GTC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Genes to Cells (2004) 9, 821-829. doi:10.1111/j.1365-2443.2004.00766.x
© 2004 Blackwell Publishing or its licensors

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuda, K.
Right arrow Articles by Inagaki, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuda, K.
Right arrow Articles by Inagaki, S.

Sema4D stimulates axonal outgrowth of embryonic DRG sensory neurones

Kenta Masuda1, Tatsuo Furuyama2, Mizue Takahara1, Shiho Fujioka1, Hitomi Kurinami1 and Shinobu Inagaki1,*

1 Group of Neurobiology, School of Allied Health Sciences, Osaka University Faculty of Medicine, Yamadaoka 1-7, Suita, Osaka 565-0871, Japan
2 Department of Molecular Genetic Research, National Institute of Longevity Sciences, Morioka-cho, Ohbu, Aichi 474-5822, Japan


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Several semaphorins are thought to function as potent inhibitors of axonal growth. We have found that Sema4D stimulates axonal outgrowth of embryonic dorsal root ganglion (DRG) neurones in stead of retraction. Neutralizing antibodies to Sema4D inhibit this action. This action appears to differ slightly from that on PC12 cells, because DRG neurones respond to Sema4D without addition of nerve growth factor (NGF), while PC12 cells do not. On the other hand, it is blocked by deprivation of endogenous NGF with antibodies to NGF and also by Trk-inhibitor K252a, suggesting that endogenously produced-NGF and the activation of Trk receptor are required for Sema4D-action on DRG neurones. These indicate that neurite-outgrowth promoting actions of Sema4D are similar between DRG neurones and PC12 cells, since NGF-Trk signalling are required for these actions. Since Schwann cells can produce NGF, the contamination of these cells in our DRG culture might explain this action. In addition to plexin-B1 that is known as a Sema4D receptor, binding experiments indicate plexin-B2 as another receptor candidate for Sema4D. These plexins and Sema4D are expressed in embryonic DRGs. We suggest a new function of Sema4D as a neurite-outgrowth stimulating, autocrine/paracrine factor in embryonic sensory neurones.


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
The semaphorins are a large family of secreted and membrane-bound glycoproteins characterized by conserved sema domain of ~500 amino acids (Kolodkin et al. 1993; Tessier-Lavigne & Goodman 1996; Semaphorin Nomenclature Committee 1999). The secreted forms of semaphorins have been implicated in mediating axonal guidance in the developing nervous system (Tessier-Lavigne & Goodman 1996; Taniguchi et al. 1997). In vitro, several semaphorins act as potent repulsive molecules (Luo et al. 1993; Messersmith et al. 1995; Miyazaki et al. 1999a, 1999b), but at least some semaphorins are bifunctional molecules that function as chemoattractants as well as chemorepellents. For example, Sema3A induces growth cone collapse of dorsal root ganglion (DRG) neurones and cortical axons, while it acts as an attractant for cortical apical dendrites (Polleux et al. 2000). Sema3C (formerly called SemE) repels sympathetic axons but attracts cortical axons in vitro (Bagnard et al. 1998). We have also shown that Sema3E (primarily called M-SemaH) repels and inhibits axon outgrowth in DRG neurones, whereas in rat pheochromocytoma cell line (PC12 cells) it induces neurite outgrowth (Miyazaki et al. 1999a; Sakai et al. 1999). In grasshopper embryos, Ti1 axons are initially repelled by an invertebrate secreted-semaphorin, Sema2a, until they encounter a stripe of epithelial cells that express an invertebrate transmembrane-semaphorin, Sema1a (Tessier-Lavigne & Goodman 1996). In vivo in invertebrates, a secreted-semaphorin acts as a repulsive factor in axon guidance, while a transmembrane-semaphorin can promote axon outgrowth (Wong et al. 1999). However, the functions of numerous transmembrane-semaphorins in the vertebrate nervous system are largely unknown. A mammalian transmembrane-member, Sema4D, is proteolytically digested and shed from immune cells (Delaire et al. 2001), and soluble Sema4D promotes immune responses, proliferation and viability of lymphocytes (Hall et al. 1996), while yet little is known in the nervous system. Recently, we have shown that soluble Sema4D is neurotrophic to enhance neurite outgrowth of PC12 cells, which are well known to differentiate into neural cells in response to NGF (Fujioka et al. 2003). Herein we have investigated whether soluble Sema4D retracts axonal outgrowth of DRG neurones as Sema3E does (Sakai et al. 1999). Instead of repulsive effect, Sema4D promotes axonal outgrowth of DRG neurones in the absence of NGF. We demonstrate what is involved in this Sema4D-action, and whether Sema4D could function in an autocrine/paracrine manner.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Sema4D induces axonal outgrowth in DRG neurones

We previously reported that a secreted type of semaphorin, Sema3E, induced neurite outgrowth of PC12 cells in a NGF-independent manner (Sakai et al. 1999). Meanwhile in DRG neurones, it acted as a repulsive factor to collapse growth cones and retract axons (Miyazaki et al. 1999a, 1999b), suggesting the diversity of semaphorin signals. We recently showed that soluble forms of Sema4D enhanced neurite outgrowth of PC12 cells in a NGF-dependent manner (Fujioka et al. 2003). In this study we have examined whether Sema4D can retract or stimulate axonal outgrowth of DRG neurones as Sema 3E. Sema4D-AP (1 nM) alone in the absence of NGF stimulated axonal outgrowth of DRG neurones (Fig. 1A,B). Sema4D-AP in the presence of NGF (50 ng/mL) also enhanced axonal outgrowth of DRG neurones. When DRG neurones were incubated in the Sema4D-medium pretreated with IgGs prepared from the polyclonal antiserum against Sema4Ded (anti-Sema4D) at 1 : 50 dilution, Sema4D-AP-induced-axonal outgrowth disappeared almost completely, while control IgGs from preimmune serum at the same dilution did not inhibit axonal outgrowth-action of Sema4D-AP (Fig. 1C). Preimmune and anti-Sema4D IgGs at this concentration was not acting in a toxic fashion, as we observed no morphologic evidence of toxicity in the cells when the cells are exposed to anti-Sema4D. This result supported that Sema4D itself induced axonal outgrowth of DRG neurones. We also investigated whether immobilized-Sema4D could stimulate axonal outgrowth of DRG neurones by culturing these cells on Sema4D-AP-coated dishes. No outgrowth-action was induced with immobilized-Sema4D (data not shown).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 1  Sema4D stimulated axonal outgrowth of DRG neurones. (A) Phase-contrast photomicrographs of DRG cells after treatment with NGF and Sema4D. DRG neurones were incubated for 16 h in the control medium (CM) without NGF (50 ng/mL) (a) and with NGF (50 ng/mL) (b), and in the 1 nM Sema4D-medium (S4D) without NGF (c) and with NGF (50 ng/mL) (d). Schwann cells (arrowheads) are scattered among DRG neurones. (B) Axonal outgrowth was quantified by measuring the length of the longest neurites per DRG neurone in the CM (open bars) and S4D (filled bars) either with or without NGF as described in (A). (C) Effect of the antibodies to Sema4D. DRG neurones were cultured for 19 h in the Sema4D-medium (S4D) preincubated for 1 h at 4 °C with preimmune IgGs diluted 1 : 50 (Preimm) or anti-S4D IgGs diluted 1 : 50 (AbS4D), respectively. For the control, DRG neurones were cultured in the control medium (CM). Sema4D-induced axonal outgrowth disappeared after treatment with the anti-S4D antibodies. Experiments were repeated at least three times and a representative case is shown. *P < 0.01 by Student's t-test.

 
Endogenous NGF and Trk signalling are required for Sema4D-action on axonal outgrowth of DRG neurones

Sema4D could not stimulate neurite-outgrowth of PC12 cells when NGF was not added to the culture, and thus neurite-outgrowth action of Sema4D on PC12 cells was NGF-dependent. On the other hand, Sema4D alone induced axonal outgrowth of DRG neurones, suggesting that Sema4D-action on DRG neurones was NGF-independent. However, in our DRG-neurone culture there were Schwann cells scattered among ganglionic neurones. Since Schwann cells could produce growth factors such as NGF (Matsuoka et al. 1991), it can be conceivable that such low-level of growth factors could cause the discrepancy in NGF-dependency of Sema4D-action between DRG neurones and PC12 cells. To investigate whether the action of Sema4D is dependent on endogenously produced-NGF in DRG culture, we used antibodies to NGF. Deprivation of endogenous NGF by adding anti-NGF antibodies markedly inhibited axonal outgrowth-action of Sema4D in a dose-dependent manner (Fig. 2A). NGF depletion by the antibodies to NGF had no toxic effect or no significant effect on axonal outgrowth of DRG neurones in the absence of Sema4D. The results suggest that endogenously produced-low-level of NGF be likely involved in Sema4D-action.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2  Neurite outgrowth action of Sema4D is dependent on endogenous NGF and Trk-activation. (A) Dispersed DRG cells pretreated with normal rabbit IgGs (1 : 1000 dilution) (open bars) and rabbit anti-NGF antibodies (grey and filled bars) (diluted 1 : 100 000-1 : 1000) were incubated for 19 h with 1 nM Sema4D-containing medium (S4D). Axonal outgrowth was quantified by measuring length of the longest neurites per cell. Pretreatment of anti-NGF antibodies markedly decreased S4D-action on DRG neurones. (B) DRG cells were incubated for 20 h either with (filled bars) or without (open bars) 100 nM K252a. Cells were pretreated with K252a for 15 min prior to incubation were incubated with the control medium (CM), NGF (50 ng/mL) in the CM or S4D (1 nM). K252a remarkably inhibited NGF-action and S4D-action on axonal outgrowth of DRG neurones. *P < 0.01 by Student's t-test.

 
To ascertain whether NGF receptor, TrkA, mediates Sema4D-action on DRG neurones, K252a was used to block the activation of TrkA. K252a at 100 nM can specifically block tyrosine autophosphorylation of Trks, but not other kinases including the receptors for bFGF and EGF in PC12 cells (Hashimoto 1988; Berg et al. 1992). As shown in Fig. 2B, K252a markedly inhibited Sema4D-induced axonal outgrowth in DRG neurones, suggesting that the activation of Trk-receptor is required for Sema4D-action. This result, together with the result of NGF-deprivation experiments suggests that axonal outgrowth-actions of Sema4D are dependent on NGF-TrkA-signalling in DRG neurones as well as in PC12 cells.

Endogenous Sema4D is expressed in DRG neurones

In situ hybridization histochemistry showed strong expression of Sema4D transcripts in the DRGs of mouse embryos at E11.5 and E14.5 (Fig. 3A,B). Sema4D signals were detected in almost all DRG cells. The transcripts were also found in scattered cells of the ventral parts of embryonic spinal cords (Fig. 3A). Immunohistochemical staining using the antibody to Sema4D showed intense staining in the central and peripheral axons extending from DRGs as well as in the spinal nerves, but weak to moderate staining in cell bodies of DRG neurones (Fig. 3C,D). These results suggest that Sema4D proteins produced in DRG neurones be transported to their axonal processes.



View larger version (152K):
[in this window]
[in a new window]
 
Figure 3  DRGs express Sema4D. In situ hybridization histochemistry shows strong expression of Sema4D transcripts in DRGs (arrows) of coronal section through the spinal cord (A) and parasagittal sections through the DRGs (B) at E14.5. Sema4D transcripts are also expressed in cells scattered in ventral parts of the spinal cord (white arrowheads). Immunohistochemical analysis using the antibody to Sema4Dcd shows strong immunostaining in the central (double arrowheads) and peripheral axons (arrowheads) of DRG neurones and spinal nerves, and moderate immunoreactivity in the DRGs (arrows) of a coronal section of E11.5 embryo (C) and a parasagittal section of E14.5 embryo (D).

 
Plexin-B1 and plexin-B2 are candidates for Sema4D receptors

Plexin-B1 is suggested to be a high affinity receptor for Sema4D (Tamagnone et al. 1999). To investigate whether plexin-B1 is a specific receptor for Sema4D, we performed binding experiments by using Sema4D-AP as a ligand. The cells were transiently transfected with expression vectors encoding plexin-B1, plexin-B2, neuropilin-1, and neuropilin-2. The last two, neuropilin-1 and neuropilin-2, are high affinity receptors for type 3 semaphorins (He & Tessier-Lavigne 1997; Fujisawa & Kitsukawa 1998). One nM of Sema4D-AP bound either the cell expressing plexin-B1 or plexin-B2, but neither the cell expressing neuropilin-1 nor neuropilin-2 (Fig. 4A–D). Therefore both plexin-B1 and plexin-B2, but not neuropilin-1 nor neuropilin-2, are candidates for Sema4D receptors. Then we investigated whether the addition of plexin-B1 or B2 could inhibit Sema4D-neurite outgrowth action of PC12 cells using crude membrane fractions of transfectants. Neurite-outgrowth actions of Sema4D was significantly inhibited by membrane fractions from plexin-B1 or plexin-B2 transfectants, but not by the fractions from mock-control cells transfected with its parent expression vector (Fig. 4E,F).



View larger version (84K):
[in this window]
[in a new window]
 
Figure 4  Sema4D binds to plexins but not to neuropilins. HEK293 cells transiently transfected with expression vectors encoding neuopilin-1 (NP1) (A), neuropilin-2 (NP2) (B), plexin-B1 (C) and plexin-B2 (D) were incubated with Sema4D-AP (1 nM) for 30 min at 37 °C. Reacting with NBT/BCIP, after fixation with 3% paraformaldehyde fixative showed AP activity. Darkly stained cells were AP positive, as a consequence of binding with Sema4D-AP. No significant binding was seen on the cells expressing neuropilin-1 nor neuropilin-2, while strong staining was found on plexin-B1- and plexin-B2-transfectants. The immunoblot analysis shows plexin-B1 (left lane) and plexin-B2 (right lane) proteins produced in transfected-CHO cells (E). PC12 cells were incubated for 20 h with 1 nM Sema4D-AP and NGF (50 ng/mL) in the presence of membrane fractions prepared from control-mock CHO cells (control, open bars) or plexin-transfectants (filled bars); plexin-B1-expressing cells (B1) or plexin-B2-expressing cells (B2) (F). The percentage of PC12 cells with neurite longer than 50 µm was calculated. Each value is the mean ± SEM. The values marked with asterisk are significantly different (P < 0.01) from the values for the membrane fraction of control cells. Membrane fractions from plexin-B1- and plexin-B2-expressing cells inhibited Sema4D action on neurite outgrowth of PC12 cells.

 
Embryonic DRGs express plexin-B1 and B2

In situ hybridization histochemistry showed that mRNAs for plexin-B1 and B2 were expressed in embryonic DRGs (Fig. 5A,C), but sense cRNA probes for these plexins (for the control) showed no specific signals (Fig. 5B,D). It was hard to identify which cells of the DRG express the signals in these autoradiograms. Immunostaining with antibodies to plexin-B1 and B2 were also found in spinal roots and nerves (Fig. 5E). RT-PCR products for plexin-B1 and B2 were detected from cDNA of embryonic DRGs and PC12 cells as well as the brain. On the other hand, RT-PCR products for CD72, a low-affinity-Sema4D receptor of immune cells (Kumanogoh et al. 2000), were not detected from DRGs nor PC12 cells but were detected from the spleen and thymus (Fig. 5F). These results indicate that embryonic DRG neurones most likely express mRNAs for plexin-B1 and plexin-B2, and produce these proteins to transport toward their axonal processes, but do not express CD72.



View larger version (156K):
[in this window]
[in a new window]
 
Figure 5  Expression of plexin-B1 and B2 in embryonic DRGs. In situ hybridization histochemistry shows mRNA expressions for plexin-B1 and plexin-B2 in the DRGs of parasagittal sections of mouse embryo at E14.5. (A) Antisense (B1as) and (B) sense (B1s) probes for plexin-B1, and (C) anti-sense (B2as) and (D) sense (B2s) probes for plexin-B2 were used. Arrows indicate DRGs. (E) A coronal section through the spinal cord (SpC) of mouse embryo at E14.5 was immunostained with the antibody to plexin-B2. Darkly stained immunoreactivity was found in peripheral axons (PN) of the DRG, anterior root (MN) and spinal nerves (N). (F) RT-PCR experiments with specific primers of mouse plexin-B1 (B1), plexin-B2 (B2), and CD72 were performed by using template of cDNAs from the adult tissues; (brain, DRG, spleen and thymus), DRG (E12.5) and PC12 cells, as described in Experimental procedures.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Sema4D-action on axonal outgrowth of DRG neurones appears to depend on endogenously produced NGF

In this study, we have shown that Sema4D enhances axonal outgrowth of DRG neurones either alone or in the presence of NGF. On the other hand, in PC12 cells Sema4D alone could not induce neurite outgrowth (Fujioka et al. 2003). However, endogenous-NGF-deprivation by using the antibodies to NGF and inhibition of NGF-signalling using a TrkA-inhibitor K252a markedly reduced Sema4D-induced axonal outgrowth in DRG neurones. These results suggest that such Sema4D-action on DRG neurones is also dependent of endogenous NGF and its downstream-signalling as found on PC12 cells, although the effect on heterogeneous cell population in DRG-culture and that on clonal PC12 cells cannot be directly compared. In our previous study, inhibition of TrkA kinase activity by K252a also reduced NGF-dependent-Sema4D action of neurite outgrowth in PC12 cells in the presence of NGF. The inhibition of neurite outgrowth activity by K252a was incomplete in PC12 cells, while almost complete inhibition was seen in DRG neurones. It appears to be difficult to explain this discrepancy, but some difference of experimental conditions might have caused such discrepancy as follows: 50 ng/mL of NGF was added to PC 12 cell-culture for Sema4D-acitivity assay, while no NGF was added to DRG neurone-culture since Sema4D can promote neurite outgrowth without addition of NGF in DRG neurones. K252a almost completely inhibited NGF alone-induced Trk-activation (PC12 cells) or Sema4D-plus-low level of endogenous-NGF-induced Trk-activation (DRG neurones). However, it might not be enough to inhibit completely Sema4D-plus-high level of NGF-induced Trk activation (PC12 cells), although future studies would be necessary. Sema4D dramatically increases the sensitivity of PC12 cells to NGF, and thus cells respond to very low concentrations of NGF such as 0.1–1 ng/mL that alone does not induce any marked neural differentiation (Fujioka et al. 2003). Since Schwann cells produce NGF (Matsuoka et al. 1991), the contamination of these cells in our DRG-neurone culture might explain such Sema4D-action on DRG neurones. Sema4D appears to be extremely potent in accelerating the velocity of neurite outgrowth induced by NGF in DRG cells most likely as in PC12 cells.

Bifunctional guidance cues

Precise axon guidance is the consequence of a continuous reorganization of actin filament structures in response to repulsive and attractive cues such as netrins, brain-derived neurotrophic factor (BDNF), Slits, semaphorins, and ephrins (reviewed by Dickson 2002). Extracellular guidance cues instruct the growth cone to advance, retract or turn. In a popular model, attractive guidance cues promote growth cone advance, whereas repulsive cues inhibit neurite growth or induce retraction (Mueller 1999). Netrin-1 and BDNF normally trigger an attractive response of the growth cones of Xenopus spinal neurones, but induce repulsive response of these growth cones in the presence of a competitive analogue of cAMP or of a specific inhibitor of protein kinase A (Song & Poo 1999). In vivo, Xenopus retinal axons are first attracted out of the eye by netrin-1 at the optic nerve head, become indifferent to it as they grow through the ventral diencephalon, and finally are repelled by netrin-1 once they reach the tectum (Shewan et al. 2002), and these changes correlate with a gradual decline in cAMP levels. Likewise, Sema3A can convert axonal responses from repulsion to attraction by raising levels of cGMP; Sema3A attracts the apical dendrites of pyramidal neurones toward the cortical plate but repels the axons away from it. Guanylyl cyclase is specifically localized in dendrites, implying that cGMP levels may be higher in dendrites than in axons (Polleux et al. 2000). These suggest that axon guidance cues including semaphorins are bifunctional to growth cone response depending on intracellular and extracellular environments. It is conceivable that the different cellular environment including cAMP/cGMP levels induces the opposing responses to Sema4D between embryonic DRG and hippocampal neurones (Swiercz et al. 2002). It was not clear why coated-immobilized Sema4D had no effect on neurite outgrowth of DRG neurones. However, the concentration of Sema4D-ligand coated on dishes might not be enough to induce the response of DRG neurones, or aggregation of the ligand might be required for the response.

Sema4D receptors in DRG neurones

There are at least two distinct types of vertebrate semaphorin receptors, plexins and neuropilins, which can interact to form receptor complexes. Neuropilins bind to secreted type of semaphorins and plexin-neuropilin complexes are high-affinity receptors for this type of semaphorins, whereas plexins alone can bind membrane-bound type of semaphorins (He & Tessier-Lavigne 1997; Tamagnone et al. 1999; Dickson 2002).

Semaphorins mainly function as chemorepellents to guide axons and plexins mediate or transduce repulsive actions of semaphorins, while it is unidentified what receptors mediate attractive actions of semaphorins (Driessens et al. 2001; Swiercz et al. 2002). Tamagnone et al. (1999) showed plexin-B1 as a receptor for a transmembrane semaphorin, Sema4D. We have demonstrated that Sema4D binds to plexin-B2 as well as to plexin-B1. Embryonic DRGs express mRNAs of Sema4D as well as mRNAs of plexin-B1 and B2, and these proteins are localized in the axonal processes of DRG neurones. These results suggest that embryonic DRG neurones could respond to Sema4D in an autocrine or paracrine manner via plexin-B1 and/or plexin-B2. This is the first paper suggesting plexins as the receptors for attractive action of semaphorins.

Plexin-B1 interacts with GTP-Rac1 to inhibit p21-activated kinase (PAK) activation, and it results in inhibition of extension (Driessens et al. 2001). Sema4D has been reported to induce growth cone collapse in the hippocampal culture, via PDZ-RhoGEF which is activator that promotes the conversion of the inactive GDP-bound to the active GTP-bound (Swiercz et al. 2002). PDZ-RhoGEF can associate at the PDZ domain with C-terminus of plexin-B1 (Hirotani et al. 2002), and contains RGS (regulating G-protein signalling) domain, which can be regulated by heterotrimeric G-proteins. Thus Sema4D-plexin-B1 signalling might be modified by heterotrimeric G-protein-coupled receptors (GPCR) through such PDZ-RhoGEFs to convert repellent to attractant and vice versa, although it remains to be studied furthermore.

Association of plexin-B1 with tyrosine kinase type-receptors

Recently, plexin-B1 is reported to couple with tyrosine kinase type-receptor, Met, which is well known as a receptor for hepatocyte growth factor (HGF)/scatter factor receptor (Giordano et al. 2002). Sema4D can stimulate tyrosine kinase activity of Met in the absence of HGF, and that results in invasive growth of epithelial cells. Recently, Morroti et al. (2002) reported that K252a can block tyrosine kinase activity of Met as well as Trks. K252a markedly inhibited Sema4D-axonal outgrowing-action of DRG neurones. It is uncertain which tyrosine kinase receptors, Trk or Met, is involved in the Sema4D-signalling. The skin that is one of target tissues of sensory neurones starts to produce NGF at E11, and the maximum level of NGF is found during E13-15 when plexin-B1 and B2 are expressed in DRGs (Davies et al. 1987). Sema4D likely cooperates with NGF to enhance axonal outgrowth of DRG neurones at this stage.

Our results could suggest that neurite-outgrowing action of Sema4D be likely induced by the interaction of signalling pathways of Sema4D-plexin and tyrosine kinase-type of receptors such as TrkA. The cellular environment of DRG neurones including cAMP/cGMP levels can switch repulsive signals to attractive signals, although it remains to be studied furthermore.


    Experimental procedures
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Preparation of soluble Sema4D

Extracellular domain of mouse Sema4D was subcloned into expression vectors of AP-tag1 (Cheng & Flanagan 1994) to express alkaline phosphatase (AP)-fused Sema4D protein (Sema4D- alkaline phosphatase) in HEK293 cells as described (Fujioka et al. 2003). The concentration of Sema4D-AP was determined from AP activity at 405 nm as previously described (Sakai et al. 1999). For the control experiments, the conditioned medium from HEK293 cells (CM) was used instead of the medium from HEK293 cells expressing Sema4D-AP (Sema4D-medium). Sema4D-AP was used for neurite outgrowth assay at 1 nM in this study, with or without 50 ng/mL NGF (7S, Roche Molecular Biochemicals). HEK293 cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% foetal bovine serum (FBS).

DRG neurone culture

DRGs were dissected under a microscope from 10 mice at embryonic day 12.5 (E12.5). About a hundred ganglia were treated with 0.25% trypsin/0.2% EDTA/phosphate-buffered saline (PBS) at 37 °C for 10 min. Dissociated DRG cells were cultured in 5% horse serum/DMEM at 1 x 105 cells/35 mm dish, which was coated with 0.5% polyethylenimine. After 1 h, the culture medium was replaced with the CM or the Sema4D-medium containing 1 nM Sema4D-AP.

Axonal outgrowth assay

DRG neurones were incubated with CM or Sema4D-medium in the absence or presence of 50 ng/mL NGF at 37 °C for 14–20 h. Axonal outgrowth was quantified by measuring the length of the longest neurite of DRG neurones using an eyepiece micrometer. At least three independent experiments were done. All values are given as means ± SEM and statistical significance of any effect was tested with Student's t-test. Difference was considered significant if P < 0.01. K252a (Calbiochem) was used at 100 nM that inhibits autophosphorylation of Trks but does not inhibit EGF- nor bFGF- receptors (Hashimoto 1988; Berg et al. 1992). Anti-NGF polyclonal rabbit antiserum (Sigma) was used at dilutions of 1 : 100 000–1 : 1000 to block endogenous NGF in DRG neurone cultures.

Construction of expression vectors

The cDNAs of human plexin-B1 (KIAA0407) and plexin-B2 (KIAA0315) provided by T. Nagase were subcloned into the expression vectors, pEF-HA and the cytoplasmic domains of human plexin-B1 (plexin-B1cd) and plexin-B2 (plexin-B2cd) was subcloned, respectively, into pCMV-Myc expression vector as described (Hirotani et al. 2002). Expression vectors encoding rat neuropilin-1 (pMT21-rNP1) and mouse neuropilin-2 (pSecTag-mNP2-myc) were provided by Dr M. Tessier-Lavigne (He & Tessier-Lavigne 1997). Extracellular domain of Sema4D (Sema4Ded) was subcloned into pEF-Fc vector (Suda & Nagata 1994).

Preparation of polyclonal antibodies to Sema4D, plexin-B1- and plexin-B2-transfectants

Rabbit polyclonal anti-Sema4D antibodies against Sema4Ded-Fc (Fc-fused-Sema4Ded) and against the cytoplasmic domain of Sema4D (Sema4Dcd) as described (Fujioka et al. 2003; Furuyama et al. 1996). The preimmune IgGs and anti-Sema4D IgGs were obtained from immunoglobulin fractions of the preimmune rabbit-serum and anti-Sema4D antiserum using protein A-Sepharose, respectively. Rabbit polyclonal anti-plexin-B1 and anti-plexin-B2 antibodies were raised against GST-plexin-B1cd and plexin-B2cd, respectively (Hirotani et al. 2002). The antiserum was affinity-purified with each GST-fusion protein covalently coupled to NHS-activated Sepharose (Amersham Pharmacia). The specificity of the antibodies was confirmed by immunoblot analysis using HEK293 cells transfected with the pCMV-Myc-plexin-B1cd and pCMV-Myc-plexin-B2cd, respectively.

Binding assay

HEK293 cells plated in 24-well plates at 5 x 103 cells/well were transfected with expression vectors encoding neuropilin-1, neuropilin-2, plexin-B1 and plexin-B2 by the calcium-phosphate-precipitation method and processed for the binding assay by Cheng & Flanagan (1994) as described (Miyazaki et al. 1999a). In brief, these cells were incubated with the indicated concentrations of Sema4D-AP for 1 h at 37 °C. After fixation in 3% paraformaldehyde-fixative, AP activity was detected by reacting for 2 h at room temperature with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP).

In situ hybridization histochemistry and immunohistochemistry

Embryos at E12.5-day and 14.5-day were fixed with 4% paraformaldehyde, frozen rapidly and cut into parasagittal and coronal sections of 15 µm thickness on a cryostat. The sections were processed for in situ hybridization histochemistry with anti-sense and sense RNA probes labelled with [35S]-UTP as previously described (Inagaki et al. 1995; Furuyama et al. 1996; Miyazaki et al. 1999b). For immunostaining, anti-Sema4D, anti-plexin-B1, and anti-plexin-B2 polyclonal antibodies against each corresponding cytoplasmic-domain, were used in conjunction with the VECSTAIN ABC kit (Vector) as previously described (Inagaki et al. 1991).

Reverse transcriptase polymerase chain reaction (RT-PCR)

RT-PCR experiments with specific primers of mouse plexin-B1 (ATCCACATCTGGAAGACC and GACCTTGTTTTCCACAGC), plexin-B2 (GGAAGAGCCAGCAGGC and TCAGAGGTCTGTAACCTTATT), and CD72 (GAAGACTGTGAAGCAGAG and GCTTGTCAACCTCTGGTC) were performed using cDNA prepared from each mouse tissue and PC12 cells as template (Sambrook et al. 1989). PCR was performed using the Taq DNA polymerase (Sigma) under the following conditions: denaturation at 94 °C for 5 min, 30 cycles at 94 °C for 30 s, 60–64 °C (varied by used primer sets) for 30 s, and 72 °C for 1 min. Aliquots (20 µL) of PCR products were analysed by 1.2% agarose gel as previously described (Hirotani et al. 2002).

Preparation of crude membrane fractions of plexin-B1 and plexin-B2 transfectants

CHO cells transfected with pEF-HA-plexin-B1 and pEF-HA-plexin-B2 were lysed in lysis buffer (20 mM Tris-HCl pH 7.5/1 mM EDTA/150 mM NaCl/0.5% TritonX-100/1 mM PMSF). Each sample was kept on ice for 30 min and centrifuged at 1000 g for 5 min. The supernatant was centrifuged at 10 000 g for 30 min, then the pellet was suspended in 2% CHAPS (Dotite, Japan). The suspension was dialysed against DMEM and used as crude membrane fractions of plexin-B1 and plexin-B2.


    Acknowledgements
 
We thank Dr J.G. Flanagan for AP-vectors (Harvard Medical School), Dr T. Nagase (Kazusa DNA Research Institute) for KIAA vectors, and Dr M. Tessier-Lavigne (University of California, San Francisco) for neuropilin-1 and neuropilin-2 vectors and Drs T. Sakai and Marcia Toguchi (Osaka University) for reading through the manuscript. This work was supported in part by Grants-in-aid for scientific research from the Ministry of Education, Science, Technology, Sports and Culture of Japan (S.I.).


    Footnotes
 
Communicated by: Yoshimi Takai

* Correspondence: E-mail: inagaki{at}sahs.med.osaka-u.ac.jp


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Experimental procedures
 References
 
Bagnard, D., Lohrum, M., Uziel, D., Puschel, A.W. & Bolz, J. (1998) Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development 125, 5043–5053.[Abstract]

Berg, M.M., Sternberg, D., Parada, L.F. & Chao, M.V. (1992) K-252a inhibits nerve growth factor-induced trk proto-oncogene tyrosine phosphorylation and kinase activity. J. Biol. Chem. 267, 13–16.[Abstract/Free Full Text]

Cheng, H.J. & Flanagan, J.G. (1994) Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek and Sek receptor tyrosine kinases. Cell 79, 157–168.[CrossRef][Medline]

Davies, A.M., Bandtlow, C., Heumann, R., et al. (1987) Timing and site of nerve growth factor synthesis in developing skin in relation to innervation and expression of the receptor. Nature 326, 353–358.[CrossRef][Medline]

Delaire, S., Billard, C., Tordjman, R., et al. (2001) Biological activity of soluble CD100. II. Soluble CD100, similarly to H-SemaIII, inhibits immune cell migration. J. Immunol. 166, 4348–4354.[Abstract/Free Full Text]

Dickson, B.J. (2002) Molecular mechanisms of axon guidance. Science 298, 1959–1964.[Abstract/Free Full Text]

Driessens, M.H., Hu, H., Nobes, C.D., Korsching, S., Rohrer, H. & Thoenen, H. (2001) Plexin-B semaphorin receptors interact directly with active Rac and regulate the actin cytoskeleton by activating Rho. Curr. Biol. 11, 339–344.[CrossRef][Medline]

Fujioka, S., Masuda, K., Toguchi, M., et al. (2003) Neurotrophic effect of semaphorin 4D in PC12 cells. Biochem. Biophys. Res. Commun. 301, 304–310.[CrossRef][Medline]

Fujisawa, H. & Kitsukawa, T. (1998) Receptors for collapsin/semaphorins. Curr. Opin. Neurobiol. 8, 587–592.[CrossRef][Medline]

Furuyama, T., Inagaki, S., Kosugi, A., et al. (1996) Identification of a novel transmembrane semaphorin expressed on lymphocytes. J. Biol. Chem. 272, 23515–23520.

Giordano, S., Corso, S., Conrotto, P., et al. (2002) The semaphorin 4D receptor controls invasive growth by coupling with Met. Nature Cell Biol. 4, 720–724.[CrossRef][Medline]

Hall, K.T., Boumsel, L., Schultze, J.L., et al. (1996) Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation. Proc. Natl. Acad. Sci. USA 93, 11780–11785.[Abstract/Free Full Text]

Hashimoto, S. (1988) K-252a, a potent protein kinase inhibitor, blocks nerve growth factor-induced neurite outgrowth and changes in the phosphorylation of proteins in PC12h cells. J. Cell Biol. 107, 1531–1539.[Abstract/Free Full Text]

He, Z. & Tessier-Lavigne, M. (1997) Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell 90, 739–751.[CrossRef][Medline]

Hirotani, M., Ohoka, Y., Yamamoto, T., et al. (2002) Interaction of plexin-B1 with PDZ. domain-containing Rho guanine nucleotide exchange factors. Biochem. Biophys. Res. Commun. 297, 32–37.[CrossRef][Medline]

Inagaki, S., Furuyama, T. & Iwahashi, Y. (1995) Identification of a member of mouse semaphorin family. FEBS Lett. 370, 269–272.[CrossRef][Medline]

Inagaki, S., Takagi, H., Suzuki, K., Akai, F. & Taniguchi, N. (1991) Intense immunoreactivity for Mn-superoxide dismutase (Mn-SOD) in cholinergic and non-cholinergic neurons in the rat basal forebrain. Brain Res. 541, 354–357.[CrossRef][Medline]

Kolodkin, A.L., Matthes, D.J. & Goodman, C.S. (1993) The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75, 1389–1399.[CrossRef][Medline]

Kumanogoh, A., Watanabe, C., Lee, I., et al. (2000) Identification of CD72 as a lymphocyte receptor for the class IV semaphorin CD100: a novel mechanism for regulating B cell signaling. Immunity 13, 621–631.[CrossRef][Medline]

Luo, Y., Raible, D. & Raper, J.A. (1993) Collapsin, a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75, 217–227.[CrossRef][Medline]

Matsuoka, I., Meyer, M. & Thoenen, H. (1991) Cell-type-specific regulation of nerve growth factor (NGF) synthesis in non-neuronal cells: comparison of Schwann cells with other cell types. J. Neurosci. 11, 3165–3177.[Abstract]

Messersmith, E.K., Leonardo, E.D., Shatz, C.J., Tessier-Lavigne, M., Goodman, C.S. & Kolodkin, A.L. (1995) Semaphorin III can function as a selective chemorepellent to pattern sensory projections in the spinal cord. Neuron 14, 949–959.[CrossRef][Medline]

Miyazaki, N., Furuyama, T., Amasaki, M., et al. (1999a) Mouse semaphorin H inhibits neurite outgrowth from sensory neurons. Neurosci. Res. 33, 269–274.[CrossRef][Medline]

Miyazaki, N., Furuyama, T., Sakai, T., et al. (1999b) Developmental localization of semaphorin H messenger RNA acting as a collapsing factor on sensory axons in the mouse brain. Neuroscience 93, 401–408.[CrossRef][Medline]

Morroti, A., Mila, S., Accornero, P., Tagliabue, E. & Ponzetto, C. (2002) K252a inhibits the oncogenic properties of Met, the HGF receptor. Oncogene 21, 4885–4893.[CrossRef][Medline]

Mueller, B.K. (1999) Growth cone guidance: first step towards a deeper understanding. Annu. Rev. Neurosci. 22, 106–116.

Polleux, F., Morrow, T. & Ghosh, A. (2000) Semaphorin 3A is a chemoattractant for cortical apical dendrites. Nature 404, 567–573.[CrossRef][Medline]

Sakai, T., Furuyama, T., Ohoka, Y., et al. (1999) Mouse semaphorin H induces PC12 cell neurite outgrowth activating Ras-mitogen-activated protein kinase signaling pathway via Ca2+ influx. J. Biol. Chem. 274, 29666–29671.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Springer Harbor Laboratory Press.

Semaphorin Nomenclature Committee (1999) Unified nomenclature for the semaphorins/collapsins. Cell 97, 551–552.[CrossRef][Medline]

Shewan, D., Dwivedy, A., Anderson, R. & Holt, C.E. (2002) Age-related changes underlie switch in netrin-1 responsiveness as growth cones advance along visual pathway. Nature Neurosci. 5, 955–961.[CrossRef][Medline]

Song, H.J. & Poo, M.M. (1999) Signal transduction underlying growth cone guidance by diffusible factors. Curr. Opin. Neurobiol. 9, 355–364.[CrossRef][Medline]

Suda, T. & Nagata, S. (1994) Purification and characterization of the Fas-ligand that induces apoptosis. J. Exp. Med. 179, 873–879.[Abstract/Free Full Text]

Swiercz, J.M., Kuner, R., Behrens, J. & Offermanns, S. (2002) Plexin-B1 directly interacts with PDZ-RhoGEF/LARG to regulate RhoA and growth cone morphology. Neuron 35, 51–63.[CrossRef][Medline]

Tamagnone, L., Artigiani, S., Chen, H., et al. (1999) Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99, 71–80.[CrossRef][Medline]

Taniguchi, M., Yuasa, S., Fujisawa, H., et al. (1997) Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection. Neuron 19, 519–530.[CrossRef][Medline]

Tessier-Lavigne, M. & Goodman, C.S. (1996) The molecular biology of axon guidance. Science 274, 1123–1133.[Abstract/Free Full Text]

Wong, J.T., Wong, S.T. & O'Connor, T.P. (1999) Ectopic semaphorin-1a functions as an attractive guidance cue for developing peripheral neurons. Nature Neurosci. 2, 798–803.[CrossRef][Medline]

Received: 22 March 2004
Accepted: 7 June 2004




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Hirschberg, S. Deng, A. Korostylev, E. Paldy, M. R. Costa, T. Worzfeld, P. Vodrazka, A. Wizenmann, M. Gotz, S. Offermanns, et al.
Gene Deletion Mutants Reveal a Role for Semaphorin Receptors of the Plexin-B Family in Mechanisms Underlying Corticogenesis
Mol. Cell. Biol., February 1, 2010; 30(3): 764 - 780.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
L. Capparuccia and L. Tamagnone
Semaphorin signaling in cancer cells and in cells of the tumor microenvironment - two sides of a coin
J. Cell Sci., June 1, 2009; 122(11): 1723 - 1736.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Parrinello, L. A. Noon, M. C. Harrisingh, P. W. Digby, L. H. Rosenberg, C. A. Cremona, P. Echave, A. M. Flanagan, L. F. Parada, and A. C. Lloyd
NF1 loss disrupts Schwann cell-axonal interactions: a novel role for semaphorin 4F
Genes & Dev., December 1, 2008; 22(23): 3335 - 3348.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Korostylev, T. Worzfeld, S. Deng, R. H. Friedel, J. M. Swiercz, P. Vodrazka, V. Maier, A. Hirschberg, Y. Ohoka, S. Inagaki, et al.
A functional role for semaphorin 4D/plexin B1 interactions in epithelial branching morphogenesis during organogenesis
Development, October 15, 2008; 135(20): 3333 - 3343.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. R. Sierra, S. Corso, L. Caione, V. Cepero, P. Conrotto, A. Cignetti, W. Piacibello, A. Kumanogoh, H. Kikutani, P. M. Comoglio, et al.
Tumor angiogenesis and progression are enhanced by Sema4D produced by tumor-associated macrophages
J. Exp. Med., July 7, 2008; 205(7): 1673 - 1685.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. H. Conrad, J. M. Strafuss, M. D. Wittman, S. Conway, and G. W. Conrad
Thyroxine Increases the Rate but Does Not Alter the Pattern of Innervation during Embryonic Chick Corneal Development
Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 139 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Deng, A. Hirschberg, T. Worzfeld, J. Y. Penachioni, A. Korostylev, J. M. Swiercz, P. Vodrazka, O. Mauti, E. T. Stoeckli, L. Tamagnone, et al.
Plexin-B2, But Not Plexin-B1, Critically Modulates Neuronal Migration and Patterning of the Developing Nervous System In Vivo
J. Neurosci., June 6, 2007; 27(23): 6333 - 6347.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. H. Friedel, G. Kerjan, H. Rayburn, U. Schuller, C. Sotelo, M. Tessier-Lavigne, and A. Chedotal
Plexin-B2 Controls the Development of Cerebellar Granule Cells
J. Neurosci., April 4, 2007; 27(14): 3921 - 3932.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Barberis, A. Casazza, R. Sordella, S. Corso, S. Artigiani, J. Settleman, P. M. Comoglio, and L. Tamagnone
p190 Rho-GTPase activating protein associates with plexins and it is required for semaphorin signalling
J. Cell Sci., October 15, 2005; 118(20): 4689 - 4700.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masuda, K.
Right arrow Articles by Inagaki, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masuda, K.
Right arrow Articles by Inagaki, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE ADVANCED SEARCH TABLE OF CONTENTS