX-XlCRY-Dash. E. coli strains, SY2 (uvrA, recA, phr) or SY32 (uvrA, recA, phr) cells that carry plasmid pRT2, were used as the hosts for the expression of zebrafish or Xenopus cry-dash genes. Plasmid pRT2 bears the E. coli phr+ gene. Thus, neither the UV-induced CPD nor (64) photoproduct is photorepaired in the SY2 host cells but CPDs are photorepaired efficiently in SY32/pRT2 cells. E. coli cells SY2 or SY32/pRT2 were transformed with pGEX-zCRY-Dash or pGEX-XlCRY-Dash. The transformed cells were grown overnight in LB medium with 20 mg/L ampicillin, 10 mg/L kanamycin and 10 mg/L tetracycline at 37 °C. Expression of pGEX-zCRY-Dash or pGEX-XlCRY-Dash was induced by adding isopropyl-1-thio-b-D-galactopyranoside (IPTG) to the medium to a final concentration of 0.1 mM and shaking for 1 h at 37 °C. The cells were plated on LB agar and first UV-irradiated with intensities of 0.1, 0.2, 0.3, 0.6 or 1.2 J/m2 and subsequently with daylight fluorescence lamps for 1 h as previously described (Kobayashi et al. 2000). Samples were incubated at 37 °C overnight. Surviving colonies were counted the next day. All experiments, except photoreactivation treatments, were performed under yellow light.
Preparation of GST-fusion protein
E. coli SY2 was transformed with the GST fusion vectors (pGEX-zCRY-Dash and pGEX-XlCRY-Dash). Cells were grown at 25 °C to A600 0.50.8 by induction with 0.1 mM IPTG for 12 h then collected by centrifugation. The cell pellets were resuspended in phosphate-buffered saline (PBS), then sonicated. Insoluble material was removed by centrifugation (60 min at 10 000 x g). GST-fusion proteins were purified from the soluble extracts in a glutathione-Sepharose 4B column (Amersham Pharmacia Biotech) according to the manufacture's instructions. GST-fusion protein containing fractions, detected by GST activity, were pooled. The gel filtration column PD-10 (Amersham Pharmacia Biotech) was used to remove glutathione contained in buffer. The final buffer contained 50 mM Tris, pH 8.0. Fractions that contained the GST-fusion protein were determined by SDS-PAGE, and they were pooled. Glycerol was added (10% final concentration) before storage at 20 °C. Purification of E. coli CPD photolyase, GST-Dm CPD photolyase and GST-Xl 64 photolyase were done as previously described (Todo et al. 1993, 1994, 1997).
Gel mobility shift and in vitro DNA repair assay
Mobility shift assays and in vitro DNA repair assay were essentially done as previously described (Hitomi et al. 1997) with slight modification (Kobayashi et al. 2000). 49 bp DNAs, which have a single UV photoproduct (either a CPD, (64) photoproduct or DEWAR isomer) at the MseI site, were prepared as described elsewhere (Hitomi et al. 1997) and used as the substrate both in the gel shift and in vitro repair assays. For the gel shift assay, 1 µg of partially purified GST-fusion protein was added to the 32P-labelled DNA substrate (1 nM), and the mixture electrophoresed on a non-denaturing acrylamide gel as previously described (Hitomi et al. 1997). In the in vitro repair assay, the MseI restriction enzyme recognition site, TTAA, which becomes uncleavable due to the photoproduct at the TT site, is restored by the photoreversal reaction, and thus MseI digestion generate 21 base pair fragment (Hitomi et al. 1997). Three micrograms of GST-fusion protein was mixed with 32P-labelled DNA substrate (10 nM) then illuminated with photoreactivating light. After treatment of the mixture with phenol, the DNA substrate was recovered by ethanol precipitation, digested with MseI then electrophoresed on a denaturing acrylamide gel.
Spectroscopic analysis
The absorption and fluorescence spectra were recorded with a BECKMAN DU-640 spectrophotometer and a Shimazu RF-5300PC spectrofluorometer, respectively. The concentrations of the apoproteins and the cofactors were calculated from their molar extinction coefficients. The theoretical molar extinction coefficient of GST-zCRY-DASH apoenzyme at 280 nm is 155 420 M1 cm1. The molar extinction coefficient of MTHF at 370380 nm is 24 495 M1 cm1 (Johnson et al. 1988; Worthington et al. 2003). To determine the flavin concentration, the zCRY-DASH holoproteins were heated at 95 °C for 5 min in buffer containing 50 mM Tris-HCl, pH 8.0, and the precipitated protein was removed by centrifugation. The absorption spectrum in the 300600 nm range was recorded, and FAD concentration was calculated from 440 nm absorbance using a molar extinction coefficient of 11 300 M1 cm1. When MTHF is released from the enzyme, the 510 methenyl bridge responsible for the 380 nm absorption is broken at neutral pH to generate 10-formyltetrahydrofolate, which does not absorb at
> 300 nm and hence does not contribute to the near UV spectrum of the cofactors (Johnson et al. 1988; Worthington et al. 2003).
Phylogenetic analyses
To investigate the evolutionary relationships of the photolyase/cryptochrome family, molecular phylogenetic trees were constructed by two different approaches, the NJ method (Saitou & Nei 1987) and the ML method (Felsenstein 1981). For the analyses, the sites including gaps were excluded from the multiple alignments.
The genetic distance between every pair of aligned sequences was calculated as an ML estimate (Felsenstein 1996), using the JTT model (Jones et al. 1992) for the amino acid substitutions. Based on the distances, an NJ tree was constructed for all of the sequences included in the alignment. The statistical significance of the NJ tree topology was evaluated by a bootstrap analysis (Felsenstein 1985) with one thousand iterative tree re-constructions.
The evolutionary relationship among the four groups was further examined by the ML method. The JTT-F model was used as the amino acid substitution model in the ML analysis. However, the number of sequences included in the alignment was too large for all of the sequences to be subjected to the ML analysis. Therefore, several representative sequences were selected from each group, and the ML analysis was performed with the restricted sequence data. The statistical significance of the ML tree topology was also evaluated by the bootstrap analysis.
For the phylogenetic analyses, two software packages, PHYLIP 3.5c (Felsenstein 1993), and MOLPHP 2.3b3 (Adachi & Hasegawa 1996), were used. The trees thus obtained were drawn with TreeView (Page 1996).
| Footnotes |
|---|
Both authors contributed equally to this work. | References |
|---|
|
|
|---|
Ahmad, M. & Cashmore, A.R. (1993) HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 366, 162166.[CrossRef][Medline]
Altschul, S.F., Madden, T.L., Schaffer, A.A., et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res.
25, 33893402.
Aubert, C., Vos, M.H., Mathis, P., Eker, A.P. & Brettel, K. (2000) Intraprotein radical transfer during photoactivation of DNA photolyase. Nature 405, 586590.[CrossRef][Medline]
Brudler, R., Hitomi, K., Daiyasu, H., et al. (2003) Identification of a new cryptochrome class. Structure, function, and evolution. Mol. Cell 11, 5967.[CrossRef][Medline]
Cashmore, A.R., Jarillo, J.A., Wu, Y.J. & Liu, D. (1999) Cryptochromes: blue light receptors for plants and animals. Science
284, 760765.
Daiyasu, H. & Toh, H. (2000) Molecular evolution of the myeloperoxidase family. J. Mol. Evol. 51, 433445.[Medline]
Dehal, P., Satou, Y., Campbell, R.K., et al. (2002) The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science
298, 21572167.
Dunlap, J.C. (1999) Molecular bases for circadian clocks. Cell 96, 271290.[CrossRef][Medline]
Felsenstein, J. (1981) Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17, 368376.[CrossRef][Medline]
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783791.[CrossRef]
Felsenstein, J. (1993) PHYLIP (phylogeny inference package), Version 3.5c.Seattle: Department of Genetics. University of Washington.
Felsenstein, J. (1996) Inferring phylogenies from protein sequences by parsimony, distance, and likelihood methods. Methods Enzymol. 266, 418427.[Medline]
Frohman, M.A., Dush, M.K. & Martin, G.R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA
85, 89989002.
Froy, O., Chang, D.C. & Reppert, S.M. (2002) Redox potential: differential roles in dCRY and mCRY1 functions. Curr. Biol. 12, 147152.[CrossRef][Medline]
Galagan, J.E., Calvo, S.E., Borkovich, K.A., et al. (2003) The genome sequence of the filamentous fungus Neurospora crassa. Nature 422, 859868.[CrossRef][Medline]
Gardner, M.J., Hall, N., Fung, E., et al. (2002) Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498511.[CrossRef][Medline]
Griffin, E.A.
Jr,
Staknis, D. & Weitz, C.J. (1999) Light-independent role of CRY1 and CRY2 in the mammalian circadian clock. Science
286, 768771.
Hirayama, J., Fukuda, I., Ishikawa, T., Kobayashi, Y. & Todo, T. (2003) New role of zCRY and zPER2 as regulators of sub-cellular distributions of zCLOCK and zBMAL proteins. Nucleic Acids Res.
31, 935943.
Hitomi, K., Kim, S.T., Iwai, S., et al. (1997) Binding and catalytic properties of Xenopus (64) photolyase. J. Biol. Chem.
272, 3259132598.
Hitomi, K., Okamoto, K., Daiyasu, H., et al. (2000) Bacterial cryptochrome and photolyase: characterization of two photolyase-like genes of Synechocystis sp. PCC6803. Nucleic Acids Res.
28, 23532362.
Ishikawa, T., Hirayama, J., Kobayashi, Y. & Todo, T. (2002) Zebrafish CRY represses transcription mediated by CLOCK-BMAL heterodimer without inhibiting its binding to DNA. Genes Cells 7, 10731086.[Abstract]
Johnson, J.L., Hamm-Alvarez, S., Payne, G., Sancar, G.B., Rajagopalan, K.V. & Sancar, A. (1988) Identification of the second chromophore of Escherichia coli and yeast DNA photolyases as 5,10-methenyltetrahydrofolate. Proc. Natl. Acad. Sci. USA
85, 20462050.
Jones, D.T., Taylor, W.R. & Thornton, J.M. (1992) The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275282.
Kanai, S., Kikuno, R., Toh, H., Ryo, H. & Todo, T. (1997) Molecular evolution of the photolyase-blue-light photoreceptor family. J. Mol. Evol. 45, 535548.[CrossRef][Medline]
Kato, T.
Jr,
Todo, T., Ayaki, H., et al. (1994) Cloning of a marsupial DNA photolyase gene and the lack of related nucleotide sequences in placental mammals. Nucl. Acids Res.
22, 41194124.
Kleine, T., Lockhart, P. & Batschauer, A. (2003) An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles. Plant J. 35, 93103.[CrossRef][Medline]
Kobayashi, Y., Ishikawa, T., Hirayama, J., et al. (2000) Molecular analysis of zebrafish photolyase/cryptochrome family: two types of cryptochromes present in zebrafish. Genes Cells 5, 725738.[Abstract]
Komori, H., Masui, R., Kuramitsu, S., et al. (2001) Crystal structure of thermostable DNA photolyase: pyrimidine-dimer recognition mechanism. Proc. Natl. Acad. Sci. USA
98, 1356013565.
Kume, K., Zylka, M.J., Sriram, S., et al. (1999) mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell 98, 193205.[CrossRef][Medline]
Lee, K., Dunlap, J.C. & Loros, J.J. (2003) Roles for WHITE COLLAR-1 in circadian and general photoperception in Neurospora crassa. Genetics
163, 103114.
Li, Y.F. & Sancar, A. (1990) Active site of Escherichia coli DNA photolyase: mutations at Trp277 alter the selectivity of the enzyme without affecting the quantum yield of photorepair. Biochemistry 29, 56985706.[CrossRef][Medline]
Loros, J.J. & Dunlap, J.C. (2001) Genetic and molecular analysis of circadian rhythms in Neurospora. Annu. Rev. Physiol. 63, 757794.[CrossRef][Medline]
Martin, W., Rujan, T., Richly, E., et al. (2002) Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl. Acad. Sci. USA
99, 1224612251.
Miki, K., Tamada, T., Nishida, H., et al. (1993) Crystallization and preliminary X-ray diffraction studies of photolyase (photoreactivating enzyme) from the cyanobacterium Anacystis nidulans. J. Mol. Biol. 233, 167169.[CrossRef][Medline]
Murzin, A.G., Brenner, S.E., Hubbard, T. & Chothia, C. (1995) SCOP: a structural classification of proteins database for the investigation of sequences and structures. J. Mol. Biol. 247, 536540.[CrossRef][Medline]
Page, R.D. (1996) TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357358.
Park, H.W., Kim, S.T., Sancar, A. & Deisenhofer, J. (1995) Crystal structure of DNA photolyase from Escherichia coli. Science
268, 18661872.
Rachael, A., Simon, B., Karen, B., et al. (1998) Genome sequence of the nematode C. elegans: a platform for investigating biology. Science
282, 20122018.
Rosato, E., Codd, V., Mazzotta, G., et al. (2001) Lightdependent interaction between Drosophila CRY and the clock protein PER mediated by the carboxy terminus of CRY. Curr. Biol. 11, 909917.[CrossRef][Medline]
Saitou, N. & Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406425.
Sancar, A. (1994) Structure and function of DNA photolyase. Biochemistry 33, 29.[CrossRef][Medline]
Sancar, G.B. (1990) DNA photolyases: physical properties, action mechanism, and roles in dark repair. Mutat. Res. 236, 147160.[Medline]
Taylor, W.R. & Orengo, C.A. (1989) Protein structure alignment. J. Mol. Biol. 208, 122.[CrossRef][Medline]
Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res.
22, 46734680.
Todo, T. (1999) Functional diversity of the DNA photolyase/blue light receptor family. Mutat. Res. 434, 8997.[Medline]
Todo, T., Kim, S.T., Hitomi, K., et al. (1997) Flavin adenine dinucleotide as a chromophore of the Xenopus (64) photolyase. Nucl. Acids Res.
25, 764768.
Todo, T., Ryo, H., Takemori, H., et al. (1994) High-level expression of the photorepair gene in Drosophila ovary and its evolutionary implications. Mutat. Res. 315, 213228.[Medline]
Todo, T., Ryo, H., Yamamoto, K., et al. (1996) Similarity among the Drosophila (64) photolyase, a human photolyase homolog, and the DNA photolyase-blue-light photoreceptor family. Science 272, 109112.[Abstract]
Todo, T., Takemori, H., Ryo, H., et al. (1993) A new photoreactivating enzyme that specifically repairs ultraviolet light-induced (64) photoproducts. Nature 361, 371374.[CrossRef][Medline]
Toh, H. (1997) Introduction of a distance cut-off into structural alignment by the double dynamic programming algorithm. Comput. Appl. Biosci.
13, 387396.
Van Gelder, R.N., Herzog, E.D., Schwartz, W.J. & Taghert, P.H. (2003) Circadian rhythms: in the loop at last. Science
300, 15341535.
Worthington, E.N., Kavakli, I.H., Berrocal-Tito, G., Bondo, B.E. & Sancar, A. (2003) Purification and characterization of three members of the photolyase/cryptochrome family blue-light photoreceptors from Vibrio cholerae. J. Biol. Chem.
278, 3914339154.
Yasui, A., Eker, A.P., Yasuhira, S., et al. (1994) A new class of DNA photolyases present in various organisms including aplacental mammals. EMBO J. 13, 61436151.[Medline]
Received: 15 January 2004
Accepted: 26 February 2004
This article has been cited by other articles:
![]() |
M. Liedvogel and H. Mouritsen Cryptochromes--a potential magnetoreceptor: what do we know and what do we want to know? J R Soc Interface, April 6, 2010; 7(Suppl_2): S147 - S162. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Phillips, P. E. Jorge, and R. Muheim Light-dependent magnetic compass orientation in amphibians and insects: candidate receptors and candidate molecular mechanisms J R Soc Interface, April 6, 2010; 7(Suppl_2): S241 - S256. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moldt, R. Pokorny, C. Orth, U. Linne, Y. Geisselbrecht, M. A. Marahiel, L.-O. Essen, and A. Batschauer Photoreduction of the Folate Cofactor in Members of the Photolyase Family J. Biol. Chem., August 7, 2009; 284(32): 21670 - 21683. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pokorny, T. Klar, U. Hennecke, T. Carell, A. Batschauer, and L.-O. Essen Recognition and repair of UV lesions in loop structures of duplex DNA by DASH-type cryptochrome PNAS, December 30, 2008; 105(52): 21023 - 21027. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bayram, C. Biesemann, S. Krappmann, P. Galland, and G. H. Braus More Than a Repair Enzyme: Aspergillus nidulans Photolyase-like CryA Is a Regulator of Sexual Development Mol. Biol. Cell, August 1, 2008; 19(8): 3254 - 3262. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Ruiz-Roldan, V. Garre, J. Guarro, M. Marine, and M. I. G. Roncero Role of the White Collar 1 Photoreceptor in Carotenogenesis, UV Resistance, Hydrophobicity, and Virulence of Fusarium oxysporum Eukaryot. Cell, July 1, 2008; 7(7): 1227 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Levy, L. Appelbaum, W. Leggat, Y. Gothlif, D. C. Hayward, D. J. Miller, and O. Hoegh-Guldberg Light-Responsive Cryptochromes from a Simple Multicellular Animal, the Coral Acropora millepora Science, October 19, 2007; 318(5849): 467 - 470. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Berrocal-Tito, E. U. Esquivel-Naranjo, B. A. Horwitz, and A. Herrera-Estrella Trichoderma atroviride PHR1, a Fungal Photolyase Responsible for DNA Repair, Autoregulates Its Own Photoinduction Eukaryot. Cell, September 1, 2007; 6(9): 1682 - 1692. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Immeln, R. Schlesinger, J. Heberle, and T. Kottke Blue Light Induces Radical Formation and Autophosphorylation in the Light-sensitive Domain of Chlamydomonas Cryptochrome J. Biol. Chem., July 27, 2007; 282(30): 21720 - 21728. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Hendrischk, S. Braatsch, J. Glaeser, and G. Klug The phrA gene of Rhodobacter sphaeroides encodes a photolyase and is regulated by singlet oxygen and peroxide in a {sigma}E-dependent manner Microbiology, June 1, 2007; 153(6): 1842 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Banerjee, E. Schleicher, S. Meier, R. M. Viana, R. Pokorny, M. Ahmad, R. Bittl, and A. Batschauer The Signaling State of Arabidopsis Cryptochrome 2 Contains Flavin Semiquinone J. Biol. Chem., May 18, 2007; 282(20): 14916 - 14922. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Selby and A. Sancar A cryptochrome/photolyase class of enzymes with single-stranded DNA-specific photolyase activity PNAS, November 21, 2006; 103(47): 17696 - 17700. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang, R. Baxter, B. S. Smith, C. L. Partch, C. L. Colbert, and J. Deisenhofer Crystal structure of cryptochrome 3 from Arabidopsis thaliana and its implications for photolyase activity PNAS, November 21, 2006; 103(47): 17701 - 17706. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Rubin, Y. Shemesh, M. Cohen, S. Elgavish, H. M. Robertson, and G. Bloch Molecular and phylogenetic analyses reveal mammalian-like clockwork in the honey bee (Apis mellifera) and shed new light on the molecular evolution of the circadian clock Genome Res., November 1, 2006; 16(11): 1352 - 1365. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hirose, T. Shinomura, T. Tanabata, H. Shimada, and M. Takano Involvement of Rice Cryptochromes in De-etiolation Responses and Flowering Plant Cell Physiol., July 1, 2006; 47(7): 915 - 925. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hirayama, L. Cardone, M. Doi, and P. Sassone-Corsi Common pathways in circadian and cell cycle clocks: Light-dependent activation of Fos/AP-1 in zebrafish controls CRY-1a and WEE-1 PNAS, July 19, 2005; 102(29): 10194 - 10199. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |