| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Molecular Biology, Kyushu University Graduate School of Pharmaceutical Sciences, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Experiments using synchronized cell cultures indicate that the ATP-DnaA level fluctuates in a replication cycle-coordinated manner with a peak around the time for replicational initiation (Kurokawa et al. 1999; Katayama et al. 2001). Decrease of the ATP-DnaA level from the peak to the basal level by RIDA takes about 20 min at 30 °C. Inasmuch as hemimethylated oriC DNA is formed immediately after duplication of oriC, sequestration can inhibit re-initiation at oriC while the ATP-DnaA level is still decreasing. The datA locus also may play such a complementary role. In rapidly growing cells, the datA sequence is required to be located at a site near oriC to prevent extra-initiations, which probably means that the ATP-DnaA molecules are required to be absorbed at the duplicated datA loci within a certain time after initiation (Kitagawa et al. 1998; Katayama 2001).
In the initiation complex formed by ATP-DnaA and oriC DNA, a part of the AT-rich 13-mer repeat region within oriC is unwound (Sekimizu et al. 1987; Speck & Messer 2001). DnaB helicase is loaded on to this single-stranded region with the aid of the DnaC helicase-loader protein (Kornberg & Baker 1992; Messer & Weigel 1996). After expansion of the single-stranded region mediated by DnaB, DnaG primase is recruited through its interaction with DnaB helicase and begins to synthesize primer RNA. PolIII HE is then loaded on to the primed single-stranded DNA (ssDNA) and commences synthesis of a complementary strand (Kelman & O’Donnell 1995; Baker & Bell 1998).
The ß clamp subunit of PolIII HE promotes highly processive replication (Kelman & O’Donnell 1995; Baker & Bell 1998). This subunit, which is encoded by the dnaN gene, forms a homodimer that adopts a ring-like configuration. The ß clamp is loaded on to primer RNA–ssDNA heteroduplexes by interaction with another subassembly of PolIII HE, the 
(DnaX) complex clamp loader (Onrust et al. 1995; Naktinis et al. 1996; Pritchard et al. 2000; Jeruzalmi et al. 2001). The interface between the two monomers of the ß clamp is opened by the complex, allowing the ß clamp to encircle the heteroduplex (Hingorani & O’Donnell 1998). After the complex is released from the loaded ß clamp, the PolIII core, a subassembly with nucleotide-polymerizing activity, binds to the ß clamp and starts processive synthesis of complementary DNA strands. PolIII* is a subassembly of PolIII HE that includes the complex and core, but not the ß clamp.
The RIDA system promotes in vivo DnaA-ATP hydrolysis in a replication-dependent manner (Kurokawa et al. 1999). In dnaB, dnaC, dnaG, dnaN and dnaX temperature sensitive mutants, the level of ATP-DnaA increases at the restrictive temperature of 42 °C. Thus, RIDA in vivo requires progressing replisomes that continuously load ß clamps on to DNA. ß clamps that temporarily remained on DNA after DNA synthesis are released from DNA by the action of the 
subunit, a member of the complex (Leu et al. 2000). Introduction of multicopy plasmids such as pBR322 and pUC19 to cells does not affect the ATP-DnaA level in vivo (Kurokawa et al. 1999; K. Fujimitsu & T. Katayama, unpublished observation). As replication forks proceed at a rate of about one thousand bases per second (Kornberg & Baker 1992), replication of each plasmid will be completed in only a few seconds. In reconstituted in vitro RIDA systems that include a plasmid template, we found that DnaA-ATP hydrolysis in the presence of the Hda (IdaB) protein requires the loaded sliding clamp (Katayama et al. 1998; Su’etsugu et al. 2001). These results suggest that the elongation phase of replication is required for RIDA. Based on these findings, we further investigated the template structures that are involved in the DNA replication dependence of RIDA. We used reconstituted RIDA systems that consisted of purified replication proteins and replicational intermediates produced in in vitro replication systems. The findings described here suggest that duplex DNA (dsDNA) in cis to the loaded ß clamp plays an essential role in promoting RIDA. We also show that Hda is a stable ligand for the ß clamp.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
During DNA replication, ß clamps are first loaded on to primer RNA-ssDNA heteroduplexes (primed ssDNA), and they then slide on to duplex DNA generated by the PolIII HE elongation reaction (Kelman & O’Donnell 1995; Baker & Bell 1998). To elucidate the details of the RIDA mechanism, we analysed the structural requirements for DnaA-ATP hydrolysis by using various replication intermediates.
First, we tested replication intermediates generated in a minichromosomal replication system reconstituted with purified proteins (Table 1). Using this system, a supercoiled minichromosome, M13E10 (Nozaki et al. 1988) was incubated for 15 min at 30 °C in the presence or absence of all four dNTPs. In the absence of dNTPs, primed templates are produced (van der Ende et al. 1985). In the presence of dNTPs, this reconstitution system yields theta (
) form and rolling circle (RC) form replication intermediates (Funnel et al. 1987; Higuchi et al. 2003). The presence of these forms was confirmed by polyacrylamide gel electrophoresis (data not shown). These intermediates were then deproteinized to be used in assays of RIDA activity.
|
and RC form replication intermediates were incubated with PolIII*, the ß clamp and Hda (Table 1, Exp. 3 and 4). The ß clamp can be efficiently loaded on these intermediates because they contain ds-ssDNA junctions as well as primed ssDNA (Stukenberg et al. 1991; Yao et al. 2000). RIDA activity of circular ssDNA replication intermediates in vitro
Next, we assessed simpler replication intermediates that were generated in a G4 phage-ssDNA replication system reconstituted with the DnaG primase and single-stranded DNA binding protein (SSB) (Rowen & Kornberg 1978; Stayton & Kornberg 1983; Kornberg & Baker 1992; Sun & Godson 1993). In this circular ssDNA replication system, DnaG is first loaded on to the G4ori site in an SSB-dependent manner and primer RNA is synthesized. Then, PolIII HE synthesizes the complementary strand, yielding replicative form DNA, nicked or gapped dsDNA circle. Hereafter we refer to the replicative form DNA as gapped dsDNA. For these experiments, we prepared both gapped dsDNA and primed ssDNA (which was obtained in the absence of PolIII HE and dNTPs). Synthesis of primed ssDNA was confirmed by the ability of PolIII HE to direct DNA synthesis on this template in the absence of DnaG (data not shown). Using template ssDNA and these two replication intermediates, we analysed RIDA activity in the presence or absence of replicative proteins, Hda, and dNTPs (Table 2).
|
Regardless of whether dNTPs are present, the ß clamp can be loaded at the 3'-end of the ds-ss junction in the primed ssDNA or gapped dsDNA (Stukenberg et al. 1991; Yao et al. 2000). These results thus imply at least two possibilities that are not mutually exclusive. The first is that ß clamps loaded on primer RNA-ssDNA heteroduplexes are inert with respect to the RIDA reaction, unlike those loaded on replication intermediates containing an elongated DNA chain. The second is that the number of ß clamps loaded on to primer RNA-DNA heteroduplexes is smaller than that loaded on the intermediates with an elongated DNA chain, which results in a difference in the activity of RIDA.
RIDA activity of the ß clamp loaded on primed ssDNA and gapped dsDNA circles
To quantitatively assess the RIDA activity of the ß clamp loaded on to primer RNA-ssDNA heteroduplexes, we used the general priming system, which promotes formation of primer RNAs by a DnaB-DnaG complex on G4 ssDNA in the absence of SSB (Arai & Kornberg 1979; Kornberg & Baker 1992). In this system, many primers of 10–60 nucleotides in length are synthesized on a single ssDNA circle by a mobile DnaB-DnaG complex (Arai & Kornberg 1979). After we confirmed primer RNA synthesis by a filter retention assay to detect labelled ribonucleotides (Fig. 1A) and by denaturing polyacrylamide gel electrophoresis (data not shown), ß clamps were loaded on to the resulting multiprimed ssDNA, and on to gapped dsDNA, in the presence of the PolIII complex.
|
The hydrolysis of DnaA-ATP was assessed in the presence or absence of tagged Hda (Hda*) for these ß-loaded DNA circles (Fig. 1C). Unlike gapped dsDNA, primed ssDNA was totally inert with respect to RIDA activity when about 20–150 fmol of DNA-loaded ß clamps were present. Comparable results were obtained when Hda FrV instead of Hda* was used (Table 3). Hda FrV was used to eliminate a possibility that the polypeptide-tags used for Hda* affected the observed specificity. Also, similar results were obtained when PolIII* was used instead of the complex as the clamp loader (data not shown). These results suggest that the presence of duplex DNA flanking loaded ß clamps is required for RIDA.
|
To further assess the structural requirements for RIDA, we determined whether the addition in trans of dsDNA could activate DnaA-ATP hydrolysis in the presence of ß clamp-loaded primed ssDNA (Fig. 2). As described for the above experiments, ß clamps were loaded on to multiprimed ssDNA and gapped dsDNA circles using the complex, and the number of loaded ß clamps was determined. Gapped dsDNA free of ß clamps was added to reactions containing or lacking ß clamp-loaded DNAs, and Hda-dependent DnaA-ATP hydrolysis was measured. In reactions containing ß clamp-loaded primed ssDNA, gapped dsDNA provided in trans did not stimulate hydrolysis (Fig. 2). Significant levels of DnaA-ATP hydrolysis were seen only when ß clamp-loaded gapped dsDNA was present, and hydrolysis was not inhibited by the addition of ß clamp-free gapped dsDNA. When ß clamp-free dsDNA alone was present, a slight increase in hydrolysis was seen, which can be presumably attributed to a weak intrinsic DNA-dependent ATPase activity of DnaA (Sekimizu et al. 1987). Taking the above data together, we conclude that dsDNA present in cis to the loaded ß clamp is a structural prerequisite for the RIDA reaction.
|
Effects of a DnaA box-bearing oligonucleotide
To further investigate the possibility that dsDNA-binding activity of DnaA is required for RIDA, we next asked whether ATP-DnaA tightly bound to a specific 9-mer sequence called the DnaA box (Kornberg & Baker 1992; Messer & Weigel 1996; Fujikawa et al. 2003) could be inactivated in the presence in trans of ß-loaded dsDNA. When ATP-DnaA was added to buffer containing ß-loaded dsDNA, Hda and a dsDNA containing the DnaA box, DnaA-ATP hydrolysis was significantly inhibited in a DnaA box-dependent manner (Fig. 3). Previously, we showed that this 15-mer dsDNA bearing a DnaA box, but not 15-mer dsDNA without a DnaA box, was able to bind DnaA efficiently (Obita et al. 2002). These results coincide with the idea that binding of DnaA to the ß clamp-loaded dsDNA is included in the process of RIDA.
|
To investigate the dsDNA region effective for RIDA activity, we used G4ori-ssDNA hybridized with various lengths of oligonucleotides (Table 4). As the ß clamp spans about 10 bp when loaded on dsDNA (Kong et al. 1992; Yao et al. 2000), 14-mer or longer oligonucleotides were hybridized with G4 ssDNA, and were incubated in reaction containing ATP-DnaA, Hda*, ß clamp, and the clamp-loader complex. Results indicated that 40-mer dsDNA was long enough to be competent for RIDA (Table 4). 29-mer DNA-DNA hybrid region exhibited a partial activity, and the same size of RNA-DNA hybrid did further less activity. When chemically synthesized RNA was commercially obtained, 29-mer RNA was the longest size.
|
|
We carried out immunoprecipitation experiments to determine whether Hda forms a stable complex with the ß clamp (Fig. 5). The Hda* protein carries MBP- and myc-6xHis-tags at the N- and C-terminal ends of the protein, respectively (Kato & Katayama 2001). As a control, we constructed an Hda* derivative that lacks the entire Hda region, termed 
(Hda)* (see Experimental procedures) (Fig. 5A). Under the conditions where Hda* and Hda FrV promoted DnaA-ATP hydrolysis, respectively, (Hda)* did not (data not shown). Hda* and (Hda)* were then included in reactions containing the ß clamp and afterwards recovered using anti-myc antibody-conjugated agarose beads. The ß clamp was co-immunoprecipitated in an Hda-dependent manner (Fig. 5B), suggesting that Hda directly and specifically binds to the ß clamp.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
In this study, we showed evidence concerning the DNA structures that link DNA chain elongation to the RIDA reaction. During chromosomal replication, ß clamps are first loaded on to ssDNA generated from duplex DNA that has been unwound by DnaB helicase and primed with RNA by DnaG primase. As we have shown here, this ß clamp-loaded primed ssDNA form is premature for the RIDA reaction. The next step, elongation of the DNA chain, creates a structure that allows the loaded ß clamp to functionally interact with Hda and ATP-DnaA, thereby permitting the RIDA reaction (Figs 1 and 2). These findings provide a basis for the further elucidation of the molecular mechanism of RIDA. ß clamps loaded on the lagging strand can remain on replicated DNA duplex (Stukenberg et al. 1994), which may allow RIDA to function in vivo. In this case, ß clamps are associated with dsDNA in cis to promote RIDA reaction.
We suggest that the mechanical significance of the requirement for dsDNA present in cis to the ß clamp that it plays a role in supporting complex formation among the ß clamp, Hda and DnaA (Fig. 6). Although Hda can form a stable complex with the ß clamp (Fig. 5), DnaA has not been found to stably bind Hda, the ß clamp or the DNA-free Hda-ß clamp complex (M. Su’etsugu & T. Katayama, unpublished observation). Unlike Hda, the DnaA protein has a DNA-binding domain (domain IV) and can interact with DNA in a sequence-specific and even nonspecific manner (Fuller et al. 1984; Sekimizu et al. 1987; Roth & Messer 1995; Weigel et al. 1997; Fujikawa et al. 2003). The sequence-independent interaction of DnaA with DNA stimulates its intrinsic ATPase activity, which implies that this interaction induces conformational changes in the protein (Sekimizu et al. 1987). Thus, dsDNA flanking the ß clamp may play a role in promoting RIDA by tethering DnaA and by causing it to adopt a conformation conducive to ATP hydrolysis and to interaction with the ß clamp-Hda complex (Fig. 6). As shown in Table 4 and Fig. 4, at least 40-mer dsDNA region can promote the RIDA reaction. In experiments shown in Fig. 4 and 60-mer dsDNA region was more effective. In experiments shown in Table 4, difference in RIDA activity between 40-mer and 60-mer dsDNA regions was not observed; the DnaA-ATP hydrolysis reached almost saturated levels even when 40-mer dsDNA was supplied under the conditions used. RNA-primed ssDNA was practically inert or inefficient in the DnaA-ATP hydrolysis (Figs 1 and 4; Table 4). RNA-DNA heteroduplexes bearing a DnaA box sequence bear no activity for DnaA-binding (Parada & Marians 1991; Schaper & Messer 1995). DnaA and Hda are members of the AAA+ protein superfamily, which includes chaperone-like ATPases (Neuwald et al. 1999; Kato & Katayama 2001). As is known for other proteins in this family (Neuwald et al. 1999; Ogura & Wilkinson 2001), DnaA-ATP hydrolysis may be stimulated by association of the AAA+ domains of DnaA and Hda (Nishida et al. 2002) (Fig. 6).
|
Furthermore, we demonstrated for the first time that Hda directly binds to the ß clamp (Fig. 5). As overproduction of intact Hda is extremely detrimental to host cells, peptide-tags of Hda* were initially necessary for the overproduction of Hda (Kato & Katayama 2001). However, we recently established a novel system to overproduce and purify Hda protein without these tags (M. Su’etsugu & T. Katayama, unpublished observation). During the preparation of this paper, a report indicating that ß clamp-binding proteins share a consensus sequence motif was published (Dalrymple et al. 2001). We found that the N-terminal region of Hda contains a sequence similar to this motif and that mutant Hda proteins with amino acid substitutions here are incapable of binding to the ß clamp (M. Su’etsugu, T. Shimuta & T. Katayama, unpublished observation).
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Minichromosome M13E10 was incubated in a replication system reconstituted with purified proteins as previously described (van der Ende et al. 1985; Katayama et al. 1998; Kato & Katayama 2001). M13E10 was a gift from T. Ogawa (Nozaki et al. 1988). Gapped dsDNA and specifically primed ssDNA synthesis using the phage G4 ori was performed by a modified method of Rowen & Kornberg (1978). Typically, gapped dsDNA was synthesized using as a template f1R199/G4oric ssDNA circle, a phage G4 ori-containing viral DNA strand (Sakai & Godson 1985). Reactions were performed at 30 °C for 20 min and consisted of f1R199/G4oric ssDNA (8 µg), SSB (20 µg), DnaG (2.9 µg), PolIII* (32.6 µg), and PolIII ß subunit (6.4 µg) in buffer (2 mL) containing 20 mM Tris-HCl (pH 7.5), 8 mM dithiothreitol, 0.08 mg/mL bovine serum albumin, 4% (w/v) sucrose, 10 mM MgCl2, 2 mM ATP, 0.1 mM GTP, 0.1 mM CTP, 0.1 mM UTP, and 0.2 mM dNTPs (dATP, dGTP, dCTP, and dTTP). For synthesis of specifically primed ssDNA, the same reaction was performed in the absence of PolIII*, the ß subunit, and dNTPs. Multiprimed ssDNA was synthesized by a modification of the general priming system method (Arai & Kornberg 1979). Typically, f1R199/G4oric ssDNA (8 µg) was incubated for 30 min at 30 °C in the presence of DnaB (11.6 µg) and DnaG primase (2.9 µg) in the same buffer (1 mL) described above, except without dNTPs and containing 0.8 mM ATP, 0.05 mM of GTP, UTP, and CTP, 8 mM MgCl2, 0.04 mg/mL bovine serum albumin. The reaction was monitored by the incorporation of [3H] UTP (161 cpm/pmol) by a filter retention assay using DEAE-cellulose paper (Whatman DE81) (Arai & Kornberg 1979). Products or intermediates were purified by phenol/chloroform extraction and ethanol precipitation. For purification of minichromosome and gapped ssDNA replication intermediates, dNTPs were removed using a Sephacryl S-400 HR spin column. For the assay of RIDA activity, purified DNAs were incubated in buffer containing 24 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 8 mM magnesium acetate, 125 mM potassium glutamate, 0.01% (w/v) Brij-58, 0.1 mg/mL bovine serum albumin, 5.4% glycerol and the indicated proteins.
Quantification of the number of DNA-loaded ß clamps
PolIII ß subunit (4 µg) was incubated for 20 min at 30 °C in buffer PB (20 mM Tris-HCl [pH 7.5], 10% glycerol, 8 mM dithiothreitol, 0.01% Brij-58, 8 mM magnesium acetate, 20 mM potassium glutamate and 0.5 mM ATP) in the presence of complex (53 fmol) and the gapped dsDNA (200 ng, 45 fmol as circle) or in the presence of complex (132 fmol) and the multiprimed ssDNA (100 ng, 45 fmol as circle). These reaction products were then applied on to a Sephacryl S-400 HR spin column (0.63 mL) equilibrated with the same buffer except the absence of ATP (Katayama et al. 1998; Su’etsugu et al. 2001). Void fractions (46 µL) were isolated by a brief centrifugation (3000 g, 3 min) at 4 °C. Proteins from half of this fraction were precipitated in 10% trichloroacetic acid and detected by SDS-polyacrylamide (12%) gel electrophoresis and silver staining. The intensities of bands corresponding to the ß clamp were quantified by comparison with a standard using a densitometer. DNA in the void fraction was quantified in comparison with DNA standards by fluorescence staining with Gel Star (BioWhittaker Molecular Applications).
RIDA reaction using the isolated DNA-loaded ß clamps
[
-32P]ATP-bound DnaA (0.5 pmol) was prepared as previously described (Sekimizu et al. 1987) and incubated for 20 min at 30 °C in buffer PB (25 µL) with 2 mM ATP and 0.1 mg/mL bovine serum albumin in the presence of Hda* (825 ng; 11.3 pmol) and the indicated amount of ß clamps loaded DNA that had been isolated by gel filtration as described above. DnaA protein was retained on a nitrocellulose filter as previously described (Sekimizu et al. 1987), nucleotides bound to this protein were extracted in 1 M HCOOH (20 µL) and a portion (0.5 µL) was used for PEI thin-layer chromatography (Katayama et al. 1998). In this assay, detection of nucleotides depends on DnaA.
DnaA box-bearing DNA and RIDA reaction
The sequence of a 15-mer DNA oligonucleotide bearing the DnaA box R1 motif is TTGTTATCCACAGGG (the DnaA box is underlined) (Schaper & Messer 1995; Obita et al. 2002). This strand was annealed with the complementary strand to create a dsDNA. A nonspecific 15-mer dsDNA contained the sequence AACTATATC instead of the DnaA box motif (Schaper & Messer 1995; Obita et al. 2002). The indicated amounts of these DNAs were added to buffer PB containing 2 mM ATP, 0.1 mg/mL bovine serum albumin, 100 mM potassium glutamate, ß clamp-loaded G4 dsDNA (0.77 fmol as DNA circle, including 30 fmol ß dimer) and either Hda* (3.3 µg; 45.2 pmol) or Hda FrV (1 µg). [-32P]ATP-DnaA (0.5 pmol) was then added and the reaction was further incubated for 20 min at 30 °C.
RIDA reaction using oligonucleotide-hybridized ssDNA
Oligonucleotides (300 pmol) were added to buffer (20 µL) containing 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA and f1R199/G4oric ssDNA circle (30 pmol). For hybridization, these mixtures were incubated at 80 °C for 30 min, and the temperature was gradually decreased to 40 °C taking 1 h. Sequence of oligonucleotides were as follows: 14-mer DNA, AGTAGGGACGGCGG; 29-mer DNA, AGTAGGGACGGCGGCTTTCGCCGTCCATG; 29-mer RNA, AGUAGGGACGGCGGCUUUCGCCGUCCAUG; 40-mer DNA, AGTAGGGACGGCGGCTTTCGCCGTCCATGTATCGGAGACT; and 60-mer DNA, AGTAGGGACGGCGGCTTTCGCCGTCCATGTATCGGAGACTCGAGTATCTCCGTAGGCACG.
When RIDA reaction was promoted in a manner coupled with the clamp-loading reaction, oligonucleotide-hybridized G4 ssDNA (100 fmol as circle), [-32P] ATP-DnaA (0.25 pmol) and Hda* (3.3 µg; 45.2 pmol) were incubated for 20 min at 30 °C in buffer PB (12.5 µL) with 2 mM ATP, 0.1 mg/mL bovine serum albumin and 150 mM potassium glutamate in the presence or absence of DNA-free ß clamps (3.1 pmol as dimer) and complex (33 fmol). When ß clamp loaded on oligonucleotide-hybridized G4 ssDNA was isolated and RIDA activity was assessed, the same buffers as those described above were used except that 0.5 mM ATP was contained and bovine serum albumin was excluded for clamp-loading.
Purification of His-Hda protein
Histidine-tagged Hda protein (His-Hda) was overproduced in strain KA450 [oriC1071::Tn10 dnaA17 (Am) rnhA199 (Am)] (Nishida et al. 2002) carrying a pBAD/HisB (Invitrogen)-derivative plasmid that bears the N-terminally His-tagged hda gene. Purification was done accordingly to a standard method that is described by the manufacturer. Briefly, lysates were prepared from arabinose-induced cells by a freeze-thaw method in buffer containing 50 mM Na2HPO4 (pH 7.4), 500 mM NaCl, 0.1% Triton X-100, 10% glycerol, 10 mMß-mercaptoethanol, 10 mM imidazole, and 0.3 mg/mL lysozyme. Supernatants were then prepared by centrifugation, and were loaded on a Ni-NTA agarose column (QIAGEN) equilibrated with the same buffer except for lysozyme. His-Hda was eluted with 300 mM imidazole. Purity of His-Hda was > 90% as judged by SDS-polyacrylamide gel electrophoresis and Coomassie Brilliant Blue staining. Specific activity of His-Hda for RIDA was comparable to that of native Hda protein (M. Su’etsugu & T. Katayama, unpublished observation).
Overproduction and purification of the Hda* and (Hda)* proteins
Hda* (ca. 73 kD) was overproduced from a pMal-c plasmid derivative and purified as previously described (Kato & Katayama 2001). The Hda* protein carries the MBP- and myc-6xHis peptide-tags to the N- and C-terminals, respectively, of Hda. Deletion of a KpnI fragment from the overproducing plasmid eliminates the entire Hda region and preserves these tags. This resulting plasmid encodes (Hda)* (ca. 43 kD), which was overproduced and purified using an amylose-affinity resin (New England Biolab) as previously described for the purification of Hda* (Kato & Katayama 2001).
Immunoprecipitaion of Hda*
The ß clamp (36 pmol as ß dimer) was incubated in the presence of Hda* or (Hda)* 100 pmol as monomer for 30 min on ice in buffer (75 µL) containing 20 mM Tris-HCl (pH 7.5), 8 mM dithiothreitol, 0.01% Brij58, 8 mM magnesium acetate and 2 mM ATP. The reaction was further incubated for 30 min on ice after the addition of mouse anti-myc tag-monoclonal antibody (Invitrogen) (3 µL of 1 mg/mL). Proteins were diluted by adding buffer LA’ (625 µL) containing 50 mM HEPES-KOH (pH 7.6), 30 mM ammonium sulphate, 5 mM magnesium acetate, 1 mM EDTA, 0.005% Triton X-100, 5 mg/mL lysozyme, 0.1 mM ATP and 0.1 mM ADP, and the mixture was further incubated for 30 min at 4 °C with gentle rotation in the presence of Protein A-Sepharose (Amersham) (50 µL of 50% slurry) equilibrated with buffer M (50 mM HEPES-KOH [pH 7.6], 100 mM NaCl, 30 mM ammonium sulphate, 5 mM magnesium acetate, 1 mM EDTA, 0.005% Triton X-100, 0.1 mM ATP and 0.1 mM ADP) (Katayama et al. 1998). The suspensions were transferred into new tubes, and proteins were precipitated by a brief centrifugation and half of each was analysed by SDS-polyacrylamide (10%) gel electrophoresis followed by staining with Coomassie Brilliant Blue.
|
Acknowledgements |
|---|
complex. This work was partly supported by research grants from the Takeda Science Foundation, the Japan Society for Promotion of Science (JSPS) and the Ministry of Education, Culture, Sports, Science and Technology. The first three authors were recipients of predoctoral fellowships from JSPS. |
Footnotes |
|---|
Present address: aSumitomo Pharmaceuticals Co., Osaka, Japan;
bDepartment of Pharmacy, Kyushu University Hospital, Fukuoka, Japan.
* Correspondence: E-mail: katayama{at}phar.kyushu-u.ac.jp |
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Baker, T.A. & Bell, S. (1998) Polymerases and the replisome: machines within machines. Cell 92, 295–305.[CrossRef][Medline]
Boye, E., Løbner-Olesen, A. & Skarstad, K. (2000) Limiting DNA replication to once and only once. EMBO Reports 1, 479–483.[CrossRef][Medline]
Brendler, T., Abeles, A. & Austin, S. (1995) A protein that binds to the P1 origin core and the oriC 13mer region in a methylation-specific fashion is the product of the host seqA gene. EMBO J. 14, 4083–4089.[Medline]
Dalrymple, B.P., Kongsuwan, K., Wijffels, G., Dixon, N.E. & Jennings, P.A. (2001) A universal protein–protein interaction motif in the eubacterial DNA replication and repair system. Proc. Natl Acad. Sci. USA 98, 11627–11632.
van der Ende, A., Baker, T.A., Ogawa, T. & Kornberg, A. (1985) Initiation of enzymatic replication at the origin of the Escherichia coli chromosome: primase as the solo priming enzyme. Proc. Natl Acad. Sci. USA 82, 3954–3958.
von Freiesleben, U., Rasmussen, K.V. & Schaechter, M. (1994) SeqA limits DnaA activity in replication from oriCEscherichia coli. Mol. Microbiol. 14, 763–772.[Medline]
Fujikawa, N., Kurumizaka, H., Nureki, O., et al. (2003) Structural basis of replication origin recognition by the DnaA protein. Nucl. Acids Res. 31, 2077–2086.
Fuller, R.S., Funnell, B.E. & Kornberg, A. (1984) The dnaA protein complex with the E. coli chromosomal replication origin (oriC) and other DNA sites. Cell 38, 889–900.[CrossRef][Medline]
Funnell, B.E., Baker, T.A. & Kornberg, A. (1987) In vitro assembly of a prepriming complex at the origin of the Escherichia coli chromosome. J. Biol. Chem. 262, 10327–10334.
Higuchi, K., Katayama, T., Iwai, S., Hidaka, M., Horiuchi, T. & Maki, H. (2003) Fate of DNA replication fork encountering a single DNA lesion during oriC plasmid DNA replication in vitro. Genes Cells 8, 437–449.[Abstract]
Hingorani, M.M. & O'Donnell, M. (1998) ATP binding of the Escherichia coli clamp loader powers opening of the ring-shaped clamp of the DNA polymerase III holoenzyme. J. Biol. Chem. 273, 24550–24563.
Jeruzalmi, D., O'Donnell, M. & Kuriyan, J. (2001) Crystal structure of the processivity clamp loader gamma () complex of E. coli DNA polymerase III. Cell 106, 429–441.[CrossRef][Medline]
Katayama, T. (2001) Feedback controls restrain the initiation of Escherichia coli chromosomal replication. Mol. Microbiol. 41, 9–17.[CrossRef][Medline]
Katayama, T., Fujimitsu, K. & Ogawa, T. (2001) Multiple pathways regulating DnaA function in Escherichia coli: Distinct roles for DnaA titration by the datA locus and the regulatory inactivation of DnaA. Biochimie 83, 13–18.[Medline]
Katayama, T., Kubota, T., Kurokawa, K., Crooke, E. & Sekimizu, K. (1998) The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase. Cell 94, 61–71.[CrossRef][Medline]
Katayama, T. & Sekimizu, K. (1999) Inactivation of Escherichia coli DnaA protein by DNA polymerase III, and negative regulations for initiation of chromosomal replication. Biochimie 81, 835–840.[Medline]
Kato, J. & Katayama, T. (2001) Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli. EMBO J. 20, 4253–4262.[CrossRef][Medline]
Kelman, Z. & O'Donnell, M. (1995) DNA polymerase III holoenzyme: structure and function of a chromosomal replicating machine. Annu. Rev. Biochem. 64, 171–200.[CrossRef][Medline]
Kitagawa, R., Mitsuki, H., Okazaki, T. & Ogawa, T. (1996) A novel DnaA protein-binding site at 94.7 min on the Escherichia coli chromosome. Mol. Microbiol. 19, 1137–1147.[CrossRef][Medline]
Kitagawa, R., Ozaki, T., Moriya, S. & Ogawa, T. (1998) Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein. Genes Dev. 12, 3032–3043.
Kong, X.-P., Onrust, R., O'Donnell, M. & Kuriyan, J. (1992) Three-dimensional structure of the ß subunit of E. coli DNA polymerase III holoenzyme: a sliding clamp. Cell 69, 425–437.[CrossRef][Medline]
Kornberg, A. & Baker, T.A. (1992) DNA Replication, 2nd edn. New York: W.H. Freeman.
Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K. & Katayama, T. (1999) Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli. EMBO J. 18, 6642–6652.[CrossRef][Medline]
Leu, F.P., Hingorani, M.M., Turner, J. & O'Donnell, M. (2000) The subunit of DNA polymerase III holoenzyme serves as a sliding clamp unloader in Escherichia coli. J. Biol. Chem. 275, 34609–34618.
Lu, M., Campbell, J.L., Boye, E. & Kleckner, N. (1994) SeqA: a negative modulator of replication initiation in E. coli. Cell 77, 413–426.[CrossRef][Medline]
Messer, W. (2002) The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev. 26, 355–374.[Medline]
Messer, W. & Weigel, C. (1996) Initiation of chromosome replication. In: Escherichia Coli and Salmonella: Cellular and Molecular Biology, 2nd edn (eds F. C. Neidhardt, R. Curtiss III, et al.), pp. 1579–1601. Washington, DC: ASM Press.
Naktinis, V., Turner, J. & O'Donnell, M. (1996) A molecular switch in a replication machine defined by an internal composition for protein rings. Cell 84, 137–145.[CrossRef][Medline]
Neuwald, A.F., Aravid, L., Spouge, J.L. & Koonin, E.V. (1999) AAA+: a class of chaperon-like ATPases associated with the assembly, operation, and disassembly of protein complexes. Genome Res. 9, 27–43.
Nishida, S., Fujimitsu, K., Sekimizu, K., Ohmura, T., Ueda, T. & Katayama, T. (2002) A nucleotide switch in the Escherichia coli DnaA protein initiates chromosomal replication: Evidence from a mutant DnaA protein defective in regulatory ATP hydrolysis in vitro and in vivo. J. Biol. Chem. 277, 14986–14995.
Nozaki, N., Okazaki, T. & Ogawa, T. (1988) In vitro transcription of the origin of replication of the Escherichia coli chromosome. J. Biol. Chem. 263, 14176–14183.
Obita, T., Iwura, T., Su’etsugu, M., et al. (2002) Determination of the secondary structure in solution of the Escherichia coli DnaA DNA-binding domain. Biochem. Biophys. Res. Commun. 299, 42–48.[CrossRef][Medline]
Ogawa, T., Yamada, Y., Kuroda, T., Kishi, T. & Moriya, S. (2002) The datA locus predominantly contributes to the initiator titration mechanism in the control of replication initiation in Escherichia coli. Mol. Miocrobiol. 44, 1367–1375.[CrossRef][Medline]
Ogura, T. & Wilkinson, A.J. (2001) AAA+ superfamily ATPases: common structure-diverse function. Genes Cells 6, 575–597.[Abstract]
Onrust, R., Finkelstein, J., Natkinis, V., Turner, J., Fang, L. & O'Donnell, M. (1995) Assembly of a chromosomal replication machine: Two DNA polymerases, a clamp loader, and sliding clamp in one holoenzyme particle; I. Organization of the clamp loader. J. Biol. Chem. 270, 13348–13357.
Parada, C.A. & Marians, K.J. (1991) Mechanism of DnaA protein-dependent pBR322 DNA replication: DnaA protein-mediated trans-strand loading of the DnaB protein at the origin of pBR322 DNA. J. Biol. Chem. 266, 18895–18906.
Pritchard, A.E., Dallmann, H.G., Glover, B.P. & McHenry, C.S. (2000) A novel assembly mechanism for the DNA polymerase III holoenzyme DnaX complex; association of ' with DnaX4 forms DnaX3'. EMBO J. 19, 6536–6545.[CrossRef][Medline]
Roth, A. & Messer, W. (1995) The DNA binding domain of the initiator protein DnaA. EMBO J. 14, 2106–2111.[Medline]
Rowen, L. & Kornberg, A. (1978) Primase, the dnaG protein of Escherichia coli: an enzyme which starts DNA chains. J. Biol. Chem. 253, 758–764.
Sakai, H. & Godson, G.N. (1985) Isolation and construction of mutants of the G4 minus strand origin: analysis of their in vivo activity. Biochim. Biophys. Acta 826, 30–37.[Medline]
Schaper, S. & Messer, W. (1995) Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem. 270, 17622–17626.
Sekimizu, K., Bramhill, D. & Kornberg, A. (1987) ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome. Cell 50, 259–265.[CrossRef][Medline]
Slater, S., Wold, S., Lu, M., Boye, E., Skarstad, K. & Kleckner, N. (1995) E. coli SeqA protein binds oriC in two different methyl-modulated reactions appropriate to its roles in DNA replication initiation and origin sequestration. Cell 82, 927–936.[CrossRef][Medline]
Speck, C. & Messer, W. (2001) Mechanism of origin unwinding: sequential binding of DnaA to double- and single-stranded DNA. EMBO J. 20, 1469–1476.[CrossRef][Medline]
Stayton, M.M. & Kornberg, A. (1983) Complexes of Escherichia coli primase with the replication origin of G4 phage DNA. J. Biol. Chem. 258, 13205–13212.
Stukenberg, P.T., Studwell-Vaughan, P.S. & O'Donnell, M. (1991) Mechanism of the sliding ß-clamp of DNA polymerase III holoenzyme. J. Biol. Chem. 266, 11328–11334.
Stukenberg, P.T., Turner, J. & O'Donnell, M. (1994) An explanation for lagging strand replication: polymerase hopping among DNA sliding clamps. Cell 78, 877–887.[CrossRef][Medline]
Su’etsugu, M., Kawakami, H., Kurokawa, K., Kubota, T., Takata, M. & Katayama, T. (2001) DNA replication-coupled inactivation of DnaA protein in vitro: a role for DnaA arginine-334 of the AAA+ Box VIII motif in ATP hydrolysis. Mol. Microbiol. 40, 376–386.[CrossRef][Medline]
Sun, W. & Godson, G.N. (1993) Binding and phasing of Escherichia coli single-stranded DNA-binding protein by the secondary structure of phage G4 origin of complementary DNA strand synthesis (G4oric). J. Biol. Chem. 268, 8026–8039.
Taghbalout, A., Landoulsi, A., Kern, R., et al. (2000) Competition between the replication initiator DnaA and the sequestration factor SeqA for binding to the hemimethylated chromosomal origin of E. coli in vitro. Genes Cells 5, 873–884.[Abstract]
Torheim, N.K. & Skarstad, K. (1999) Escherichia coli SeqA protein affects DNA topology and inhibits open complex formatiom at oriC. EMBO J. 18, 4882–4888.[CrossRef][Medline]
Weigel, C., Schmidt, A., Rückert, B., Lurz, R. & Messer, W. (1997) DnaA protein binding to individual DnaA boxes in the Escherichia coli replication origin oriC. EMBO J. 16, 6574–6583.[CrossRef][Medline]
Wold, S., Boye, E., Slater, S., Kleckner, N. & Skarstad, K. (1998) Effects of purified SeqA protein on oriC-dependent DNA replication in vitro. EMBO J. 17, 4158–4165.[CrossRef][Medline]
Yao, N., Leu, F.P., Anjelkovic, J., Turner, J. & O'Donnell, M. (2000) DNA structure requirements for the Escherichia coli complex clamp loader and DNA polymerase III holoenzyme. J. Biol. Chem. 275, 11440–11450.
Received: 27 November 2003
Accepted: 4 March 2004
This article has been cited by other articles:
|
|
 |
|
  Y. Abe, T. Jo, Y. Matsuda, C. Matsunaga, T. Katayama, and T. Ueda Structure and Function of DnaA N-terminal Domains: SPECIFIC SITES AND MECHANISMS IN INTER-DnaA INTERACTION AND IN DnaB HELICASE LOADING ON oriC J. Biol. Chem., June 15, 2007; 282(24): 17816 - 17827. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kongsuwan, P. Josh, M. J. Picault, G. Wijffels, and B. Dalrymple The Plasmid RK2 Replication Initiator Protein (TrfA) Binds to the Sliding Clamp {beta} Subunit of DNA Polymerase III: Implication for the Toxicity of a Peptide Derived from the Amino-Terminal Portion of 33-Kilodalton TrfA. J. Bacteriol., August 1, 2006; 188(15): 5501 - 5509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Riber, J. A. Olsson, R. B. Jensen, O. Skovgaard, S. Dasgupta, M. G. Marinus, and A. Lobner-Olesen Hda-mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome Genes & Dev., August 1, 2006; 20(15): 2121 - 2134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-F.ço. Noirot-Gros, M. Velten, M. Yoshimura, S. McGovern, T. Morimoto, S. D. Ehrlich, N. Ogasawara, P. Polard, and P. Noirot Functional dissection of YabA, a negative regulator of DNA replication initiation in Bacillus subtilis PNAS, February 14, 2006; 103(7): 2368 - 2373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kawakami, K. Keyamura, and T. Katayama Formation of an ATP-DnaA-specific Initiation Complex Requires DnaA Arginine 285, a Conserved Motif in the AAA+ Protein Family J. Biol. Chem., July 22, 2005; 280(29): 27420 - 27430. [Abstract] [Full Text] [PDF] |
) was incubated for 20 min at 30 °C in buffer (25 µL) containing [
) were also carried out. The hydrolysis of DnaA-ATP was assessed by PEI thin-layer chromatography as described in Experimental procedures.
) or presence of ß clamps (30 fmol as dimer) loaded on to gapped dsDNA (0.77 fmol as circle; •) or multiprimed ssDNA (0.6 fmol as circle; 
), or 60-mer DNA (
) were also carried out (–ß).
