| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Laboratory of Frontier Science, and 2 Department of Tumor Cell Biology, Tokyo Metropolitan Institute of Medical Science, 3-18-22, Honkomagome, Bunkyo, Tokyo 113–8613, Japan
3
Department of Functional Biology, Kyoto University Graduate School of Biostudies, Yosidakonoe, Sakyo, Kyoto 606–8501, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionExperimental proceduresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Glutamine/asparagine-rich aggregates are also involved in the non-Mendelian inheritance of yeast prion phenotypes, including [PSI+], [URE3] and [PIN+]. Their non-Mendelian inheritance is thought to result from the transmission of altered conformations of yeast prion proteins rather than of DNA (Serio & Lindquist 2001; Wickner 1994). For example, the Sup35 protein, a component of the eukaryotic release factor, which is a determinant of the [PSI+] phenotype, is soluble in the normal [psi–] state but insoluble in the [PSI+] prion state (Patino et al. 1996; Paushkin et al. 1996). In the case of Sup35, the glutamine/asparagine-rich domain or prion domain (PrD) is required for the maintenance of [PSI+] by the formation of self-propagating amyloid-like aggregates (Ter-Avanesyan et al. 1994; Patino et al. 1996; Kimura et al. 2003). This domain is also responsible for the induction of the [PSI+] phenotype when over-expressed in [psi–] cells, as is full length Sup35 (Chernoff et al. 1993; Derkatch et al. 1996; Patino et al. 1996). Very recent analysis of infecting yeast with recombinant PrD of Sup35 proved that they do indeed take infectious conformations (King & Diaz-Avalos 2004; Tanaka et al. 2004).
Previous studies have indicated that a similar molecular mechanism might underlie the formation of aggregates of both Sup35 and ex-polyQ (DePace et al. 1998; Krobitsch & Lindquist 2000; Meriin et al. 2002). First, a region of PrD (aa.8–24) of Sup35 that is rich in glutamine and asparagine can be replaced by a polyQ stretch in aggregate formation (DePace et al. 1998). Second, a recombinant protein containing the PrD spontaneously forms amyloid-like fibrils in vitro (Glover et al. 1997; King et al. 1997). PolyQ also spontaneously changes from the soluble state into amyloid-like aggregates in a polyQ length and in a concentration-dependent manner in vitro (Ross et al. 2003; Scherzinger et al. 1997, 1999). Third, in vivo however, the molecular chaperone Hsp104, which is a member of the AAA+ superfamily, is required for Sup35 aggregation and the propagation of the heritable trait (Chernoff et al. 1995; Patino et al. 1996). In addition, the glutamine/asparagine-rich protein Rnq1, which is associated with [PIN+], is usually required for the conversion of [psi–] to [PSI+]in vivo (Derkatch et al. 1997, 2000, 2001; Osherovich & Weissman 2001). PolyQ similarly requires Hsp104 and Rnq1 to achieve aggregation and toxicity when expressed in yeast (Krobitsch & Lindquist 2000; Kimura et al. 2001; Meriin et al. 2002). Interestingly, when expressed in Drosophila eyes, ex-polyQ requires another member of the AAA+ superfamily, VCP/p97, for pathogenesis (Higashiyama et al. 2002). VCP/p97 was also isolated as an ex-polyQ binding protein in mammalian cultures (Hirabayashi et al. 2001). Previous studies have failed to discover clear reasons for these additional in vivo requirements.
In this paper, we have shown that preexisting aggregates are required for the two Hsp104-dependent processes: efficient aggregate formation of polyQ and epigenetic change of the yeast [PSI+] prion.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
hsp104 cells
The formation of polyQ aggregates is greatly reduced in Hsp104-deletion cells (referred to here as hsp104), although some aggregation is still observed if the stretch of the polyQ is long (Krobitsch & Lindquist 2000; Kimura et al. 2001; Meriin et al. 2002). In this experiment, we first noticed that the exogenous expression of Hsp104 in a low-copy plasmid failed to restore the formation of aggregates of short polyQ (p50-Q34) in hsp104 cells (Fig. 1A), although it recovered the thermo-tolerance defect which is associated with the function of Hsp104 (data not shown, and (Sanchez & Lindquist 1990)). Therefore, the deletion of the HSP104 gene not only abrogated Hsp104 expression, but also led to additional changes that inhibited the formation of short polyQ aggregates and were not corrected by exogenous Hsp104. Since endogenous Rnq1, which enhances polyQ aggregate formation and toxicity, has been reported to form Hsp104-dependent aggregates (Meriin et al. 2002, 2003; Sondheimer & Lindquist 2000), one of the changes in hsp104 cells was likely to be the loss of Rnq1 aggregates, resulting in the failure of the restoration of short polyQ aggregate formation by Hsp104. Rnq1 was indeed soluble in the hsp104 cells expressing Hsp104 and the short polyQ (unpublished observaiton). However in contrast with the result of p50-Q34 aggregation, we found that the formation of aggregates of long polyQ (p50-Q80) was partially restored by the expression of Hsp104 (Fig. 1A). Again Rnq1 remained in a soluble fraction in the hsp104 cells expressing p50-Q80 and Hsp104, suggesting that Rnq1 did not play a role in the restoration of p50-Q80 aggregate formation with Hsp104 (Fig. 1B). Rather, the fact that long polyQ, but not short polyQ, can form aggregates in the absence of Hsp104 suggested that Hsp104 works on preformed long polyQ aggregates to produce more aggregates.
|
hsp104 cells (Fig. 2). The 3HA-tagged polyQs (3HA-Q34 or 3HA-Q80) were constitutively expressed using a low-copy plasmid, whereas the expression of p50-Q34 was induced. The formation of short polyQ (p50-Q34) aggregates was only slightly increased by the expression of long polyQ (3HA-Q80) in the absence of Hsp104 (Fig. 2A, lane 4). However, the formation of short polyQ (p50-Q34) aggregates was significantly enhanced by the coexpression of Hsp104 and long polyQ (3HA-Q80), but not by the coexpression of Hsp104 and short polyQ (3HA-Q34) (Fig. 2A, lanes 5 and 8). While examining the formation of 3HA-tagged polyQ aggregates, it was noticed that the production of 3HA-Q80-containing aggregates was effectively enhanced by Hsp104 expression, whereas that of 3HA-Q34-containing aggregates was not (Fig. 2B). Since significant amounts of both types of aggregate were co-localized (Fig. 2A,C), the increase in p50-Q34 aggregation that was associated with the coexpression of 3HA-Q80 and Hsp104 was likely due to seeding by the 3HA-Q80 aggregates. Moreover, this effect was not observed with an ATPase-deficient mutant of Hsp104(K218T) (Fig. 2A, lane 6; Fig. 2B, lane 7) (Parsell et al. 1991). These results indicate that polyQ aggregates, which were formed independently of Hsp104 were required for Hsp104 to more efficiently make polyQ aggregates, and that the functional Hsp104, plausibly its ATPase activity is required for the process.
|
hsp104 cells to [PSI+] state by the expression of the PrDs in high-copy plasmid
To investigate the significance of preformed aggregates in an in vivo Hsp104 dependent system, we used the yeast prion [PSI+] system. In this system, the conversion of [psi–] to [PSI+] can be caused by the over-expression of Sup35 if the [psi–] strain has the [PIN+] phenotype (Chernoff et al. 1993; Derkatch et al. 1997). With Sup35, the exogenous expression of the PrD of Sup35 into [psi–] cells is sufficient to induce the appearance of the [PSI+] state (Derkatch et al. 1996). Hsp104 is required for the maintenance of [PSI+] as [PSI+] is lost in the deletion of HSP104 gene (Chernoff et al. 1995). Curiously, the conversion of [psi–]hsp104 to the [PSI+] state has never been achieved by the introduction of Hsp104 and Sup35 (Derkatch et al. 1997). This failure can be interpreted to mean that prions including [PSI+], [PIN+] and [URE3], which influence one another through unknown mechanisms, are absent from hsp104 cells (Chernoff et al. 1995; Moriyama et al. 2000; Sondheimer & Lindquist 2000).
Consistent with the previous results of others, the expression of Sup35 PrD (aa1–124) with a p50 tag (PrD-p50) under the control of a constitutive GPD promoter into [psi–][pin+] cells induced the appearance of [PSI+] cells when expressed in the high-copy plasmid (pH-PRD-P50), as well as in the low-copy plasmid (pL-PRD-P50) (data not shown). In hsp104 cells, not only does PrD-p50 expressed in low-copy plasmid (L-PrD-p50) and in high-copy plasmid (H-PrD-p50) have no effect on the conversion, but also the aggregate formation of the PrD-containing proteins is significantly reduced (Kimura et al. 2003; and unpublished observation). However we previously showed that some of the aggregates of H-PrD-p50 that are still formed in hsp104 cells can be stained with an amyloid-binding compound thioflavin-S (Kimura et al. 2003). This suggests that high concentrations of PrD-p50 enable amyloid aggregates to be formed even in hsp104 cells. This Hsp104-independent amyloid-like aggregate formation of H-PrD-p50 was reminiscent of the aggregate formation of long polyglutamine in hsp104 cells (Kimura et al. 2001, 2002), and therefore we carefully compared the aggregate formation of H-PrD-p50 and L-PrD-p50 in the hsp104 cells. H-PrD-p50 or L-PrD-p50 was expressed into the hsp104 cells together with a plasmid containing the HSP104 gene (pHSP104) or a vector. As expected, six days after transformation, the quantity of PrD-p50 aggregates in hsp104 cells expressing H-PrD-p50 was much greater than that expressing L-PrD-p50 (Fig. 3A). Furthermore, an insoluble form of PrD-p50 was clearly detected in cells expressing H-PrD-p50, but not in cells expressing L-PrD-p50 (Fig. 3B and Kimura et al. 2003). However, the expression of Hsp104 neither enhanced aggregate formation nor led to the increased production of insoluble PrD-p50 in cells expressing the H-PrD-p50 (Fig. 3A,B). Importantly, even with the coexpression of Hsp104, endogenous Sup35 remained mainly soluble (Fig. 3B) and the phenotype remained Ade-, which was indicative of [psi–] (Fig. 3D, lane 2). As the de novo appearance of several yeast prions is induced by a cold state, the transformed hsp104 cells were placed in a cold room for more than nine days (Derkatch et al. 2000). Surprisingly a phenotypic change to Ade+, which is indicative of [PSI+] was observed in cells originally transformed with pH-PRD-P50 and pHSP104, but not in cells transformed with the pL-PRD-P50 and pHSP104 (Fig. 3C(g,e)). Moreover, the exogenous expression of Hsp104(K218T) instead of Hsp104 failed to convert hsp104 cells into the Ade+ phenotype (Fig. 3C(c)). These results indicate that if a sufficient amount of PrD-p50 aggregates, probably formed independently from Hsp104 was supplied, the expression of functional Hsp104 could result in the change of the physical property of Sup35 from soluble to insoluble, leading to epigenetic change to the prion state. Consistent with previous reports that over-expression of the PrD region of Sup35 was toxic to [PSI+] cells, H-PrD-p50 appeared to be toxic to cells once they were converted to [PSI+] (Chernoff et al. 2002). As most if not all Ade+ cells lost the high-copy plasmid (pH-PRD-P50); this was detected by the failure of cells to grow in a medium without uracil (Fig. 3D, lane 3). In contrast, none of the Ade+ cells that were tested lost the plasmid containing the HSP104 gene (pHSP104); this was detected by the successful growth of cells in a medium without histidine (Fig. 3D, lane 3). The Ade+ cells were confirmed as [PSI+] because treatment with guanidine hydrochloride (GuHCl), which is known to cure [PSI+] converted them to Ade- and changed the insoluble endogenous Sup35 to its soluble form (Fig. 3D, lane 4, and Fig. 3E). We further found that the tag p50 was not required for the conversion (Fig. 3F). The over-expression of the PrD without the tag (H-PrD) together with the expression of Hsp104 also changed the hsp104 cells to Ade+ (Fig. 3F(a)), and they were confirmed as [PSI+] (data not shown).
|
hsp104 cells to [PSI+] state by the coexpression of Rnq1 and the PrD-p50 in low-copy plasmid
The conversion of [psi-] to [PSI+] by the over-expression of Sup35 is usually dependent on the presence of the [PIN+] prion (Derkatch et al. 1997, 2000). Rnq1 is associated with [PIN+] (Derkatch et al. 2001; Osherovich & Weissman 2001). Therefore, we examined the role of Rnq1 in the conversion of hsp104 cells from [psi-] to [PSI+]. In cells expressing H-PrD-p50, seven days after transformation the exogenous over-expression of Rnq1 enhanced aggregate formation of PrD-p50 independently of Hsp104 (Fig. 4B, lanes 1–4). Moreover, when Hsp104 was coexpressed together with H-PrD-p50 and Rnq1, the phenotypic change to Ade+ was more efficient than in cells with the H-PrD-p50 and pHsp104 (Fig. 4C(g,h)). In the cells expressing L-PrD-p50, only a small fraction of cells contained PrD-p50 aggregate(s), but its aggregate formation was slightly enhanced when Rnq1 was coexpressed (Fig. 4B, lanes 5 and 7). The coexpression of Hsp104 and Rnq1 further increased aggregate formation (Fig. 4B, lane 8), though the phenotypic change was not observed at that time (data not shown and Fig. 4D lane 2). The transformed hsp104 cells then changed to the Ade+ phenotype after further incubation in a cold room (Fig. 4C(e)). In this experiment, all the Ade+ cells contained the three plasmids. However, only a plasmid containing HSP104 was essential in the maintenance of the phenotype (Fig. 4D, lane 3). These Ade+ cells were confirmed as [PSI+] because endogenous Sup35 of the cell was insoluble (Fig. 4E). Moreover, the cells became Ade–, and endogenous Sup35 became soluble as the result of treatment with GuHCl (Fig. 4D, lane 4 and Fig. 4E). The substitution of Hsp104(K218T) for Hsp104 failed to produce the Ade+ phenotype (Fig. 4C(d)). These results indicate that exogenous Rnq1 expression increased the probability of Hsp104-dependent epigenetic change by increasing the amount of PrD-p50-containing aggregates.
|
The dependence of [PSI+] on [PIN+] was reminiscent of the dependence of aggregate formation of short polyQ on that of long polyQ, where short polyQ was enhanced by the seeding of aggregates of long polyQ. To test the possibility of the co-localization of Rnq1 and PrD aggregates, we put 3HA-tag at the N-terminus of Rnq1 to monitor its behaviour, and the 3HA-Rnq1 was over-expressed in hsp104 cells. The 3HA-Rnq1 was functional, as it converted hsp104 cells to Ade+ when the L-PrD-p50 and Hsp104 were coexpressed (Fig. 5B), and the Ade+ cells harbouring only pHSP104 were confirmed as [PSI+] (data not shown). The exogenous expression of 3HA-Rnq1 by itself resulted in the formation of one or two aggregates in approximately 10% of stained hsp104 cells, seven days after transformation. The coexpression of 3HA-Rnq1, L-PrD-p50 and Hsp104 revealed that a small number of the 3HA-Rnq1 aggregates were co-localized with PrD-p50 aggregates (Fig. 5C). Moreover, the co-localization was still observed in a small number of the PrD-p50 aggregates (about 3%) in the absence of Hsp104 expression (Fig. 5D). The co-localized aggregates were also observed in the [PSI+]hsp104 cells that were originally transformed with p3HA-Rnq1, pL-PRD-P50 and pHSP104, and that retained the three plasmids (Fig. 5E). Various sized aggregates were observed in different cultures, but the co-localized aggregates in the [PSI+]hsp104 cells were generally larger than that in hsp104 cells seven days after transformation of the three plasmids (Fig. 5C,D vs. Fig. 5E). These results suggested that 3HA-Rnq1 aggregates functioned as cross-seeds for PrD-p50, and increased the probability of Hsp104-dependent phenotypic change.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Our results appear to suggest that Hsp104 utilizes pre-existing aggregates to produce more polyQ aggregates, and changes endogenous Sup35 from soluble to insoluble, although the mechanism of Hsp104 action is still unclear. One model that has been proposed for Hsp104 function is that it may facilitate the conversion of soluble polyQ or Sup35 into insoluble forms (Patino et al. 1996). Indeed, Hsp104 was reported to promote a conformational change of a protease-sensitive form of PrPc into a protease-resistant form of PrP in the presence of denatured disease-associated PrPscin vitro (DebBurman et al. 1997). In a similar way, Hsp104 may promote the conversion of soluble polyQ or Sup35 by utilizing preexisting aggregates, for example by stabilizing putative folding intermediates if there are any. However, it has been shown that the conversion of soluble Sup35 protein to the aggregated prion form does not require Hsp104 (Ness et al. 2002). We have similarly shown that the requirement of Hsp104 for short polyQ aggregate formation was circumvented by the seeding of long polyQ aggregates, indicating that a conformational change of soluble polyQ to an aggregated form was Hsp104-independent (Kimura et al. 2002). Hence, the conversion processes seemed basically to be Hsp104-independent. Another model that has been also proposed is that Hsp104 may break down polyQ and Sup35 aggregates to increase the number of seeds (Kushnirov & Ter-Avanesyan 1998). To support this hypothesis, the following observations have been made: (1) yeast prion aggregates become larger and fewer when the expression of Hsp104 is terminated (Wegrzyn et al. 2001) and (2) new prion seeds can be produced independently of protein synthesis (Ness et al. 2002). Moreover, in vitro analysis of a variant form of Sup35, which is responsible for Hsp104-independent inheritance in vivo showed the variant forms short amyloid fibers (Crist et al. 2003). In separate studies, it has been shown that Hsp104 in addition to Hsp70 and Hsp40 resolubilizes aggregated proteins (Glover & Lindquist 1998; Parsell et al. 1994). Similarly, ClpB, a member of the Hsp100 family works to break down aggregates in collaboration with an Hsp70 system (Goloubinoff et al. 1999; Motohashi et al. 1999). Moreover, very recent analysis has shown that aggregates of a low molecular weight oligomer of a small peptide from the PrD of Sup35 were disaggregated by Hsp104 in vitro (Narayanan et al. 2003). Therefore, the latter model is more consistent with both previous and our own findings. However, further analysis is required to prove this model. For example, it must be determined whether PrD aggregates, but not aggregates made of a small peptide of PrD are broken down by Hsp104, or whether other cofactors such as Hsp70 and Hsp40 are required.
We have shown that the high-copy expression of PrD (H-PrD-p50) as well as that of PrD without the p50 tag (H-PrD), but not the expression of PrD-p50 in low-copy plasmid (L-PrD-p50) induce the [PSI+] state in hsp104[psi–][pin–] cells when Hsp104 was exogenously expressed. Moreover, by comparing the aggregate formation of H-PrD-p50 and L-PrD-p50 in hsp104 cells we found that a sufficient amount of aggregates containing the PrD is the initial step for the chaperone-dependent epigenetic change. Thus, it could be speculated when the PrD-containing aggregates exceed a threshold value in a cell, Hsp104 might begin to function, for example, by breaking down pre-existing aggregates to increase the number of seeds. This process could act as a stochastic switch for the epigenetic change. Endogenous Sup35 proteins could be incorporated into pre-existing aggregates. Then in the presence of functional Hsp104, the aggregates might propagate, leading to altered heritable traits. Therefore, the same molecular mechanism could be responsible for the establishment and the maintenance of the heritable traits. Although the expression of H-PrD-p50 and Hsp104 converted hsp104[psi–] cells to the [PSI+] state, exogenous Hsp104 failed to increase the aggregate formation of PrD-p50 (Figs 3 and 4). At present, we do not have a clear explanation for the result, but it might be related to the fact that over-expression of a PrD region of Sup35 is toxic to [PSI+] cells (Chernoff et al. 2002). Indeed, most if not all [PSI+]hsp104 cells which were achieved by the introduction of pH-PRD-P50 and pHSP104 lost the pH-PRD-P50 plasmid. Therefore, the aggregates consisting of purely the PrD-p50 might be toxic and cells with the aggregates above a certain level might not be stably maintained. Thus the effects of Hsp104 for aggregate formation of PrD-p50 might not be observed when H-PrD-p50 is expressed.
The results of conversion by the expression of the H-PrD-p50 or H-PrD with Hsp104 also indicate that the [PIN+] requirement for the [PSI+] conversion was circumvented by H-PrD-p50 or H-PrD. Rnq1 that is associated with [PIN+] was indeed soluble in the hsp104[PSI+] cells harbouring pHSP104 that had been originally transformed with pH-PRD-P50 and pHSP104 (unpublished observation). The circumvention of the [PIN+] requirement by the over-expression of the PrD region of Sup35 was previously reported by Derkatch et al. (Derkatch et al. 1997, 2000). They found that the over-expression of PrDs of Sup35 (aa.1–154, aa.1–112) with a particular 17 amino acid extension, but not PrDs with other extensions of amino acids induces the [PSI+] state in [psi–][pin–] cells. However, due to the degradation-prone property of their PrD derivatives, and due to the specific requirement for the 17 amino acid extension, the reason why the expression of their PrDs circumvented the [PIN+] requirement remained unknown. We have shown here that a sufficient amount of PrD aggregates is responsible for circumvention of the [PIN+] requirement. This result was consistent with very recent report that the infection of recombinant PrD into [psi–][pin–] cells circumvented the [PIN+] requirement (Tanaka et al. 2004).
The idea that a sufficient amount of prion aggregates is required for Hsp104-dependent epigenetic change to occur is further supported by the observations that exogenous expression of Rnq1 increased aggregate formation of PrD-p50 in hsp104 cells and before its phenotypic change (Fig. 4). This finding was consistent with the previous finding by others that the expression of a fusion of a prion domain of New1 protein with cyan fluorescent protein (New-CFP) produced its aggregates and enhanced aggregate formation of a fusion of Sup35 PrD with yellow fluorescent protein (Sup-YFP) in hsp104 cells (Osherovich & Weissman 2001). Moreover, the co-localization of some aggregates of PrD-p50 with aggregates of 3HA-Rnq1 suggests that such increase in PrD-p50 aggregation is at least partly due to the cross-seeding by 3HA-Rnq1 aggregates (Fig. 5). Similarly, the co-localization of polyQ aggregates and Rnq1 has also been reported (Meriin et al. 2003). Thus, the previously reported phenomena of [PSI+] prion induction by different prions might be caused by a direct interaction of Sup35 with these prions (Derkatch et al. 2001; Osherovich & Weissman 2001).
We speculate that the relationships among different prions are analogous to the relationships among polyQs with different lengths. Long polyQ forms aggregates on its own more efficiently than short polyQ does. Also aggregates of polyQ can enhance the aggregate formation of short polyQ by seeding. Similarly, different prions may have different abilities to form aggregates on their own. For example prions with a greater ability to form aggregates on their own could enhance the aggregate formation of lesser able prions via cross-seeding. Therefore one of the reasons that Sup35 is dependent on Rnq1 for prionization may be that Rnq1 has a higher intrinsic ability to form aggregates than Sup35.
Finally, since the amount of preexisting aggregates determines both chaperone dependent polyglutamine aggregation and the epigenetic change in yeast prions, the idea of ‘quantitative epigenetics’, which was proposed for morphological variation, might also apply to yeast prion biology and possibly human polyglutamine diseases (Rutherford & Henikoff 2003).
|
Experimental procedures |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Standard yeast media and cultivation procedures were used (Guthrie & Fink 1991). All the experiments were performed at 25 °C unless otherwise indicated. For cells harbouring TRP1-, or ADE2-, or URA3-based plasmids, a medium (SC) containing 0.7% yeast nitrogen base without amino acids, 0.5% casamino acids, and 2% glucose was used. Glucose was replaced with raffinose or galactose to make SCRaf or SCGal, respectively. Tryptophan, adenine or uracil was added when necessary.
In polyglutamine aggregation experiments, W303 (MATa, ade2–1, can1–100, his3–12, 16, leu2–3, 112, trp1–1, ura3–1) and its HSP104 deletion cells were grown to mid-log phase in SCRaf, collected by centrifugation and transferred to SCGal. For yeast prion experiments, 74D-694a cognates (MATa, ade1–14, trp1–289, his3-200, ura3–52, leu2–3, lys2,[psi–]or[PSI+]), and their HSP104 deletion mutant were used (Chernoff et al. 1995). Nonsuppressed ade1–14 mutants are Ade-, and suppression of ade1–14 by [PSI+] allows growth without adenine. Yeast cells transformed with pAUR123 or its derivatives were resistant with 0.5 µg/mL of Aureobasidin A (Takara Biomedicals, Japan). When these plasmids were lost, yeast cells became sensitive to the drug again. To eliminate [PSI+] prions without losing pHSP104, cells were streaked on SD plates-his, along with 5 mM guanidine-hydrochloride (Tuite et al. 1981).
Plasmid construction
Galactose-inducible expression plasmids of pGal-p50-Q34, pGal-p50-Q80 in CEN plasmid (M087 and M088, respectively) and pMGal-p50-Q34 in 2 µ plasmid (M089) have been previously described (Kimura et al. 2001). Low-copy plasmids expressing 3HA-Q34 and 3HA-Q80 under the GPD promoters, pGPD-3HA-Q34 and pGPD-3HA-Q80, respectively, were also previously described (Kimura et al. 2002). For making pHSP104-ADE2, pRS316 was first cut with PstI, blunted, and ligated to a 3.5 kB of ADE2 fragment. The resulting plasmid, ADE2-CEN6 was cut with XhoI, and ligated with an XhoI fragment of the HSP104 gene from pYS104 (a gift from Dr S. Lindquist). The XhoI fragment of HSP104 was also used to create pHSP104 by ligating this fragment with the XhoI vector portion of pRS313. Plasmids containing a missense mutation of HSP104 corresponding to the K218T mutation of Hsp104, were created as follows. First, an EcoRV-EcoRI fragment of HSP104 was cloned into the EcoRV-EcoRI portion of BSII to create E243. Second, a mutation was introduced using E243 and two oligonucleotides (GGTGAGCCAGGTATCGGTACGACCGCTATTATTGAAGGTGT; ACACCTTCAATAATAGCGGTCGTACCGATACCTGGCTCACC) according to the manufacturer's instructions (Stratagene). The BglII-EcoRI fragment from the mutated plasmid was then ligated to the BglII-EcoRI portion of pYS104 to make pYS104 (K218T). To create phsp104(K218T)-ADE2 and phsp104(K218T), an XhoI fragment of pYS104(K218T) was cloned into the XhoI portion of the ADE2-CEN6 and pRS313, respectively. The high-copy plasmid expressing a prion domain of Sup35 with a p50 tag (pH-PRDP50, previously referred to as Sup35N-p50) has been previously described (Kimura et al. 2003). Its low-copy plasmid version (pL-PRD-P50) was created by ligating the SacI-EcoRI fragment from pH-PRD-P50 to the SacI-EcoRI portion of YCplac33 (CEN4, URA3) (Gietz & Sugino 1988). To create a high-copy plasmid expressing the PrD without the p50 tag (pH-PRD), a portion of the SUP35 gene corresponding to the PrD of Sup35 (a.a.1–124) was cloned by PCR using oligonucleotides (ATGAGCTCCTACATACCTTGAGACTGTGGT and TTAATACTAGTAACAATGTCGGATTCAAACCAA) and pH-PRD-P50 as a template. The obtained fragment was then cut with SacI and SpeI, and ligated to the SacI-SpeI portion of pRS426-GPDp. The RNQ1 gene was cloned by PCR using oligonucleotides (RNQ-Kpn: TTAATGGTACCAAAATGGATACGGATAAGTTAAT; RNQ1-Sac: ATGAGCTCTCAGTAGCGGTTCTGGTTGCC) and a genomic library as a template. The obtained fragment was cut with SacI-KpnI, and ligated to the SacI-KpnI fragment of pAUR123 (Takara Biomedicals, Japan) to create pRNQ1. Rnq1 is expressed under the control of constitutive ADH1 promoter in pRNQ1. p3HA-RNQ1 was created first by PCR using pRNQ1 as a template and with oligonucleotides (Kpn3HARNQ: CAAAATGTACCCATACGATGTTCCTGACTATGCGGGCTA
TCCCTATGACGTCCCGGACTATGCAGGATATCCATATGA
CGTTCAGATTACGCTAC; RNQ-565: TGTTGGAATTCATGAAAGAT). The obtained PCR fragment was cut with KpnI and EcoRI, and ligated to the SacI-KpnI of pAUR123 and the SacI-EcoRI fragment of pRNQ1.
Cell staining and microscopic analysis
Immunofluorescence analysis using anti-tag antibodies has been previously described by Kimura (Kimura et al. 2001, 2002). Each experiment was repeated at least three times and performed using new transformants obtained from an independent transformation of plasmids. In each experiment, about 150–250 stained cells were enumerated. Clumps of cells were omitted, and unstained cells were not included in the counting. Similar results were obtained in each independent experiment. As previously reported for cells over-expressing a PrD of Sup35 fused with GFP, ring-like aggregates were observed in addition to dot-like aggregates in the hsp104 cells expressing H-PrD-p50 (Zhou et al. 2001). Both types of the aggregates were counted as aggregates. Since a faint background staining was observed for anti-HA antibody staining, cells which were stained more strongly than cells expressing vector were counted as cells with diffusive staining. The number of cells with one or more aggregate(s) and the number of stained cells from all the repeated experiments were summed, and the ratio of cells with one or more aggregate(s) relative to the total number of stained cells, and standard error were calculated from the sum. For comparison, P-values were calculated according to the 
-square method. From the co-localization experiment by double fluorescence, cells with at least one co-localized aggregate were counted. The possibility of artifacts, such as crossover fluorescence, was excluded by the following experiments: (1) staining cells expressing both 3HA- and p50–tagged proteins with either anti-HA or anti-p50 antibody (2) staining cells expressing 3HA- or p50-tagged proteins with an alternative antibody (that is, anti-p50 or anti-HA antibody only) (3) staining cells with only secondary antibodies.
Immunoblot analysis
Immunoblot analysis was performed as previously described (Kimura et al. 2001).
Sedimentation analysis
Sedimentation analysis was performed according to Liu et al. (2002), except that Zymolyase 20T was used at 0.83 mg/mL instead of Zymolyase 100T. Rabbit anti-Sup35 antibody was made using a synthetic peptide corresponding to a.a. 494–507 of Sup35 as an antigen. Rabbit anti-Rnq1 antibody was made using a synthetic peptide, CSQQNNNGNQNRY, corresponding to the C-terminus region of Rnq1 as an antigen, and the serum was affinity-purified against the peptide. Anti-Hsp104 antibody was purchased from StressGen (Victoria, BC Canada).
|
Acknowledgements |
|---|
|
Footnotes |
|---|
*Correspondence: E-mail: ykimura{at}rinshoken.or.jp
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionExperimental proceduresReferences |
|---|
Chernoff, Y.O., Lindquist, S.L., Ono, B., Inge-Vechtomov, S.G. & Liebman, S.W. (1995) Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880–884.
Chernoff, Y.O., Uptain, S.M. & Lindquist, S.L. (2002) Analysis of prion factors in yeast. Meth Enzymol. 351, 499–538.[Medline]
Crist, C.G., Nakayashiki, T., Kurahashi, H. & Nakamura, Y. (2003) [PHI+], a novel Sup35-prion variant propagated with non-Gln/Asn oligopeptide repeats in the absence of the chaperone protein Hsp104. Genes Cells 8, 603–618.[Abstract]
DebBurman, S.K., Raymond, G.J., Caughey, B. & Lindquist, S. (1997) Chaperone-supervised conversion of prion protein to its protease-resistant form. Proc. Natl. Acad. Sci. USA 94, 13938–13943.
DePace, A.H., Santoso, A., Hillner, P. & Weissman, J.S. (1998) A critical role for amino-terminal glutamine/asparagine repeats in the formation and propagation of a yeast prion. Cell 93, 1241–1252.[CrossRef][Medline]
Derkatch, I.L., Bradley, M.E., Hong, J.Y. & Liebman, S.W. (2001) Prions affect the appearance of other prions: the story of [PIN (+)]. Cell 106, 171–182.[CrossRef][Medline]
Derkatch, I.L., Bradley, M.E., Masse, S.V., et al. (2000) Dependence and independence of [PSI (+)] and [PIN (+)]: a two-prion system in yeast? EMBO J. 19, 1942–1952.[CrossRef][Medline]
Derkatch, I.L., Bradley, M.E., Zhou, P., Chernoff, Y.O. & Liebman, S.W. (1997) Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae. Genetics 147, 507–519.[Abstract]
Derkatch, I.L., Chernoff, Y.O., Kushnirov, V.V., Inge-Vechtomov, S.G. & Liebman, S.W. (1996) Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics 144, 1375–1386.[Abstract]
DiFiglia, M., Sapp, E., Chase, K.O., et al. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science 277, 1990–1993.
Gietz, R.D. & Sugino, A. (1988) New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527–534.[CrossRef][Medline]
Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J. & Lindquist, S. (1997) Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae. Cell 89, 811–819.[CrossRef][Medline]
Glover, J.R. & Lindquist, S. (1998) Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 94, 73–82.[CrossRef][Medline]
Goloubinoff, P., Mogk, A., Zvi, A.P., Tomoyasu, T. & Bukau, B. (1999) Sequential mechanism of solubilization and refolding of stable protein aggregates by a bichaperone network. Proc. Natl. Acad. Sci. USA 96, 13732–13737.
Guthrie, C. & Fink, G.R. (1991) Methods in Enzymology. New York: Academic press, Inc.
Higashiyama, H., Hirose, F., Yamaguchi, M., et al. (2002) Identification of ter94, Drosophila VCP, as a modulator of polyglutamine-induced neurodegeneration. Cell Death Differ. 9, 264–273.[CrossRef][Medline]
Hirabayashi, M., Inoue, K., Tanaka, K., et al. (2001) VCP/p97 in abnormal protein aggregates, cytoplasmic vacuoles, and cell death, phenotypes relevant to neurodegeneration. Cell Death Differ. 8, 977–984.[CrossRef][Medline]
Huang, C.C., Faber, P.W., Persichetti, F., et al. (1998) Amyloid formation by mutant huntingtin: threshold, progressivity and recruitment of normal polyglutamine proteins. Somatic Cell Mol. Genet. 24, 217–233.[CrossRef][Medline]
Kimura, Y. & Kakizuka, A. (2003) Polyglutamine diseases and molecular chaperones. IUBMB Life 55, 337–345.[Medline]
Kimura, Y., Koitabashi, S. & Fujita, T. (2003) Analysis of yeast prion aggregates with amyloid-staining compound in vivo. Cell Struct. Funct. 28, 187–193.[CrossRef][Medline]
Kimura, Y., Koitabashi, S., Kakizuka, A. & Fujita, T. (2001) Initial process of polyglutamine aggregate formation in vivo. Genes Cells 6, 887–897.[Abstract]
Kimura, Y., Koitabashi, S., Kakizuka, A. & Fujita, T. (2002) Circumvention of Chaperone Requirement for Aggregate Formation of a Short Polyglutamine Tract by the Co-expression of a Long Polyglutamine Tract. J. Biol. Chem. 277, 37536–37541.
King, C.Y. & Diaz-Avalos, R. (2004) Protein-only transmission of three yeast prion strains. Nature 428, 319–323.[CrossRef][Medline]
King, C.Y., Tittmann, P., Gross, H., Gebert, R., Aebi, M. & Wuthrich, K. (1997) Prion-inducing domain 2–114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc. Natl. Acad. Sci. USA 94, 6618–6622.
Krobitsch, S. & Lindquist, S. (2000) Aggregation of huntingtin in yeast varies with the length of the polyglutamine expansion and the expression of chaperone proteins. Proc. Natl. Acad. Sci. USA 97, 1589–1594.
Kushnirov, V.V. & Ter-Avanesyan, M.D. (1998) Structure and replication of yeast prions. Cell 94, 13–16.[CrossRef][Medline]
Liu, J.J., Sondheimer, N. & Lindquist, S.L. (2002) Changes in the middle region of Sup35 profoundly alter the nature of epigenetic inheritance for the yeast prion [PSI+]. Proc. Natl. Acad. Sci. USA 99 (Suppl. 4), 16446–16453.
Meriin, A.B., Zhang, X., He, X., Newnam, G.P., Chernoff, Y.O. & Sherman, M.Y. (2002) Huntington toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. J. Cell Biol. 157, 997–1004.
Meriin, A.B., Zhang, X., Miliaras, N.B., et al. (2003) Aggregation of expanded polyglutamine domain in yeast leads to defects in endocytosis. Mol. Cell. Biol. 23, 7554–7565.
Moriyama, H., Edskes, H.K. & Wickner, R.B. (2000) [URE3] prion propagation in Saccharomyces cerevisiae: requirement for chaperone Hsp104 and curing by overexpressed chaperone Ydj1p. Mol. Cell. Biol. 20, 8916–8922.
Motohashi, K., Watanabe, Y., Yohda, M. & Yoshida, M. (1999) Heat-inactivated proteins are rescued by the DnaK.J-GrpE set and ClpB chaperones. Proc. Natl. Acad. Sci. USA 96, 7184–7189.
Narayanan, S., Bosl, B., Walter, S. & Reif, B. (2003) Importance of low-oligomeric-weight species for prion propagation in the yeast prion system Sup35/Hsp104. Proc. Natl. Acad. Sci. USA 100, 9286–9291.
Ness, F., Ferreira, P., Cox, B.S. & Tuite, M.F. (2002) Guanidine hydrochloride inhibits the generation ofCM prion ‘seeds’ but not prion protein aggregation in yeast. Mol. Cell. Biol. 22, 5593–5605.
Osherovich, L.Z. & Weissman, J.S. (2001) Multiple Gln/Asn-rich prion domains confer susceptibility to induction of the yeast [PSI (+) ] prion. Cell 106, 183–194.[CrossRef][Medline]
Parsell, D.A., Kowal, A.S., Singer, M.A. & Lindquist, S. (1994) Protein disaggregation mediated by heat-shock protein Hsp104. Nature 372, 475–478.[CrossRef][Medline]
Parsell, D.A., Sanchez, Y., Stitzel, J.D. & Lindquist, S. (1991) Hsp104 is a highly conserved protein with two essential nucleotide-binding sites. Nature 353, 270–273.[CrossRef][Medline]
Patino, M.M., Liu, J.J., Glover, J.R. & Lindquist, S. (1996) Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273, 622–626.[Abstract]
Paushkin, S.V., Kushnirov, V.V., Smirnov, V.N. & Ter-Avanesyan, M.D. (1996) Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor. EMBO J. 15, 3127–3134.[Medline]
Ross, C.A., Poirier, M.A., Wanker, E.E. & Amzel, M. (2003) Polyglutamine fibrillogenesis: the pathway unfolds. Proc. Natl. Acad. Sci. USA 100, 1–3.
Rutherford, S.L. & Henikoff, S. (2003) Quantitative epigenetics. Nature Genet. 33, 6–8.[CrossRef][Medline]
Sanchez, Y. & Lindquist, S.L. (1990) HSP104 required for induced thermotolerance. Science 248, 1112–1115.
Scherzinger, E., Lurz, R., Turmaine, M., et al. (1997) Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90, 549–558.[CrossRef][Medline]
Scherzinger, E., Sittler, A., Schweiger, K., et al. (1999) Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proc. Natl. Acad. Sci. USA 96, 4604–4609.
Serio, T.R. & Lindquist, S.L. (2001) [PSI+], SUP35, and chaperones. Adv. Protein Chem. 57, 335–366.[Medline]
Sondheimer, N. & Lindquist, S. (2000) Rnq1: an epigenetic modifier of protein function in yeast. Mol. Cell 5, 163–172.[CrossRef][Medline]
Tanaka, M., Chien, P., Naber, N., Cooke, R. & Weissman, J.S. (2004) Conformational variations in an infectious protein determine prion strain differences. Nature 428, 323–328.[CrossRef][Medline]
Ter-Avanesyan, M.D., Dagkesamanskaya, A.R., Kushnirov, V.V. & Smirnov, V.N. (1994) The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics 137, 671–676.[Abstract]
Tuite, M.F., Mundy, C.R. & Cox, B.S. (1981) Agents that cause a high frequency of genetic change from [psi+] to [psi–] in Saccharomyces cerevisiae. Genetics 98, 691–711.
Wegrzyn, R.D., Bapat, K., Newnam, G.P., Zink, A.D. & Chernoff, Y.O. (2001) Mechanism of prion loss after Hsp104 inactivation in yeast. Mol. Cell. Biol. 21, 4656–4669.
Wickner, R.B. (1994) [URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science 264, 566–569.
Zhou, P., Derkatch, I.L. & Liebman, S.W. (2001) The relationship between visible intracellular aggregates that appear after overexpression of Sup35 and the yeast prion-like elements [PSI (+)] and [PIN (+) ]. Mol. Microbiol. 39, 37–46.[CrossRef][Medline]
Zoghbi, H.Y. & Orr, H.T. (2000) Glutamine repeats and neurodegeneration. Annu. Rev. Neurosci. 23, 217–247.[CrossRef][Medline]
Received: 5 April 2004
Accepted: 28 May 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | ADVANCED SEARCH | TABLE OF CONTENTS |
