| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Cell Biology Group and CREST Research Project, Kansai Advanced Research Center, National Institute of Information and Communications Technology, 588-2 Iwaoka, Iwaoka-cho, Nishi-ku, Kobe 651-2492, Japan
2
Department of Biology, Graduate School of Science, Osaka University, 1-1 Machikaneyama, Toyonaka, 560-0043, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
The most striking example of meiotic nuclear reorganization has been provided by the fission yeast Schizosaccharomyces pombe. In this organism, centromeres are clustered at the spindle-pole body (SPB; a centrosome-equivalent structure in fungi) during the mitotic cell cycle (Funabiki et al. 1993). In contrast, the telomeres become clustered to the SPB and centromeres dissociate from the SPB during meiotic prophase (Chikashige et al. 1994, 1997). Furthermore, the entire nucleus moves back and forth between the cell poles for some hours during meiotic prophase, and telomeres remain clustered at the SPB located at the leading edge of the moving nucleus (Chikashige et al. 1994; Ding et al. 1998). It has been demonstrated that telomere clustering, and the subsequent nuclear oscillation, facilitate the pairing of homologous chromosomes by aligning the chromosomes along their length (Cooper 2000; Hiraoka et al. 2000; Yamamoto & Hiraoka 2001; Ding et al. 2004).
Normally S. pombe grow as haploid cells in a rich culture medium. Upon nitrogen starvation, cells are arrested at the G1 phase of mitosis, and haploid cells with the opposite mating types, h+ and h–, conjugate to produce a diploid zygote. In a diploid zygote, expression of the mating type-specific genes of both mating types leads to expression of Mei3. Expression of Mei3 inactivates Pat1, and this inactivation leads to activation of Mei2 and the induction of meiosis (McLeod & Beach 1988; Watanabe et al. 1997). Pat1 kinase is a key negative regulator of meiosis, and inactivation of Pat1 alone can induce cells to undergo meiosis even when cultured under conditions in which they would normally continue in mitotic cell growth. Thus, inactivation of Pat1 is often used to induce S. pombe cells synchronously into meiosis (Bähler et al. 1991).
Cells of the temperature-sensitive pat1-114 mutant enter meiosis synchronously when they are first arrested at the G1 phase of mitosis by nitrogen starvation and shifted to a restrictive temperature. When pat1-114 cells in the G2 phase are shifted to a restrictive temperature, these cells proceed to the G1 phase following one round of mitotic cell division and then enter meiosis (G1-exit meiosis). However, meiosis can be induced directly from the G2 phase (G2-exit meiosis), for example, by combining a cdc2 mutation with pat1-114. In these cells, sister chromatids precociously segregate at the first meiotic division, and recombination frequency decreases 20 fold (Watanabe et al. 2001). On the other hand, we previously reported that even when pat1-114 cells are induced to meiosis from the G1 phase, 40% of diploid cells or 80% of haploid cells show precocious segregation of sister chromatids at the first meiotic division (Yamamoto & Hiraoka 2003). Thus, some of the normal meiotic events are not reproduced in Pat1-induced meiosis.
Here we followed the behaviour of telomeres and centromeres continuously in individual living pat1-114 cells. The temporal order of events determined here will provide landmarks for the progression of chromosomal events under regulation downstream the Pat1 inactivation.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
To examine the nuclear organization in S. pombe cells during the process of meiosis induced by Pat1 inactivation, we followed the behaviour of telomeres and centromeres continuously in living cells. In these experiments, cells of the pat1-114 temperature sensitive mutant were first arrested at the G1 phase of mitosis under nitrogen starvation, and induced to meiosis by shifting to the restrictive temperature 34 °C in EMM2 depleted of nitrogen sources (see Experimental procedures). We observed living pat1-114 cells on a microscope kept at 34 °C in a temperature controlled room. In this way, we successfully followed the entire process of meiosis continuously in individual living cells.
Firstly, chromosomes were observed in pat1-114 cells expressing histone H3-GFP after induction of meiosis at 34 °C (Fig. 1A,B). In these examples, the first meiotic division was seen at 373 min or 393 min, and the second meiotic division at 434 min or 454 min (Fig. 1A,B, respectively). In the example shown in Fig. 1A, the fluorescence intensity of histone H3-GFP increased between 169– 190 min. This increase was observed in 83 (86%) of 96 cells examined. The remaining 13 cells (14%) showed no increase in histone H3-GFP fluorescence, and 12 of them proceeded with two meiotic divisions (an example of which is shown in Fig. 1B). The increase of GFP fluorescence probably reflects incorporation of histone H3-GFP into replicated chromatin, and indicates the time of premeiotic DNA synthesis. This was confirmed by flow cytometry analysis showing that the increase in fluorescence intensity of histone H3-GFP accompanied the increase in DNA content (Fig. 1E). We infer that these cells with no histone incorporation were induced to meiosis at the G2 phase of mitosis and entered meiosis directly without DNA synthesis (i.e., G2-exit meiosis), whereas most of the cells underwent G1-exit meiosis (Fig. 1C). A cumulative plot of the population of cells that proceeded through premeiotic DNA synthesis, meiosis I and meiosis II is shown in Fig. 1D (also see Table 1).
|
|
We followed the behaviour of telomeres in pat1-114 cells induced to meiosis. Telomeres were stained with the GFP fusion of Taz1, a telomere-binding protein, in living cells. Figure 2A shows an example of telomere clustering observed in a living cell. In this example, several spots of telomeres were seen until 153 min after induction, formed a single cluster at 173 min and remained clustered until immediately before the first meiotic division. As shown in Fig. 2D, in 104 (84%) of 124 cells examined, telomeres formed a single cluster before the first meiotic division, during the period ranging from 120 to 260 min after induction of meiosis. Separate experiments of double staining with Taz1-GFP and CFP-Sad1 showed that the cluster of telomeres was co-localized with the SPB in 79% of cells (104 of 132 cells examined) (Fig. 3). Sad1 is a well known marker of the SPB (Hagan & Yanagida 1995). These results show that telomeres form a cluster near the SPB in meiosis induced by pat1 inactivation like in normal meiosis. On the other hand, some cells proceeded to meiotic nuclear divisions without forming a telomere cluster: such an example is shown in Fig. 2B. Probably these cells without telomere clustering underwent G2-exit meiosis, as described later. A cumulative plot of the population of cells that proceeded through telomere clustering, meiosis I and meiosis II is shown in Fig. 2E (also see Table 1).
|
|
We also followed the behaviour of centromeres in pat1-114 cells induced to meiosis. Centromeres were stained with the GFP fusion of Mis6, a centromere-binding protein (Saitoh et al. 1997), in living cells. Figure 4A shows an example of centromeres in pat1-114 cells. In this example, centromeres show a single spot until 184 min, and become scattered from 214 min until the first meiotic division at 366 min. A similar behaviour of scattering of centromeres was observed in 106 (95%) of 112 cells examined, and centromeres remained clustered in the rest of the cells (Fig. 4D). An example of the latter is shown in Fig. 4B; these cells with ever-clustered centromeres probably underwent G2-exit meiosis, as described later. A cumulative plot of cells that proceeded with centromere scattering, first and second meiotic divisions as a time course is shown in Fig. 4E (also see Table 1).
|
|
These results of nuclear localization of telomeres and centromeres obtained from living cells were also confirmed by fluorescence in situ hybridization (FISH) in fixed cells (Fig. 6). The example shown in Fig. 6B, in which telomeres are completely clustered at the SPB, and centromeres are partially associated with the SPB, was most frequently observed (46%); the example shown in Fig. 6A, in which both centromeres and telomeres are completely clustered to the SPB, was the second most frequent (21%). Summing up, telomeres (completely) and centromeres (at least partially) are associated with the SPB in a major population of the cells (67%).
|
As described above, telomeres clustered to the SPB in the majority of pat1-114 cells. It should be noted, however, that a fraction of the cells showed no telomere clustering (16% in Fig. 2) or no centromere separation (5% in Fig. 4). This fraction roughly coincides with a fraction of the cells arrested at the G2 phase: flow cytometry analysis showed that 16% and 6% of the cells were in the G2 phase (Figs 2 and 4, respectively). As shown in Fig. 1, those cells arrested at the G2 phase entered meiosis without DNA synthesis. Thus, we were tempted to speculate that these cells that underwent G2-exit meiosis may exhibit no switching of positions of telomeres and centromeres.
To examine behaviours of telomeres and centromeres in G2-exit meiosis, we induced exponentially growing cells of pat1-114, which are mostly at the G2 phase. It is generally believed that when cells at the G2 phase of mitosis are induced to meiosis, those cells enter meiosis after they proceed to the G1 phase following one round of mitotic division. We found, however, the exponentially growing pat1-114 cells followed the two kinds of fates when they were induced to meiosis by temperature shift at the same time as nitrogen starvation. As shown in Fig. 7A, some cells entered meiosis without mitotic division after temperature shift; because the brightness of histone-GFP did not increase in these cells, we concluded that they entered meiosis directly from G2 phase without DNA synthesis, i.e. G2-exit meiosis (Fig. 7A). On the other hand, as shown in Fig. 7B, some cells proceeded with one round of mitotic division, and each of the daughter cells entered meiosis. In this case, because the brightness of histone-GFP increased in each daughter cell, these cells entered meiosis following G1 phase and DNA synthesis, i.e., G1-exit meiosis. Thus, we were able to distinguish cells of G2-exit meiosis by asking if the cell entered meiosis without mitotic division after temperature shift. In our experiments, about one half of the cells underwent G2-exit meiosis, and the cells undergoing G2-exit meiosis had shorter cell length at the time of meiosis induction, compared with the cells that underwent G1-exit meiosis following mitotic division (compare Fig. 7A with 7B as an example). These results indicate that cells at the early G2 phase directly enter meiosis (G2-exit meiosis) while those at the late G2 phase continue the mitotic cycle until DNA synthesis before entering meiosis (G1-exit meiosis).
|
Meiotic chromosome segregation in Pat1-induced meiosis
Previous studies have demonstrated that sister centromeres often segregate precociously at the first meiotic division in a fraction of cells when pat1-114 cells are induced to meiosis (Yamamoto & Hiraoka 2003). We also demonstrated above that centromeres remained partially associated with the SPB in pat1-114 cells induced to meiosis. Thus, we asked if centromere association with the SPB correlates with precocious segregation of sister chromatids in meiosis induced by pat1 inactivation. To this end, we used strains carrying the lacI/lacO recognition sequences inserted near the centromere, at the lys1 locus (35 kb to the centromere I) or at the cen2 locus (immediately adjacent to the centromere II), on only one of the homologous chromosomes. The SPB was stained with Sad1-DsRed. Diploid (h–/h–) cells of pat1-114 expressing lacI-GFP and Sad1-DsRed were first arrested at the G1 phase by nitrogen starvation and then shifted to a restrictive temperature. These cells contained a population of G1 phase cells (87%) as estimated by flow cytometry.
We first determined the position of the centromere relative to the SPB, and then continued observation to examine segregation of sister centromeres in the same cell. Examples are shown for the cen2 locus in Fig. 8A–D. In these examples, centromeres of the chromosome II separated from the SPB (Fig. 8A,B), or remained near the SPB (Fig. 8C,D). At the first meiotic division, sister centromeres precociously segregated in examples shown in Fig. 8A,C (equational segregation), and showed normal segregation moving together to the same pole in examples shown in Fig. 8B,D (reductional segregation). In the examples for cen2, the cen2 locus was associated with the SPB in 103 (73%) of 142 cells, and separated from the SPB in 39 (27%) of 142 cells. Either of the populations contained a certain fraction of cells that showed precocious sister chromatid separation. A similar result was obtained for the lys1 locus.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Inactivation of Pat1 is often useful to induce synchronous meiosis in S. pombe. Using live cell imaging microscopy, we determined the temporal order of DNA synthesis, telomere clustering, centromere separation and meiotic chromosome segregation during the time course of meiosis induced by Pat1 inactivation. The times of these events are summarized in Table 1. The times of meiosis I and II were reproducible in independent sets of the experiments, thus the times of DNA synthesis, telomere clustering and centromere separation can be compared among these experiments with regard to the times of meiosis I and II as landmark events. In these experiments, pat1-114 cells were induced to meiosis by shifting to the restrictive temperature in the absence of nitrogen sources. When nitrogen sources were supplemented to the culture medium upon the temperature shift, meiosis proceeded with faster timings (Table 1), but the failure in centromere separation from the SPB was reproduced in the pat1-114 cells induced to meiosis in the presence of nitrogen sources (data not shown).
The process of meiosis induced by Pat1 inactivation differs from the normal process of meiosis. Oscillation of the elongated nucleus that is seen in normal meiosis was also observed in pat1-114 cells, but it was less frequent and less prominent. pat1-114 cells undergoing G1-exit meiosis showed 2–3 rounds of oscillation (Fig. 1A) whereas pat1-114 cells undergoing G2-exit meiosis showed little or no oscillatory nuclear movement during meiotic prophase (Figs 1B and 7A). In contrast, 30–60 rounds of oscillation are observed over a few hours during normal meiosis (Ding et al. 1998). In Pat1-induced meiosis, telomeres form a cluster to the SPB as in normal meiosis, but centromeres remained partially associated with the SPB in the majority of cells observed; in addition, sister chromatids separated precociously at the first meiotic division in high frequency (Fig. 8; also Yamamoto & Hiraoka 2003). The temporal order of meiotic events in Pat1-induced meiosis differs from that in normal meiosis. In pat1-114 cells, DNA synthesis precedes telomere clustering, and centromere separation is late and incomplete, whereas in normal zygotic meiosis, switching of nuclear positions of telomeres and centromeres is completed prior to karyogamy, and then premeiotic DNA synthesis follows karyogamy. Thus, it should be kept in mind that some of the meiotic events in Pat1-induced meiosis is aberrant from those in the normal process of meiosis.
Fate of the cells induced to meiosis from the G2 phase
Normally S. pombe cells are arrested at the G1 phase upon nitrogen starvation and then enter meiosis following one round of DNA replication. Also pat1-114 cells enter meiosis from the G1 phase when shifted to a restrictive temperature. It has been demonstrated, however, that cells of a pat1-114 cdc2 mutant can be arrested at the G2 phase and induced to meiosis from the G2 phase without DNA replication; in these cells, sister chromatids exhibit equational segregation at the first meiotic division (Watanabe et al. 2001). In this report, we showed that some of the exponentially growing pat1-114 cells enter meiosis from the G2 phase when shifted to a restrictive temperature at the same time with nitrogen starvation, and these cells show equational segregation of sister chromatids at the first meiotic division. Thus, a passage through premeiotic DNA replication is an important requisite for the formation of meiotic kinetochore structures, as proposed in Watanabe et al. (2001). In addition, cells undergoing G2-exit meiosis retain the mitotic configuration of chromosomes, that is, centromeres remain associated with the SPB and telomeres do not cluster to the SPB. These results suggest that entering meiosis from the G1 phase is important in the correct regulation of meiotic nuclear reorganization.
Telomeres and centromeres in Pat1-induced meiosis
When cells of pat1-114 were induced to meiosis by temperature shift-up, a fraction of cells exhibited no telomeres clustered to the SPB. These cells probably entered meiosis from the G2 phase, as described above. In the rest of the cells that entered meiosis from the G1 phase, telomeres clustered to the SPB in the majority of cells observed. Thus, the behaviour of telomeres was considerably normal in meiosis induced from the G1 phase by Pat1 inactivation.
In contrast, the behaviour of centromeres was aberrant in meiosis induced by Pat1 inactivation. In pat1-114 cells entered meiosis from the G2 phase, centromeres were mostly clustered to the SPB; also when pat1-114 cells were induced to meiosis from the G1 phase, centromeres were partially associated with the SPB. Therefore, Pat1 inactivation is not sufficient for moving the centromeres to their meiotic nuclear positions. The failure in SPB-centromere separation in pat1-114 cells is unlikely to be due to the poor nuclear movements because centromeres separate from the SPB in dhc1 mutant cells which completely lack nuclear movements (Yamamoto et al. 1999).
Sister chromatid segregation in Pat1-induced meiosis
In some of the pat1-114 cells induced to meiosis, centromeres remained associated with the SPB, and sister chromatids showed equational segregation. However, there was no correlation between centromere-SPB association and sister chromatid segregation. In Pat1-induced meiosis, centromeres probably fail to form properly whether they are separated from or associated with the SPB. It has been reported that reductional segregation of sister chromatids at the first meiotic division is impaired in Pat1-induced meiosis, but is compensated by activation of mating pheromone signalling (Yamamoto & Hiraoka 2003). Therefore, kinetochore structures are not properly formed by Pat1 inactivation alone, but require mating pheromone signalling for their formation. Further analysis of these differences in kinetochore structures will provide insights into the regulation of meiotic chromosome segregation.
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Genotypes of the strains used in this paper are shown in Table 2. For routine mitotic culture of S. pombe cells, YE, YES, or EMM2 was used according to Moreno et al. (1991).
|
A single colony of pat1-114 mutant cells on a YES plate was inoculated into YES liquid medium to grow to 5 x 106 cell/mL at 26 °C. The cells were transferred to EMM2 liquid medium at 2 x 106 cell/mL and incubated for eight hours at 26 °C. The cells were transferred to EMM2-N (EMM2 depleted of nitrogen sources) and further incubated for 16 h at 26 °C. As a result of nitrogen starvation, 75–85% of haploid cells and 85–95% of diploid cells were arrested at the G1 phase. After nitrogen starvation, the cells were transferred to fresh EMM2-N liquid medium at 3 x 107 cell/mL, and the cell suspension was mounted on a 35 mm glass-bottom dish for live cell observation on the microscope stage kept at 34 °C.
Induction of meiosis at the exponentially growing phase
A single colony of pat1-114 mutant cells on a YES plate was inoculated to YES liquid medium to grow to 5 x 106 cell/mL at 26 °C. The cells were then transferred to fresh EMM2-N liquid medium at 3 x 107 cell/mL, and the cell suspension was mounted on a glass-bottom dish for live cell observation on the microscope stage kept at 34 °C.
Plasmid vectors for chromosomal integration
We used the following vectors for integration to S. pombe choromosomes. The pYC36 was made as follows: The NotI site of the Bluscript KS+ (STRATAGENE) was replaced by the NruI site, then the NaeI site was replaced by the NotI site to make pYC31. The 2.8kb HindIII fragment, which contains the 5'-end of lys1+ (named lys1-N) with added NotI site at both ends, was inserted at the NotI site of the pYC31 to make pYC36. The lys1-N fragment can complement the lys1-131 mutation when it is integrated collectedly at lys1 locus.
The pCST3 was derived from the pYC36 as follows: First, the NdeI site in the lys1-N fragment was disrupted and the fragment from the HindIII site to the KpnI sites in the multicloning sites were deleted in pYC36. The resulting plasmid was designated pYC32. It was confirmed that disruption of the NdeI site of lys1-N does not affect its complementation of the lys1-131 mutation. The 2.2kb PstI-SacI fragment containing the nmt1 promoter, 5 restriction sites (NdeI, SalI, XbaI, BamHI and SmaI) and nmt1 terminator from pRep1 (Maundrell 1993), was inserted at the PstI-SacI site of pYC32 to make pYC61. The 5 restriction sites between the nmt1 promoter and nmt1 terminator in pYC61 were replaced by the following sequence: CATATG TCGAGT GTCGACGGATCCCTCGAGAGATCTTAG, in which the bolded ATG and TAG correspond to the initiation codon and the termination codon in frame of nmt1 and the underlined sequences are restriction sites of NdeI, SalI, BamHI, XhoI and BglII in this order. The resulting plasmid was designated pCST3.
pYC23 was made as follows: the NaeI site of the Bluscript KS+ was replaced by the NsiI site to make pYC4. The 1.5 kb PstI fragment, which contains the 3'-end of pro1+ (named pro1-C), was inserted at the NsiI site of the pYC4. The resulting plasmid was designated pYC23.
The pro1-C fragment can complement the pro1-1 mutation when it is integrated correctly at the pro1 locus. pYC11 was made as follows: The 2.2kb XhoI-SalI fragment of S. cerevisiae LEU2 gene, which complements the S. pombe leu1–, was inserted at the NaeI site of the Bluscript KS+. Restriction maps and DNA sequences of these integration vectors can be found at our web site, http://www-karc.nict.go.jp/d332/CellMagic/index.html
GFP, CFP and DsRed fusion constructs
The mis6-GFP fusion gene was made by fusing the GFP gene to the 3' end of mis6+. The mis6+ gene on the chromosome was replaced by the mis6-GFP fusion gene using S. cerevisiae LEU2 as a selection marker. The histon H3-GFP (hht2-GFP) fusion construct is described in Wang et al. 2002. The taz1-GFP fusion gene (Chikashige & Hiraoka 2001) was integrated into the lys1 or pro1 locus on the chromosome by using the pYC36 or pYC23.
Sad1-GFP, CFP-Sad1 and Sad1-DsRed were used as a marker of the SPB. The sad1-GFP fusion gene was made by fusing the GFP gene to the 3' end of sad1+. The sad1-GFP fusion gene was integrated into the lys1 locus on the chromosome by using the pYC36. The sad1-GFP fusion gene complements the lethality of sad1-null mutants, indicating that the sad1-GFP fusion gene was functional.
The plasmid for integration of the CFP-sad1 fusion gene was constructed as follows: CFP was constructed by replacing serine, tyrosine and glycine at residues 64–66 of GFP with leucine, threonine and tryptophan, respectively (DNA sequence is CTTACTTGG). DNA fragments containing the sad1 promoter (from –614 to –1), followed by the first 7 amino acid coding sequence of CFP, was amplified by PCR with a genomic DNA template, using a forward primer (5'-AACACGCGAATTGCTGGATTTGGATCCTATCAGCTTCAAGTACTTA-3') and a reverse primer (5'-GAAGAGCTCTTCTCCTTTACTCATTGATGTATAAAAGGCTATTTGA-3'; the underlined sequence indicates the artificial SacI site, which does not change the CFP amino acid sequence). This DNA fragment was digested with BamHI and SacI and cloned into the BamHI and SacI sites of pYC36 lacking the XhoI and SalI sites. A DNA fragment lacking the first 5 amino acid coding sequence of CFP was amplified by PCR using a forward primer (5'-GCGGGATCCGAGCTCTTCACTGGAGTTGTCCCAATTCTTG-3'; the underlined sequence indicates the artificial SacI site, which does not change the CFP amino acid sequence) and a reverse primer (5'-AGCCCGGGCTCGAGTTTGTATAGTTCATCCATGCCATGTG-3'). This DNA fragment was digested with BamHI and XhoI and cloned into the BamHI and XhoI sites of pCST3. The SacI fragment containing the partial CFP ORF followed by the nmt1 terminator was cloned into the SacI site of pYC36 containing the sad1 promoter followed by the partial CFP ORF described above. Finally, the BamHI fragment containing the sad1+ ORF amplified by PCR was cloned into the BglII site of this plasmid. The resulting plasmid was integrated into the chromosome at the lys1-131 gene locus. Integration was confirmed by PCR. CFP-sad1 fusion gene complements the lethality of sad1-null mutants, indicating that the CFP-sad1 fusion gene was functional.
The Sad1-DsRed fusion construct was made as follows: the entire coding sequence of the sad1 gene with its own promoter region (1545 base pairs of the coding sequence plus 614 base pairs immediately preceeding) was ligated in frame to the 5' end of the sequence encoding wild-type DsRed (Clontech), with the linker sequence (3 x GGATCCCCCGGGTCTACTGTTCCTCGTGCTCGTGATCCTCCTGTTGCTACTAGATCT), followed by the nmt1 terminator sequence and cloned into the integration vector pYC11. The resulting plasmid was integrated into the chromosome at the sad1 gene locus. Sad1-DsRed is always used with sad1+. It was not examined whether the sad1-DsRed fusion gene complements the sad1-null mutant. In this case, because an abnormal spore is formed after meiosis, the sad1-DsRed fusion gene is expected to give a dominant phenotype. It was confirmed that the behaviour of telomeres and centromeres observed in the cells which had Sad1-DsRed shown in this paper were similar to those observed in the strain which did not have sad1-DsRed.
Fluorescence microscopy
Indirect immunofluorescence microscopy and FISH were carried out as previously described (Chikashige et al. 1997). Fluorescence microscope images were obtained by the DeltaVision microscope system (Applied Precision, Inc.) set up in a temperature-controlled room as previously described (Haraguchi et al. 1999).
Flow cytometry
The DNA and histone H3-GFP content of cells were determined using an Epics XL flow cytometer (Beckman Coulter). For measurement of DNA content, S. pombe cells were fixed in 70% ethanol for 30 min at 4 °C. Fixed cells were incubated in 50 mM sodium citrate with 0.1 mg/mL RNase A for 2 h at 37 °C. After RNase treatment, cells were stained with 1 µM SYTOX green (Molecular Probes) and sonicated for a few seconds. Fluorescence intensity of histone H3-GFP was measured in unfixed cells in EMM2-N liquid medium.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
*Correspondence: E-mail: yasushi{at}nict.go.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Chikashige, Y., Ding, D.Q., Funabiki, H., et al. (1994) Telomere-led premeiotic chromosome movement in fission yeast. Science 264, 270–273.
Chikashige, Y., Ding, D.Q., Imai, Y., Yamamoto, M., Haraguchi, T. & Hiraoka, Y. (1997) Meiotic nuclear reorganization: switching the position of centromeres and telomeres in the fission yeast Schizosaccharomyces pombe. EMBO J. 16, 193–202.[CrossRef][Medline]
Chikashige, Y. & Hiraoka, Y. (2001) Telomere binding of the Rap1 protein is required for meiosis in fission yeast. Curr. Biol. 11, 1618–1623.[CrossRef][Medline]
Cooper, J.P. (2000) Telomere transitions in yeast: the end of the chromosome as we know it. Curr. Opin. Genet. Dev. 10, 169–177.[CrossRef][Medline]
Ding, D.Q., Chikashige, Y., Haraguchi, T. & Hiraoka, Y. (1998) Oscillatory nuclear movement in fission yeast meiotic prophase is driven by astral microtubules, as revealed by continuous observation of chromosomes and microtubules in living cells. J. Cell Sci. 111, 701–712.[Abstract]
Ding, D.-Q., Yamamoto, A., Haraguchi, T. & Hiraoka, Y. (2004) Dynamics of homologous chromosome pairing during meiotic prophase infission yeast. Developmental Cell 6, 329–341.[CrossRef][Medline]
Funabiki, H., Hagan, I., Uzawa, S. & Yanagida, M. (1993) Cell cycle-dependent specific positioning and clustering of centrosome and telomeres infission yeast. J. Cell Biol. 121, 961–976.
Hagan, I. & Yanagida, M. (1995) The product of the spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J. Cell Biol. 129, 1033–1047.
Haraguchi, T., Ding, D.-Q., Yamamoto, A., Kaneda, T., Koujin, T. & Hiraoka, Y. (1999) Multi-color fluorescence imaging of chromosomes and microtubules in living cells. Cell Struct. Funct. 24, 291–298.[CrossRef][Medline]
Hiraoka, Y., Ding, D.Q., Yamamoto, A., Tsutsumi, C. & Chikashige, Y. (2000) Characterization of fission yeast meiotic mutants based on live observation of meiotic prophase nuclear movement. Chromosoma 109, 103–109.[CrossRef][Medline]
Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123, 127–130.[CrossRef][Medline]
McLeod, M. & Beach, D. (1988) A specific inhibitor of the ran1+ protein kinase regulates entry into meiosis in Schizosaccharomyces pombe. Nature 332, 509–514.[CrossRef][Medline]
Moreno, S., Klar, A. & Nurse, P. (1991) Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Meth. Enzymol. 194, 795–823.[Medline]
Nabeshima, K., Nakagawa, T., Straight, A.F., et al. (1998) Dynamics of centromeres during metaphase-anaphase transition in fission yeast: Dis1 is implicated in force balance in metaphase bipolar spindle. Mol. Biol. Cell 9, 3211–3225.
Saitoh, S., Takahashi, K. & Yanagida, M. (1997) Mis6, a fission yeast inner centromere protein, acts during G1/S and forms specialized chromatin required for equal segregation. Cell 90, 131–143.[CrossRef][Medline]
Scherthan, H. (2001) A bouquet makes ends meet. Nature Rev. Mol. Cell. Biol. 2, 621–627.[CrossRef][Medline]
Wang, H., Tang, X., Liu, J., et al. (2002) The multiprotein exocyst complex is essential for cell separation in Schizosaccharomyces pombe. Mol. Biol. Cell 13, 515–529.
Watanabe, Y., Shinozaki-Yabana, S., Chikashige, Y., Hiraoka, Y. & Yamamoto, M. (1997) Phosphorylation of RNA-binding protein controls cell cycle switch from mitotic to meiotic in fission yeast. Nature 386, 187–190.[CrossRef][Medline]
Watanabe, Y., Yokobayashi, S., Yamamoto, M. & Nurse, P. (2001) Pre-meiotic S phase is linked to reductional chromosome segregation and recombination. Nature 409, 359–363.[CrossRef][Medline]
Yamamoto, A. & Hiraoka, Y. (2001) How do meiotic chromosomes meet their homologous partners?: lessons from fission yeast. Bioessays 23, 526–533.[CrossRef][Medline]
Yamamoto, A. & Hiraoka, Y. (2003) Monopolar spindle attachment of sister chromatids is ensured by two distinct mechanisms at the first meiotic division in fission yeast. EMBO J. 22, 2284–2296.[CrossRef][Medline]
Yamamoto, A., West, R.R., McIntosh, J.R. & Hiraoka, Y. (1999) A cytoplasmic dynein heavy chain is required for oscillatory nuclear movement of meiotic prophase and efficient meiotic recombination in fission yeast. J. Cell Biol. 145, 1233–1249.
Received: 27 March 2004
Accepted: 26 May 2004
This article has been cited by other articles:
|
|
 |
|
  I. Samejima, V. J. Miller, L. M. Groocock, and K. E. Sawin Two distinct regions of Mto1 are required for normal microtubule nucleation and efficient association with the {gamma}-tubulin complex in vivo J. Cell Sci., December 1, 2008; 121(23): 3971 - 3980. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Anders, P. C.C. Lourenco, and K. E. Sawin Noncore Components of the Fission Yeast {gamma}-Tubulin Complex Mol. Biol. Cell, December 1, 2006; 17(12): 5075 - 5093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hayashi, H. Asakawa, T. Haraguchi, and Y. Hiraoka Reconstruction of the Kinetochore during Meiosis in Fission Yeast Schizosaccharomyces pombe Mol. Biol. Cell, December 1, 2006; 17(12): 5173 - 5184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D.-Q. Ding, N. Sakurai, Y. Katou, T. Itoh, K. Shirahige, T. Haraguchi, and Y. Hiraoka Meiotic cohesins modulate chromosome compaction during meiotic prophase in fission yeast J. Cell Biol., August 14, 2006; 174(4): 499 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Masuda, T. Toda, R. Miyamoto, T. Haraguchi, and Y. Hiraoka Modulation of Alp4 function in Schizosaccharomyces pombe induces novel phenotypes that imply distinct functions for nuclear and cytoplasmic {gamma}-tubulin complexes Genes Cells, April 1, 2006; 11(4): 319 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Masuda, R. Miyamoto, T. Haraguchi, and Y. Hiraoka The carboxy-terminus of Alp4 alters microtubule dynamics to induce oscillatory nuclear movement led by the spindle pole body in Schizosaccharomyces pombe Genes Cells, April 1, 2006; 11(4): 337 - 352. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Asakawa, A. Hayashi, T. Haraguchi, and Y. Hiraoka Dissociation of the Nuf2-Ndc80 Complex Releases Centromeres from the Spindle-Pole Body during Meiotic Prophase in Fission Yeast Mol. Biol. Cell, May 1, 2005; 16(5): 2325 - 2338. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
