|
|
||||||||
1 Department of Developmental Biology, National Institute for Basic Biology, Okazaki, 444-8585 Japan
2
Department of Chemistry and Biotechnology, School of Engineering, The University of Tokyo, 1-3-7 Hongo, Bunkyo-ku, Tokyo, 113-8656 Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Xenopus is a model organism whose ESTs have been collected in a large-scale project and the genomic DNA is being sequenced. Combination of DNA information and its experimental advantages, such as ease of surgical operation and microinjection, provides a promising future for understanding developmental events remained to be solved.
FGFs are a family of polypeptides that regulate a number of biological phenomena including cell proliferation, differentiation and migration. In particular, FGFs are known to participate in early embryonic inductions, such as mesoderm induction and in cell-to-cell interactions during organogenesis known as epithelial-mesenchymal interactions (reviewed in Gotoh & Nishida 1996). In the central nervous system, FGF signals are not only implicated in neural induction, but also are believed to be essential for the patterning that includes the formation of the telencephalon and the midbrain-hindbrain barrier (MHB) (Walshe et al. 2002). In Xenopus, the roles of FGF signals have been studied extensively, and they have been shown to regulate mesoderm induction as well as the patterning of anterior-posterior axis. In mesoderm induction, embryonic FGF (eFGF) signal induces Xbra, which in turn activates the transcription of eFGF constituting a closed autoregulatory circuit (Musci et al. 1990; Amaya et al. 1991; Smith et al. 1991; Amaya et al. 1993; Gotoh et al. 1995). More recently, it has been proposed that FGF signal is also essential for the convergent extension of gastrulation cell movements and the signalling pathway regulating it differs from the one that regulates mesoderm induction (Nutt et al. 2001; Frazzetto et al. 2002).
It is well established that FGF family ligands signal thorough receptor tyrosine kinases, whose phosphorylation in turn triggers cytoplasmic events that transmit the external signal to the nucleus. For mesoderm induction, FGF signal is known to activate a canonical MAPK pathway in a ras-dependent fashion (reviewed in Gotoh & Nishida 1996). In contrast, the pathway regulating convergent extension is sensitive to an FGF signal inhibitor, Sprouty2 (Nutt et al. 2001). It is not clear how the FGF signal is bifurcated into these two distinct pathways. To achieve this, we took advantage of differential screening with DNA-microarray that was recently fabricated in our laboratory using 4600 Xenopus embryonic cDNAs and SU5402, which induces conformational changes in the nucleotide-binding loop of FGFR by producing hydrogen bond between the side chain in the hinge region of FGFR and the carboxyehyl group of it. SU5402 treatment of mammalian cells was previously shown to dramatically inhibit the activation of ERK (Mohammadi et al. 1997).
This genome-wide approach enabled us to identify 43 candidates as general FGF targets and 10 of them are promising candidates for components specifically acting in gastrulation cell movements. We performed functional analyses of two interesting genes. Here, we show that a homolog of mammalian mig6 regulates Xmyf5 expression and hence is essential for muscle differentiation and that a GPCR4 homolog is required for gastrulation cell movement during Xenopus embryogenesis.
| Results |
|---|
|
|
|---|
The approximate concentration of SU5402 needed to block endogenous FGF signalling was determined according to previous studies of the ascidian, zebrafish, chick, and mouse (Hoffman et al. 2002; Mohammadi et al. 1997; Kim & Nishida 2001; Shinya et al. 2001; Montero et al. 2001; Malcolm et al. 2002). The effectiveness of SU5402 in shutting down the FGF signalling was confirmed by Western blotting with anti-phosphorylated-ERK antibody (Fig. S1A). We compared the amount of dp-ERK (diphosphorylated ERK) in eFGF-stimulated Keller explants either exposed to 50 µm SU5402 or over-expressing XFD or HAVØ, an inert form of XFD. Dose-dependent signal induction by eFGF and inhibition by XFD were confirmed. Compared with XFD, SU5402 treatment led to a more drastic inhibition of dp-ERK activation. This was consistent with the results of microarray analysis: data set of SU5402 included those of XFD (data not shown).
To determine the effective dose of SU5402, embryos and Keller explants were treated with 5 µM to 100 µM of SU5402 for the entire time from early gastrula to tailbud stage, and changes in morphology were examined. Compared with the DMSO-treated control, SU5402-exposed embryos exhibited incomplete closure of the blastopore, a short trunk and hardly distinguishable anterior-posterior structures; these changes increased in severity in a dose-dependent fashion. Fifty micromolar SU5402 was sufficient to inhibit the gastrulation of whole embryos and elongation of Keller explants, respectively.
Next, we investigated the effects of changing the time of exposure to SU5402 by morphological observation and by RT-PCR analysis. SU5402 was added to culture medium around the onset of gastrulation, i.e. stage 10.5, and was removed at stage 11.5. This relatively short exposure also caused the retardation of involution, leading to the incomplete closure of the blastopore and short trunk. Similarly, the exposed Keller explants displayed complete failure of elongation (Fig. S1B).
The expression pattern of marker genes in the Keller explants was investigated by RT-PCR analysis (data not shown). The results were consistent with previous reports (Amaya et al. 1993; Nutt et al. 2001; Malcolm et al. 2002; Monsoro-Burq et al. 2003): mesodermal markers including Xbra, myoD, myf5, and
-actin, as well as non-mesodermal markers, Xspry2 and Xmc, were down-regulated by SU5402. The neural markers we tested, the spinal chord marker HoxB9, presumptive notochord marker Xnot, and posterior marker Krox20 were also suppressed. More anterior markers, such as Otx-2 and En-2, exhibited unchanged or up-regulated expression, and the cement gland marker AG-1 was up-regulated. These results are consistent with the known function of FGF as a posteriorizing factor. Immunostaining with the MZ15 antibody showed that the notochord was partially present in the anterior but not in the posterior structures. Prolonged exposure to SU5402 exaggerated the above gene expression profile.
Microarray analysis of Keller explants
Changes in the gene expression pattern in the Keller explants cultured in the presence of SU5402 were analysed using NIBB non-redundant 4.6-K microarray. Explants from stage 10.5 embryos were treated with DMSO or 50 µM SU5402 until the sibling embryos reached stage 11.5. Through the microarray analysis shown as Fig. 1A and Table 1, we isolated 43 genes whose expression was affected by SU5402, including 38 down- regulated genes (ratio < 2) and 5 up-regulated ones (ratio > 2) (Fig. 1B), suggesting that FGF signalling functions mostly in transcriptional activation.
|
|
The details of the functional classification of these genes are given in Fig. 1D. The genes obtained by our screen included transcription factors, transport-related genes, transmembrane proteins, scaffolding proteins, growth factors, and cell-cycle regulating protein, among others.
Whole-mount in situ hybridization analysis of identified genes
The spatiotemporal expression patterns of the identified gene were investigated by careful comparison with FGFR1, because FGFR1-specific inhibitor was used in this screen. Since the candidate genes we chose were specifically expressed at higher levels in the blastopore region in the gastrula, we focused on expression during gastrula. The expression patterns of the novel genes are described briefly and shown in Fig. 2. The expression domains of all the identified genes are summarized in Table 1.
|
Confirmation of FGF target genes by semiquantitative RT-PCR analysis and WISH
To confirm the reliability and reproducibility of the microarray analysis in the context of molecular embryology, semiquantitative RT-PCR was performed for the identified genes (Fig. 3). FGF target genes Xbtg1 (Saka et al. 2000) and derriere (White et al. 2002), which were found to be down-regulated by microarray analysis, showed FGF-dependent up-regulation and XFD/SU5402-dependent down-regulation. Up-regulated genes in the microarray analysis Xhox7.1 and XGATA4 showed FGF-dependent down-regulation and XFD/SU5402-dependent up-regulation, thus confirming the effectiveness of the microarray approach. Other familiar FGF targets that were excluded from the microarray Xbra, Xwnt11, eFGF, Xspry2, and Xmc displayed FGF- and SU5402-dependent responses (data not shown), demonstrating that the experiments were designed properly.
|
We further confirmed that the genes we identified were FGF targets via WISH (Fig. S2A). The expression of FGF target genes fkh5, ESR5, and derriere diminished in XFD-injected embryos. ARL5, mig6, and NRH also displayed XFD-dependent loss of expression. GPCR4, XL011a24, and other identified genes exhibited similar regulation profiles.
Through the RT-PCR and WISH analyses, we confirmed FGF-dependent regulation of identified genes. That is, the genes that were down-regulated in the microarray analysis showed up-regulation in response to eFGF and down-regulation in response to XFD or SU5402. Moreover, Xhox7.1 and XGATA4, which exhibited up-regulation in the microarray analysis, were down-regulated in response to eFGF and up-regulated is response to XFD or SU5402. These two unequivocal results demonstrate the reliability of the microarray analysis.
How are the novel genes relevant to FGF signalling pathways?
Results obtained in Xenopus have shown that FGFs are involved in early mesodermal inductive signals and in the maintenance of Xbra expression. More recently, Xspry2 was shown to prevent convergent extension movements during gastrulation but not to prevent mesodermal induction and patterning (Nutt et al. 2001). To understand how our candidates are related to known FGF components, we carried out RT-PCR and WISH of embryos that received injection of RNAs of the novel genes as well as of embryos that were injected with the RNAs of known FGF components (Fig. 4).
|
We also used a specific MEK inhibitor, U0126 (Kim & Nishida 2001) to investigate whether the regulation of the novel FGF target genes depended on Ras-MAPK signalling. Although other genes were stable when Xbra expression was completely suppressed, mig6 was thoroughly down-regulated, suggesting that mig6 is specifically regulated by Ras-MAPK signalling and by Xbra (Fig. 4B).
Xenopus mig6 (Xmig6) is regulated brachyury-dependent manner
The profile of Xmig6 transcriptional regulation described above, namely, activation by FGFs or Xbra and inhibition by XFD, SU5402, or U0126, suggested that Xmig6 might be involved in mesodermal induction during early embryogenesis. To determine this we again used U0126 and MAPK phosphatase (XCL100 or MKP-1) to inhibit Ras-MAPK signalling pathway (Keyse & Emslie 1992; Gotoh & Nishida 1996; Favata et al. 1998; LaBonne et al. 1995). The ectopic induction of Xmig6 by eFGF was completely down-regulated by XCL100 and severely suppressed by Xbra-EnR (Conlon et al. 1996) (Fig. 5A). In the presence of U0126, ectopically induced Xmig6 by eFGF was completely suppressed but this induction was unaffected by Xbra co-injection. The up-regulation of Xmig6 by Xbra was not affected by U0126 (Fig. 5B) or XCL100 (data not shown). These results suggest that Xmig6 is regulated by FGF-MAPK-bra pathway.
|
Xmig6 encodes a polypeptide of 404 amino acids that shares a ~56% sequence identity with mouse and human mig6, which consist of 461 and 462 amino acids, respectively (Fig. S3). Database analysis revealed that mig6 contains a potential CRIB domain, SH3 domain, 14-3-3 domain, and ACK-related non-receptor tyrosine kinase domain (AH domain). These proteins share well-conserved serine/proline-rich carboxy-terminal domains (Makkinje et al. 2000; Hackel et al. 2001).
Because of the way Xmig6 was regulated, we scrutinized the relationship between Xmig6 and the downstream signalling of FGF in mesodermal induction. To confirm that the Xmig6 MO (morpholino antisense-oligonucleolide)-specific transcription inhibition was specific, we used Western blotting (Fig. 6A). Xmig6 MO was specifically inhibiting transcription of 5' UTR including the Xmig6 venus-tagged (Nagai et al. 2002) construct since the Xmig6 MO recognizes the 5' UTR sequence. But this inhibition was rescued using a full length Xmig6 construct. We examined the role of mig6 in regulating other mesodermal markers using Xmig6 MO to suppress mig6 function. The result of WISH revealed that the knockdown of Xmig6 by the MO completely abolished Xmyf5 expression (Fig. 6B). The expression of Xbra and Xnot was intact, as revealed by WISH (Fig. 6B) and RT-PCR analyses (Fig. 6C). The down-regulation of Xmyf5 by the Xmig6 MO was also efficiently reversed by co-injecting mig6 mRNA construct (Fig. 6B). However, another muscle marker XmyoD was only partially down-regulated. Together, these data prove the specificity of the Xmig6 MO. About 30% (6 of 20) embryos that were mig6 depleted lacked well-differentiated muscle, as assessed by immunostaining with the muscle-specific antibody, 12/101. No change was found in the notochord (Fig. 6D). Although Xmig6 MO showed Xmyf5-specific down-regulation, Xmig6 itself did not induce Xmyf5 in the whole embryos when over-expressed (data not shown). In higher doses of Xmig6 (> 500 pg), the embryos showed abnormal cell division (data not shown). The results suggest that Xmig6 is a potential downstream gene of eFGF and Xbra, and has specific roles in muscle differentiation that are mediated in an Xmyf5-dependent fashion.
|
We examined the role in early embryogenesis of novel Xenopus GPCR4 (XGPCR4), which most likely to encode a G-protein coupled receptor. As little is known about the molecular nature of GPCR4, we first searched the database for homologous sequences. GPCR4 shares homology with several other GPCRs, including ORG1, G2A, T-cell death associated gene 8, and 12 A. These have
51% sequence identity to each other and approximately 30% sequence identity with the platelet-activating factor (PAF) receptor. XGPCR4, whose cDNA sequence contained an open reading frame of 364 amino acids, shared 36% and 55% sequence identity with human and porcine GPCR4 and 35% and 55% identity with murine and rat GPCR4, respectively (Zhu et al. 2001; Xu 2002). XGPCR4 contains 7 passed transmembrane protein from 33 to 284.
To expand our understanding of GPCR4 in early embryogenesis we carried out gain-of-function and loss-of-function analyses. XGPCR4 mRNA-injected embryos showed dose-dependently incomplete closure of the blastopore and spina bifida (Fig. 7A). We examined the XGPCR4 MO-mediated transcription inhibition (Fig. 7B) and phenotypes using mut-XGPCR4 (rescue construct) mRNA and one including the 5' UTR. To obtain molecular clues regarding the role of GPCR4, WISH and RT-PCR analyses were performed. Neither XGPCR mRNA-injected embryos (Fig. S2B) nor XGPCR4 MO-injected embryos showed perturbed expression of Xbra, Xwnt11, Xgsc (Fig. 7C). XGPCR4 MO-injected embryos displayed gastrulation defects and a dorsal open phenotype or short trunk (Fig. 7D). Using a rescue construct we tried to rescue the spina bifida phenotype caused by the MO-induced XGPCR4 knockdown. We achieved a partial rescue: the occurrence of short trunk and spina bifida decreased from 53% to 24%, and the percentage of normal embryos doubled (Fig. 7D).
|
Although the physiological roles of GPCR4 remain unclear, our data may suggest that GPCR4 is a promising candidate for the component that acts exclusively in the FGF pathway to regulate gastrulation. In other species, several studies of GPCR4 homologues have reported a receptor-ligand relationship and receptor-mediated signal transduction (reviewed in Xu 2002). To gain more insight into the role of GPCR4, we are currently investigating how it is involved in gastrulation cell movement.
| Discussions |
|---|
|
|
|---|
Much effort has been spent trying to elucidate the role of FGF signalling in embryonic development (Hoffman et al. 2002; Pownall et al. 2003; Tateossian et al. 2004), and a number of genes that regulate or modify FGF signalling have been identified (Gotoh & Nishida 1996; Walshe et al. 2002; Musci et al. 1990; Amaya et al. 1991, 1993; Smith et al. 1991; Nutt et al. 2001; Frazzetto et al. 2002; Malcolm et al. 2002; Monsoro-Burq et al. 2003; Saka et al. 2000; White et al. 2002). Although all these results have contributed to our understanding of the molecular mechanisms of FGF signalling, many experiments, particularly those using Xenopus, have been performed on whole embryos using gain-of-function assay or induction. These approaches, however, can be difficult to interpret, because it is hard to distinguish direct action on the target tissues from indirect actions on other tissues. In addition, a critical technical limitation is the incomplete diffusion of the injected RNA. This may introduce mosaic expression of the injected RNA and dispersion in the experiment. Drug treatment has some advantages over conventional approaches. For instance, a larger number of developing embryos can be treated. It is easy to control the exposure time to the drug, permitting transient or semipermanent exposure, which is difficult to do with microinjection. By treating embryos at various developmental stages, the researcher can determine the critical period for FGF signalling in embryos by restricting the hours of treatment and anatomical classification. The use of SU5402 allowed us to study the role of FGF signalling at a desired point, e.g. the gastrula in this report, and to focus on signal molecules that are specifically expressed in the developing dorsal marginal zone.
In this study we successfully introduced a combinatorial screening strategy using Keller explants, SU5402, and subtraction by microarray analysis, and we achieved our primary goalto identify FGF target genes that are expressed during gastrulation. The genes we identified included a number of well-known FGF target genes (Fig. 1 and Table 1). The finding of known FGF targets implies high-fidelity of the microarray analysis. Through the analysis of two interesting genes, we expanded our understanding of when and how two different FGF pathways bifurcate during embryogenesis.
The inhibitory effects of SU5402 on gene expression and morphology were very similar to those of XFD (Amaya et al. 1993) but showed more diverse phenotypes. In stage-subdividing experiments, treatment starting at the late gastrula caused severe neural tube closure defect, but the effect was minimal in embryos treated from the mid-neurula. By assaying the elongation of Keller explants, we demonstrated that the inhibitory effect of SU5402 was most pronounced when applied to stage 10.511.5 embryos. Our data imply that there must exist a critical and/or sensitive period during which FGF signalling exerts its influence on convergent extension movements. In addition, the divergent phenotypes may suggest a multiple function or recursive role of FGF in embryogenesis. We found this discovery intriguing, and we further accumulated convincing clues through stage-subdividing microarray analysis (unpublished data) and the functional analysis of two interesting genes, mig6 and GPCR4, in developing embryos. Interestingly, microarray analyses from stage 10.511.5 and 10.515 identified many overlapping genes but they did not necessarily exclude genes related to mesodermal induction (unpublished data); mig6 was one such gene.
Mig6 may act as an adaptor molecule that interacts with other proteins through CRIB, 14-3-3, and/or SH3 domains (Makkinje et al. 2000; Hackel et al. 2001). Mig6 is reported to be a binding partner of the EGFR and to antagonize EGF signalling but not FGF (Hackel et al. 2001). Here, we demonstrated that Xmig6 expression was induced by FGF and Xbra and depleted by FGF inhibitor, MAKK inhibitor, and Xbra repressor. Xmig6 is regulated by FGF-MAPK-Xbra pathway and regulates muscle differentiation Xmyf5-depentently. Thus, we speculate that the interactions mediated by the domains named above modulate FGF signalling and regulate tissue specification by relaying FGF, Xbra, and Xmyf5 signal.
GPCR4 is most highly expressed in the placenta, lung, liver, skeletal muscle, ovary, lymph node and heart. It shares a significant identity with the ORG1 subfamily, which are specific receptors for sphingosylphosphorylcholine (SPC) and lysophosphatidylcholine (LPC). Like ORG1, mGPCR4 responds to both SPC and LPC, although less to the latter (Xu et al. 2000; Xu 2002). SPC is a bioactive lipid that regulates diverse cellular functions, including proliferation, growth inhibition, muscle contraction, and wound healing. SPC stimulates signalling pathways that induce protein tyrosine phosphorylation, activate MAP kinase and/or protein kinase C (PKC), modify ion channel activity, and increase intracellular calcium concentrations. GPCR4 mediates not only an SPC-induced PMA (phorbol myristate acetate)-sensitive intracellular calcium increase, but also PTX (pertussis toxin)-sensitive ERK activation, suggesting that PKC activity and the Gi/o type of G protein are involved. Ligands of GPCR4 induce cell shape changes, suggesting that SPC and LPC might affect the cellular cytoskeleton. In fact, Rho-dependent activities induced by SPC through its receptors include actin rearrangement and cell migration (Zhu et al. 2001; Xu 2002). Further investigation will be required to understand the role and signalling mechanism of GPCR4 in embryogenesis.
FGF signalling controls a diverse array of developmental events, but the number of signal bifurcations and how these branches collaborate is still unclear. MAPK-dependent pathway is a well-characterized pathway and is essential for mesodermal induction and patterning. Among the FGF targets identified in this study, only mig6 showed MAPK-dependent transcription regulation. GPCR4 was insensitive to any known FGF components, but showed perturbation of cell movement when it was depleted. It might regulate PKC or a calcium-dependent pathway or some other novel pathway.
Although the present study has demonstrated that microarray analysis combined with specific inhibitors is very efficient for uncovering novel FGF target genes and has implied potential for dissecting other signalling pathways, the method could be improved in a number of ways. One is to apply cyclohexamide to growth factor-stimulated animal caps to identify the earliest responsive target genes. We believe that such modifications of the analysis should lead to the identification of more novel genes and help us solve some important questions.
| Experimental procedures |
|---|
|
|
|---|
Xenopus eggs were collected as described (Yamamoto et al. 2001) and the embryos were staged according to Nieuwkoop and Faber (Nieuwkoop & Faber 1967). Keller explants were excised at stage 10.5 and placed in 1x Steinberg's solution supplemented with 0.1% bovine serum albumin (BSA) and then were incubated with 50 µM SU5402 (Calbiochem, CA, USA) or DMSO until the stages of interest were reached. Plasmids to be used for microinjections, were linearized with NotI. Capped mRNAs were synthesized with an mMESSAGE mMACHINE kit (Ambion, Austin, TX, USA) and purified on a NICK column (Pharmacia, Uppsala, Sweden). All plasmids were transcribed with SP6 polymerase.
Western blotting
To investigate the effects of SU5402 on Xenopus embryos, dominant-negative form of the FGFR (XFD) RNAs and eFGF RNAs were injected into the two dorsal cells of 4-cell-stage embryos. Ten Keller explants, embryonic explants consisting of presumptive dorsal mesoderm and neuroectoderm, were dissected at stage 10.5 and exposed to SU5402. These explants were incubated until stage 11.5. Explants that either received injection or were exposed to SU5402 were homogenized in 100 µL lysis buffer (50 mM Tris-Cl [pH 7.4], 150 mM NaCl, 50 mM NaF, 5 mM EDTA, 0.5% NP-40, 1 mM Na3VO4), with the exception that 1 mM p-APMSF, 10 µg/mL aprotinin, 20 µg/mL leupeptin, 10 µg/mL pepstatin, and 1 mM DTT were added to lysis buffer as indicated. Uninjected explants were used as an internal loading control. Boiled lysates (10 µL) were separated by 10% SDS-PAGE, transferred to PDVF membranes (BIO-RAD, CA, USA), and then immunoblotted as described (Nutt et al. 2001).
Microarray
NIBB cDNA microarray ver.1 was prepared using the tentatively selected non-redundant 4600 cDNA set from the NIBB Mochii normalized gastrula and tailbud cDNA libraries for the NIBB/NIG Xenopus laevis EST project (A. Kitayama, unpublished). The list of the cDNA genes that were spotted is available on our web site, XDB (http://xenopus.nibb.ac.jp).
Total RNAs were extracted by TRIzolTM reagent (Life Technologies, Carlsbad, CA, USA) from 10 Keller explants that were or were not treated with SU5402. Using these total RNAs (
1 µg), T7 RNA polymerase-based mRNA amplification was carried out with a RiboAmp RNA Amplification Kit (ARCTURUS). Five micrograms of anti-sense RNA from each sample was labelled with Cy3- or Cy5-dCTP (Amersham, Stockholm, Sweden) using random primers and SuperScriptII reverse transcriptase (Life Technologies).
Hybridization and washing were carried out according to the slide manufacture's protocol (Amersham). Scanning was performed on a GenePix 4000B (Axon, Union City, CA) to generate two 16-bit TIFF images corresponding to the Cy3 and Cy5 channels. After image analysis using GenePix Pro 3.0 or 4.1 (Axon), the data were analysed with an Excel-based analysis tool MarC-V (Schageman et al. 2002).
RNA isolation and RT-PCR assays
Total RNA was isolated from 10 explants using TrizolTM reagent, according to the manufacturer's instructions. Isolated RNAs from the explants were used for cDNA synthesis in the presence of 2 mM dNTP, 0.1 M DTT, 5X first strand buffer, RNase inhibitor, and Reverse Transcriptase (M-MLV, Life Technologies) in a 20 µL reaction volume for 1 h at 37 °C. A-twentieth volume of cDNA was used for PCR amplification with Ampli Taq polymerase (Applied Biosystems, Branchburg, NJ). The primer pairs and number of cycles used in this study were as follows: Xbtg1 (20) 5'GTTTCATCACGAAGTTCCTC3' (F) and 5'-CTGGCTGCTGAGTCCAATAC3' (R), XGATA4 (20) 5'AGCAGAGAGGTCTCCTACAGT3' (F) and 5'TCTATGTTTGGGTGCCTTGA3' (R), ARL5 (20) 5'TCATCAGTGTTGGACACTTA3' (F) and 5'AGCGATCATGAGCAACTCTGT3' (R), GPCR4 (18) 5'TCTGATGTGCTGTGAAGTCT3' (F) and 5'ACTATAAAGACACTGCTGTA3' (R), NRH (18) 5'ACGTGGTGAGAACAGCACTA3' (F) and 5'TGTATCAAGGAAGACGCCACT3' (R), Xspry2 (18) 5'TCTGCTCCACGACAGACTACCCA3' (F) and 5'TCAGGTTTAGGCTGTACTCGAAT3' (R), Xmc (20) 5'ATTCAGGTGAGGTACAGCTC3' (F) and 5'AAACATCCCTTGTCCTTCGCTG3' (R). PCR products were separated on 6% non-denaturing polyacrylamide gels and visualized by CYBR GreenI staining. The gel images were scanned and quantified by FLA2000 bioimager and built-in software. (Fuji Film, Japan)
Whole-mount in situ hybridization and immunostaining
Embryos to be used for in situ hybridization were incubated until the proper stages, fixed in MEMFA (0.1 M Mops [pH 7.4], 2 mM EGTA, 1 mM MgSO4, 3.7% formaldehyde) solution and stored in methanol at 20°C until use. Embryos that received an injection of mRNA and ß-galactosidase mRNA were fixed primarily in MEMFA solution, rinsed with PBS, and stained with 6-chloro-3-indolyl-ß-D-galactoside, as a lineage tracer. Following the staining procedure, the embryos were fixed again in MEMFA. Synthesis of DIG-labelled anti-sense RNA probes and whole-mount in situ hybridization (WISH) were performed as previously described. (Harland 1991) Probes were purified with a Sephadex G 50 spin column (Amersham Pharmacia). Hybridized RNAs were detected with alkaline-phosphatase-conjugated anti-DIG-antibody (Roche, Mannheim, Germany) and developed using BM purple (Roche). Stained embryos were bleached in 10% hydrogen peroxide supplemented methanol.
Immunostaining was perforsmed with minor modifications as described (Klymkowsky & Hanken 1991), using monoclonal antibodies MZ15 and 12/101 (Hybridoma bank) to stain the notochord and somites, respectively. Embryos and explants were fixed in 4% MEMFA at stage of 28, then incubated first in diluted primary antibody, and then in secondary antibody. Labeling was visualized with H2O2. For notochord observation, the tissue was cleared using benzyl benzoate solution.
Plasmid construction
Using PCR we constructed plasmids for microinjection and subcellular localization studies. Full-length cDNAs were subcloned in-frame into ClaI and XhoI sites for Xmig6 (GenBank accession no. AY553188) and EcoRI and XhoI sites for XGPCR4 (GenBank accession no. AY553188) of pCS2+ and pCS2-venus (Nagai et al. 2002), respectively. The primer pairs used in the PCR were: 5'-CCATCGATATGACAACTGCTGGGATTGCA-3', 5'-CCGCTCGAGTCAGATCTGCCCCACTAAGCA-3' for Xmig6; and 5'-TCGGAATTCATGTGTAACCAGAGCGTGTCG-3', 5'-CCGCTCGAGCTACAACCTAGACTGTATTT3' for XGPCR4, respectively. The primer used for 5 nucleotides displacement in XGPCR4 that becomes XGPCR4 MO rescue construct is indicated italic and bold font (mut-XGPCR4) was 5'-CGGAATTCATGTGCAATCAATCGTGTCGT-3'. The restriction sites are underlined and a stop codon was deleted in the downstream primers for the pCS2-venus construct.
MO sequence and detection of transcription inhibition
Two kinds morpholino oligonucleotides (MOs) were used: Xmig6 MO, 5'GCGGCTGTCATTCCTTCAACTATGG3'; and XGPCR4 MO, 5'CACGACACGCTCTGGTTACACATTC3' (GENE TOOLS, LLC, OR). Transcription inhibition by the MOs was confirmed through Western blotting. Venus-tagged constructs were used and detected with a rabbit anti-GFP antibody (MBL) followed by and HRP-conjugated anti-rabbit anti-IgG (Amersham).
| Supplementary material |
|---|
|
|
|---|
Figure S1 The effects of SU5402 to Xenopus embryogenesis.
Figure S2 (A) Novel genes identified in this study that showed FGF-dependent regulation. Embryos received HAVØ or XFD (0.5 ng) injection with lineage tracer in one dorsal cell at 4-cell stage and proceeded to WISH when the stage was reached. (B) Novel genes are regulated in an FGF-dependent manner and do not affect mesodermal genes and FGF component genes.
Figure S3 The amino acid sequences of human mig6, mouse mig6 and Xenopus mig6 and their phylogenic tree are shown.
| Acknowledgements |
|---|
| Footnotes |
|---|
* Correspondence: E-mail: nueno{at}nibb.ac.jp
| References |
|---|
|
|
|---|
Amaya, E., Musci., T.J. & Kirschner, M.W. (1991) Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation in Xenopus embryos. Cell 66, 257270.[CrossRef][Medline]
Amaya, E., Stein, P.A., Musci., T.J. & Kirschner, M.W. (1993) FGF signaling in the early specification of mesoderm in Xenopus. Development 118, 477487.[Abstract]
Bottcher, R.T., Pollet, N., Delius, H. & Niehrs, C. (2004) The transmembrane protein XFLRT3 forms a complex with FGF receptors and promotes FGF signalling. Nature Cell Biol. 6, 3844.[CrossRef][Medline]
Buttitta, L., Tanaka, T.S., Chen, A.E., Ko, M.S. & Fan, C.M. (2003) Microarray analysis of somitogenesis reveals novel targets of different WNT signaling pathways in the somitic mesoderm. Dev. Biol. 258, 91104.[CrossRef][Medline]
Conlon, F.L., Sedgwick, S.C., Weston, K. & Smith, J.C. (1996) Inhibition of Xbra transcription activation causes defects in mesodermal patterning and reveals autoregulation of Xbra in dorsal mesoderm. Development 122, 24272435.[Abstract]
Favata, M.F., Horiuchi, K.Y., Manos, E.J., et al. (1998) Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J. Biol. Chem. 273, 1862318632.
Frazzetto, G., Klingbeil, P. & Bouwmeester, T. (2002) Xenopus marginal coil (Xmc), a novel FGF inducible cytosolic coiled-coil protein regulating gastrulation movements. Mech. Dev. 113, 314.[CrossRef][Medline]
Gotoh, Y., Masuyama, N., Suzuki, A., Ueno, N. & Nishida, E. (1995) Involvement of the MAP kinase cascade in Xenopus mesoderm induction. EMBO J. 14, 24912498.[Medline]
Gotoh, Y. & Nishida, E. (1996) Signals for mesoderm induction. Roles of fibroblast growth factor (FGF)/mitogen-activated protein kinase (MAPK) pathway. Biochim. Biophy. Acta 1288, F1F7.[Medline]
Hackel, P.O., Gishizky, M. & Ullrich, A. (2001) Mig-6 is a negative regulator of the epidermal growth factor receptor signal. Biol. Chem. 382, 16491662.[CrossRef][Medline]
Harland, R.M. (1991) In situ hybridization: an improved whole-mount method for Xenopus embryos. Meth Cell Biol. 36, 685695.[Medline]
Hoffman, M.P., Kidder, B.L., Steinberg, Z.L., et al. (2002) Gene expression profiles of mouse submandibular gland development: FGFR1 regulates branching morphogenesis in vitro through BMP- and FGF-dependent mechanisms. Development 129, 57675778.[CrossRef][Medline]
Kanning, K.C., Hudson, M., Amieux, P.S., Wiley, J.C., Bothwell, M. & Schecterson, L.C. (2003) Proteolytic processing of the p75 neurotrophin receptor and two homologs generates C-terminal fragments with signaling capability. J. Neurosci. 23, 54255436.
Keyse, S.M. & Emslie, E.A. (1992) Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase. Nature 359, 644647.[CrossRef][Medline]
Kim, G.J. & Nishida, H. (2001) Role of the FGF and MEK signaling pathway in the ascidian embryo. Dev. Growth Differ. 43, 521533.[CrossRef][Medline]
Klymkowsky, M.W. & Hanken, J. (1991) Whole-mount staining of Xenopus and other vertebrates. In: Xenopus Laevis: Practical Uses in Cell and Molecular Biology (eds B.K. Kay & H.B. Peng), pp. 419441, New York: Academic Press.
LaBonne, C., Burke, B. & Whitman, M. (1995) Role of MAP kinase in mesoderm induction and axial patterning during Xenopus development. Development 121, 14651486.
Lin, C.Y., Li, C.C., Huang, P.H. & Lee, F.J. (2002) A developmentally regulated ARF-like 5 protein (ARL5), localized to nuclei and nucleoli, interacts with heterochromatin protein 1. J. Cell Sci. 115, 44334445.
Makkinje, A., Quinn, D.A., Chen, A., et al. (2000) Gene 33/Mig-6, a transcriptionally inducible adapter protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker transcript for chronic pathologic conditions, such as diabetic nephropathy. Possible role in the response to persistent stress. J. Biol. Chem. 275, 1783817847.
Malcolm, E.F., Isaacs, H.V. & Pownall, M.E. (2002) eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis. Development 129, 13071315.[Medline]
Mohammadi, M., McMahon, G., Sun, L., et al. (1997) Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276, 955960.
Monsoro-Burq, A.-H., Fletcher, R.B. & Harland, R.M. (2003) Neural crest induction by paraxial mesoderm in Xenopus embryos requires FGF signals. Development 130, 31113124.
Montero, J.A., Ganan, Y., Macias, D., et al. (2001) Role of FGFs in the control of programmed cell death during limb development. Development 128, 20752084.
Musci., T.J., Amaya, E. & Kirschner, M.W. (1990) Regulation of the fibroblast growth factor receptor in early Xenopus embryos. Proc. Natl. Acad. Sci. USA 87, 83658369.
Nagai, T., Ibata, K., Park, E.S., Kubota, M., Mikoshiba, K. & Miyawaki, A. (2002) A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nature Biotechnol. 20, 8790.[CrossRef][Medline]
Nieuwkoop, P.D. & Faber, J. (1967) A Normal Table Of Xenopus laevis, Amsterdam: North Holland Publishing.
Nutt, S.L., Dingwell, K.S., Holt, C.E. & Amaya, E. (2001) Xenopus Sprouty2 inhibits FGF-mediated gastrulation movements but does not affect mesoderm induction and patterning. Genes Dev. 15, 11521166.
Pownall, M.E., Welm, B.E., Freeman, K.W., Spencer, D.M., Rosen, J.M. & Isaacs, H.V. (2003) An inducible system for the study of FGF signalling in early amphibian development. Dev. Biol. 256, 8999.[Medline]
Saka, Y., Tada, M. & Smith, J.C. (2000) A screen for targets of the Xenopus T-box gene Xbra. Mech. Dev. 93, 2739.[CrossRef][Medline]
Schageman, J.J., Basit, M., Gallardo, T.D., Garner, H.R. & Shohet, R.V. (2002) MarC-V: a spreadsheet-based tool for analysis, normalization, and visualization of single cDNA microarray experiments. Biotechniques 32, 338344.[Medline]
Shinya, M., Koshida, S., Sawada, A., Kuroiwa, A. & Takeda, H. (2001) Fgf signalling through MAPK cascade is required for development of the subpallial telencephalon in zebrafish embryos. Development 128, 41534164.
Smith, J.C., Price, B.M., Green, J.B., Weigel, D. & Herrmann, B.G. (1991) Expression of a Xenopus homolog of Brachyury (T) is an immediate-early response to mesoderm induction. Cell 67, 7987.[CrossRef][Medline]
Tateossian, H., Powles, N., Dickinson, R., Ficker, M. & Maconochie, M. (2004) Determination of downstream targets of FGF signalling using gene trap and cDNA subtractive approaches. Exp. Cell Res. 292, 101114.[CrossRef][Medline]
Walshe, J., Maroon, H., McGonnell, I.M., Dickson, C. & Mason, I. (2002) Establishment of hindbrain segmental identity requires signaling by FGF3 and FGF8. Curr. Biol. 12, 11171123.[CrossRef][Medline]
White, R.J., Sun, B.I., Sive, H.L. & Smith, J.C. (2002) Direct and indirect regulation of derriere, a Xenopus mesoderm-inducing factor, by VegT. Development 129, 48674876.[Medline]
Xu, Y. (2002) Sphingosylphosphorylcholine and lysophosphatidylcholine: G protein-coupled receptors and receptor-mediated signal transduction. Biochim. Biophys. Acta 1582, 8188.[Medline]
Xu, Y., Hong, G., Wu, W., Baudhuin, L.M., Xiao, Y.J. & Damron, D.S. (2000) Sphingosylphosphorylcholine is a ligand for ovarian cancer G-protein-coupled receptor 1. Nature Cell Biol. 2, 261267.[CrossRef][Medline]
Yamamoto, T.S., Takagi, C., Hyodo, A.C. & Ueno, N. (2001) Suppression of head formation by Xmsx-1 through the inhibition of intracellular nodal signaling. Development 128, 27692779.[Medline]
Zhu, K., Baudhuin, L.M., Hong, G., et al. (2001) Sphingosylphosphorylcholine and lysophosphatidylcholine are ligands for the G protein-coupled receptor GPR4. J. Biol. Chem. 276, 4132541335.
Received: 17 April 2004
Accepted: 26 May 2004
This article has been cited by other articles:
![]() |
L. V. Yang, C. G. Radu, M. Roy, S. Lee, J. McLaughlin, M. A. Teitell, M. L. Iruela-Arispe, and O. N. Witte Vascular Abnormalities in Mice Deficient for the G Protein-Coupled Receptor GPR4 That Functions as a pH Sensor Mol. Cell. Biol., February 15, 2007; 27(4): 1334 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Lanahan, T. W. Chittenden, E. Mulvihill, K. Smith, S. Schwartz, and M. Simons Synectin-dependent gene expression in endothelial cells Physiol Genomics, November 21, 2006; 27(3): 380 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Amaya Xenomics Genome Res., December 1, 2005; 15(12): 1683 - 1691. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tao, B. Lloyd, S. Lang, D. Houston, A. Zorn, and C. Wylie A novel G protein-coupled receptor, related to GPR4, is required for assembly of the cortical actin skeleton in early Xenopus embryos Development, June 15, 2005; 132(12): 2825 - 2836. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK |